RPA combined Cas12b detection method and kit for strawberry vein banding virus

Abstract

The invention discloses a method for detecting RPA (recombinase polymerase amplification) combined Cas12b of strawberry vein banding virus in strawberry leaves and a special kit thereof. The detection method comprises the following steps: extracting total DNA of a strawberry leaf sample to be detected; carrying out RPA (recombinase polymerase amplification) combined Cas12b amplification by taking DNA (deoxyribonucleic acid) as a template and utilizing a primer and reagent combination; and fluorescence observation or test strip detection can be carried out on a reaction product by using different probes so as to judge whether a sample contains the strawberry vein banding virus or not. The primer combination comprises an RPA (recombinase polymerase amplification) primer group, sgRNA (single guide ribonucleic acid) and a probe, the RPA primer group is composed of an upstream primer as shown in a sequence 1 in a sequence table and a downstream primer as shown in a sequence 2 in the sequence table; the sequence of the sgRNA is shown as a sequence 3 in the sequence table. The detection method disclosed by the invention has the characteristics of rapidness, accuracy, strong specificity, high sensitivity, easiness in distinguishing a detection result, cost saving and the like, provides technical support for early diagnosis and monitoring of the strawberry vein banding virus, and has very important significance on prevention and control of field virus diseases.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant virology, and particularly relates to a RPA combined Cas12b detection method for strawberry vein banding virus in strawberry leaves and a special kit. BACKGROUND

[0002] Strawberry (Fragaria x ananassa Duch) is a perennial herb of the genus Fragaria in the Rosaceae family. It is native to South America and has become a popular fruit due to its nutritional value and sweet taste. It is widely cultivated worldwide due to its adaptability and early fruiting, and its yield has ranked second among berry fruits globally. With the continuous progress of greenhouse cultivation technology in China, China has become the world's largest strawberry producer. As of 2016, China accounted for 41% of the world's strawberry production. As of 2021, China's strawberry cultivation area reached 189,000 hm2, with an annual yield of 3,449,000 tons, making it the largest strawberry producer and consumer in the world.

[0003] Strawberry vein banding virus belongs to the Caulimovirus genus of the Caulimoviridae family and is a circular double-stranded DNA (dsDNA) virus. The virus particle is spherical and has no envelope, with a diameter of 40-55 nm. The genome is a circular double-stranded DNA, with a total length of 7876 bp, encoding 7 open reading frames (ORFs). Strawberry vein banding virus was first discovered in 1952 on the strawberry variety Fairfax introduced from the United States and Brazil in the United Kingdom. It has been reported worldwide. The virus is a semi-persistent aphid-borne virus that can be transmitted by strawberry aphids and other insects, and can also be transmitted by grafting. Infected plants show symptoms such as stunted growth, faded green leaf veins, irregular yellow edges on leaves, and thin and deformed new leaves. To reduce the harm of SVBV to strawberries, it is necessary to diagnose SVBV and remove infected strawberry seedlings in advance. Establishing an effective detection technology at the molecular level is of great significance for SVBV.

[0004] Stolon-based cutting is the main propagation method for strawberry production in agriculture. Virus diseases can spread widely and rapidly through infected stolons, so selecting healthy strawberry plants as mother plants to control virus diseases from the source is one of the most economical and effective measures for field control of virus diseases. Strawberry vein banding virus has a latent symptom in the field, which means that the symptoms temporarily disappear under certain environmental conditions. Once the suitable conditions for disease occurrence are restored, the symptoms can reappear. This phenomenon makes it difficult to determine whether asymptomatic plants carry viruses in the field.

[0005] The RPA (recombinase polymerase amplification) combined Cas12b detection system is a synchronous reaction of adding the Cas12b detection system in the RPA amplification reaction system, and the specific site is detected by using the Cas12b system while the RPA isothermal amplification is carried out, so that the pathogen in the strawberry can be detected by observing the fluorescence or observing the test strip. The technology has been widely used in the detection of viruses, bacteria, fungi and other pathogens due to its convenience, rapidness and accuracy. At present, there is no related literature and patent using the RPA combined Cas12b detection technology for detecting SVBV virus. The present application establishes an RPA combined Cas12b detection method and special kit for strawberry veinbanding virus in strawberry leaves, which can detect SVBV conveniently, rapidly and accurately, and provides technical support for early diagnosis of strawberry veinbanding virus, and has great significance for the prevention and control of field virus diseases. SUMMARY

[0006] The purpose of the present application is to provide an RPA combined Cas12b primer, detection method and special kit for rapidly detecting strawberry veinbanding virus in strawberry leaves. The method has the characteristics of convenience, rapidness, accuracy, strong specificity, high sensitivity and easy-to-distinguish detection results.

[0007] The first aspect of the present application provides an RPA combined Cas12b primer combination for rapidly detecting strawberry veinbanding virus, characterized in that it comprises an RPA primer combination, an sgRNA and a probe; wherein the RPA primer combination is a specific primer for detecting strawberry veinbanding virus, and the nucleotide sequence is:

[0008] The SVBV RPA-F (upstream primer) is:

[0009] CCATAAAAAAGCTAAGAAAAAGAAGTACAAGC (sequence 1 in the sequence listing);

[0010] The SVBV RPA-R (downstream primer) is: CCGTCTCTTCTTTCTGGTTTCTTTTCCTGCG (sequence 2 in the sequence listing).

[0011] The sgRNA for detecting strawberry veinbanding virus has the nucleotide sequence of:

[0012] The sgRNA is: CCTGCGAAAAAGTTTTCTAC (sequence 3 in the sequence listing).

[0013] The nucleotide sequence of the probe for detecting strawberry veinbanding virus is:

[0014] The ssDNA probe 1 is: 5'-FAM-TTTTTTT-Biotin-3'

[0015] ssDNA probe2: 5'-FAM-TTTTTTT-BHQ1-3'

[0016] FAM is the fluorescent group of the probe, and Biotin and BHQ1 are the quenching groups of the probe.

[0017] The primer combination can also include a positive plasmid primer for detecting strawberry vein banding virus,

[0018] The primer for detecting the positive plasmid of strawberry vein banding virus has the nucleotide sequence of:

[0019] PCR-F: AGCTTCTTCAACGGGAGAAG (sequence 4 in the sequence listing)

[0020] PCR-R: TGTTTTCCCTTGCGGGCAGA (sequence 5 in the sequence listing)

[0021] The above-mentioned primer, sgRNA and probe combination of the present application are RPA combined Cas12b detection design components, which can be used for rapid detection of strawberry vein banding virus in strawberry leaves.

[0022] The second aspect of the present application provides an RPA combined Cas12b detection method for rapidly detecting strawberry vein banding virus in strawberry leaves, comprising the following steps:

[0023] (1) Extracting total DNA from the strawberry leaf sample to be tested;

[0024] (2) Using the above-mentioned primer and corresponding component combination as a template, performing RPA combined Cas12b detection;

[0025] The total volume of the RPA combined Cas12b detection reaction system is 29 μL, wherein the RPA-Cas12b system contains dry powder dissolving solution 12 μL, magnesium acetate 2 μL, AaCas12b 1 μL, sgRNA 1 μL, 10×AaCas12bBuffer 2.5 μL, 800 nM of ssDNA probe1 (or ssDNA probe2) 0.5 μL, SVBV RPA-F 2.0 μL, SVBV RPA-R 2.0 μL, DNA 1.0 μL and sterilized ddH2O 5.0 μL.

[0026] The RPA combined Cas12b detection reaction procedure is: 42℃ RPA-Cas12b system constant temperature reaction for 60 min.

[0027] (3) Result determination: when using ssDNA probe 1, the RPA combined Cas12b detection reaction product is added to the sample pad of the test strip, and when the T zone appears a strip after waiting for 15 min, it indicates that the strawberry leaf contains strawberry vein banding virus; when using ssDNA probe 2, the fluorescence signal is observed by using the corresponding instrument with excitation and emission wavelengths of 488 / 520 nm, and when the fluorescence signal appears or the green fluorescence is observed by naked eye, it indicates that the strawberry leaf contains strawberry vein banding virus.

[0028] The application also provides a kit for detecting SVBV by using RPA combined Cas12b, comprising the above-mentioned RPA combined Cas12b primer combination, AaCas12b, 10x AaCas12b Buffer, sterilized ddH2O and positive control.

[0029] The positive control is a recombinant plasmid obtained by connecting the nucleotide fragment described in sequence 6 in the sequence table and pBM23.

[0030] The application has the following beneficial effects:

[0031] (1) The RPA primer obtained by screening in the application has good specificity and convenience in combination with Cas12b, and the whole detection process can quickly and simply amplify and detect the target. The detection process does not require complex instruments and operations, and the positive product is clear and easy to identify, with high accuracy.

[0032] (2) The detection method provided by the application realizes simultaneous Cas12b detection in the RPA reaction system, can quickly detect viruses existing in strawberries, reduces detection cost, shortens detection time, improves detection efficiency, has the characteristics of high efficiency, rapidness and accuracy, is suitable for large-scale detection of strawberry virus disease samples, provides basis for seedling virus detection and targeted prevention and treatment of diseases caused by SVBV virus, achieves the purpose of early targeted disease prevention, and can be popularized and used in scientific research and disease monitoring departments.

[0033] (3) The kit of the application comprises reagents and primers for realizing SVBV detection, and is convenient and fast to use.

[0034] (4) The detection target of the SVBV virus in the application has not been reported. BRIEF DESCRIPTION OF DRAWINGS

[0035] Figure 1 For primer specificity retrieval verification, the Primer-Blast retrieval result of the primer pair SVBV RPA-F / SVBV RPA-R.

[0036] Figure 2, the effect of different ssDNA concentrations on the results of RPA combined with Cas12b detection of SVBV. Figure A is the reaction of ssDNA at 1000 nM, 800 nM, 600 nM, 400 nM, 200 nM, and the visual observation under ultraviolet light. In the figure, A: ssDNA concentration 1000 nM; B: ssDNA concentration 800 nM; C: ssDNA concentration 600 nM; D: ssDNA concentration 400 nM; E: ssDNA concentration 200 nM.

[0037] Figure 3 , the effect of different primer concentrations on the results of RPA combined with Cas12b detection of SVBV. The corresponding reaction temperatures are 46°C, 44°C, 42°C, 40°C, 38°C, and 36°C, respectively. In the figure, A: Cas12b concentration 50 ng / μL, sgRNA concentration 100 ng / μL; B: Cas12b concentration 25 ng / μL, sgRNA concentration 50 ng / μL; C: Cas12b concentration 12.5 ng / μL, sgRNA concentration 25 ng / μL; D: Cas12b concentration 6.25 ng / μL, sgRNA concentration 12.5 ng / μL; E: Cas12b concentration 0 ng / μL, sgRNA concentration 0 ng / μL;

[0038] Figure 4 , the effect of different Cas12b protein (nM) / sgRNA (nM) concentrations on the results of RPA combined with Cas12b detection of SVBV. The corresponding contents are 50 / 100, 25 / 50, 12.5 / 25, and 6.25 / 12.5 reaction conditions and visual observation under ultraviolet light. Note: The figure is the fluorescence curve when the primer concentration is 100 nM, 10 nM, 1 nM, and 0.1 nM.

[0039] Figure 5 , the effect of different reaction temperatures on the results of RPA combined with Cas12b detection of SVBV. The primer concentration is 100 nM, 10 nM, 1 nM, and 0.1 nM. The reaction system was amplified at 46°C, 44°C, 42°C, 40°C, 38°C, and 36°C for 90 min.

[0040] Figure 6 Comparison of the sensitivity of RPA combined with Cas12b detection of SVBV and PCR.

[0041] A is RPA combined with Cas12b detection of SVBV. Figures 1-8 are diluted to 10 -1 ~ 10 -8 times.

[0042] B is PCR detection of SVBV. M is Marker. Figures 1-8 are diluted to 10-1 ~ 10 -8 fold, - is a negative control.

[0043] Figure 7 Figure 6 is a result of detecting field collected strawberry leaf samples by using the SVBV system combined with RPA and Cas12b. M is DL2000 DNA Marker, 1-8: field samples, +: positive control, -: negative control.

[0044] Figure 7 Figure 7 is a result of detecting field collected strawberry leaf samples by using the SVBV system combined with RPA and Cas12b. A is a result of PCR detection, 1-8: field samples 1-8; +: positive control; - : negative control.

[0045] Figure 7 Figure 8 is a result of detecting field collected strawberry leaf samples by using the SVBV system combined with RPA and Cas12b. B is a result of using fluorescent probe detection, 1-8: field samples 1-8; +: positive control; - : negative control.

[0046] Figure 1 Figure 9 is a result of detecting field collected strawberry leaf samples by using the SVBV system combined with RPA and Cas12b. C is a result of using test strip detection, T: detection line; C: quality control line; 1-8: field samples 1-8; +: positive control; - : negative control. DETAILED DESCRIPTION

[0047] In order to better understand the present application, the present application will be further described below in combination with specific examples.

[0048] The following examples facilitate better understanding of the present application, but do not limit the present application. In the following examples, the test methods are conventional methods, unless otherwise specified. In the following examples, the materials and reagents used, unless otherwise specified, can be obtained from commercial channels.

[0049] Example 1: Design, screening and RPA primer specificity search verification of RPA detection primer and sgRNA in RPA combined with Cas12b detection of strawberry vein banding virus (SVBV)

[0050] I. sgRNA design

[0051] According to the CP sequence of strawberry virus, the corresponding PAM site (TTN) is found. The chain where TTN is located is the NTS (nontarget sequence) chain, and the corresponding chain is the TS (target sequence) chain. The 20-base sequence after the PAM site (5'→3' direction) is the target of sgRNA binding, and the sgRNA is designed. The primer is synthesized by Beijing Xunsi Technology Co., Ltd.

[0052] II. sgRNA screening

[0053] 1. Extraction of total DNA from strawberry leaf tissue

[0054] The total DNA of the strawberry was extracted by using the Biomed broad-spectrum plant genomic DNA rapid extraction kit, and the extraction instructions were followed.

[0055] 2, sgRNA screening

[0056] The total volume of the PCR reaction system was 25 μL, which contained 2x Taq PCR Mastermix 12.5 μL, 10 μmol / L of the upstream and downstream primers 0.5 μL each, DNA 2 μL and sterilized ddH2O 9.5 μL; the PCR reaction program was as follows: 94 ℃ pre-denaturation for 3 min; 94 ℃ denaturation for 30 s, 56 ℃ annealing for 30 s, 72 ℃ extension for 60 s, 35 cycles; 72 ℃ extension for 5 min; 5 μL of the PCR product was added to the CRISPR detection system and reacted at 43 ℃ for 90 min, and the fluorescence was observed every minute to observe the sgRNA cleavage activity.

[0057] Construction of recombinant plasmid: PCR primers were designed according to the designed sgRNA position, and the target band was detected by 2% agarose gel electrophoresis. The cloning vector for constructing the RPA product was obtained by referring to the methods of PCR product purification, ligation cloning vector and transformation of competent cells.

[0058] 3, primer screening

[0059] Screening of the primer for detecting SVBV by RPA combined with Cas12b: the DNA of the diseased leaves obtained in step 1 was used as a template, and the primer pair SVBV RPA-F / SVBV RPA-R (Table 1) was screened out by amplifying the RPA combined with Cas12b detection SVBV system, which had short reaction time, high fluorescence expression and stable reaction results.

[0060] Table 1 Specific primer combination sequence for detecting SVBV virus

[0061]

[0062] III. Specificity verification

[0063] In order to verify the specificity of the primers designed in the application, the Primer-BLAST tool in NCBI (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) was used to search the specificity of the primers. In the search setting, the length of the PCR amplification product was 70-1000 bp, the length of the maximum amplification product was 1000 bp, and the NR database was searched. The primer pair SVBVRPA-F / SVBV RPA-R was searched to have one amplification product, and the product length was 146 bp, which was SVBV. Figure 2 ​

[0064] Example 2: Establishment of RPA combined with Cas12b detection system for strawberry vein banding virus

[0065] The RPA combined with Cas12b primer combination for rapid detection of strawberry vein banding virus of the application comprises an RPA primer set, an sgRNA and a probe; wherein,

[0066] The RPA primer set is a specific primer for detecting strawberry vein banding virus, and the nucleotide sequence thereof is:

[0067] SVBV RPA-F (upstream primer):

[0068] CCATAAAAAAGCTAAGAAAAAGAAGTACAAGC (sequence 1 in the sequence listing);

[0069] SVBV RPA-R (downstream primer): CCGTCTCTTCTTTCTGGTTTCTTTTCCTGCG (sequence 2 in the sequence listing).

[0070] The sgRNA for detecting strawberry vein banding virus has the nucleotide sequence of:

[0071] sgRNA: CCTGCGAAAAAGTTTTCTAC (sequence 3 in the sequence listing).

[0072] The nucleotide sequence of the probe for detecting strawberry vein banding virus is:

[0073] ssDNA probe1: 5'-FAM-TTTTTTT-Biotin-3'

[0074] ssDNA probe2: 5'-FAM-TTTTTTT-BHQ1-3'

[0075] FAM is the fluorescent group of the probe, and Biotin and BHQ1 are the quenching groups of the probe.

[0076] The primer combination can further comprise a positive plasmid primer for detecting strawberry vein banding virus,

[0077] The primer for detecting the positive plasmid of strawberry vein banding virus has the nucleotide sequence of:

[0078] PCR-F: AGCTTCTTCAACGGGAGAAG (sequence 4 in the sequence listing)

[0079] PCR-R: TGTTTTCCCTTGCGGGCAGA (sequence 5 in the sequence listing)

[0080] Optimization of PCR reaction system: Using the DNA of the diseased leaves obtained in step two of Example 1 as the template, the ssDNA concentration, Cas12b protein and sgRNA concentration, primer concentration and reaction temperature in the reaction system were optimized by adjusting the gradient level of individual test factors in sequence, and the fluorescence signal was collected every minute using a qPCR instrument.

[0081] 1. Optimization of different ssDNA concentrations: When the volume of ssDNA was 0.5 μL, five concentration gradients were set. Considering the highest fluorescence expression, reaction time, cost and other factors, the optimal ssDNA concentration was 800 nM ( Figure 3 ) ;

[0082] 2. Optimization of Cas12b protein / sgRNA concentration: The Cas12b protein / sgRNA concentration was set to four gradients, i.e. 50 / 100, 25 / 50, 12.5 / 25 and 6.25 / 12.5. Considering the highest fluorescence expression and other factors, the optimal Cas12b protein / sgRNA content was Cas12b protein 50 nM and sgRNA nM ( Figure 4 ) ;

[0083] 3. Optimization of different primer concentrations: Four concentration gradients were set. Considering the fluorescence intensity and reaction time, the optimal primer concentration was 10 nM ( Figure 5 ) ;

[0084] 4. Optimization of different reaction temperatures: Six temperature gradients were set for reaction. Considering the reaction time and the highest fluorescence expression, the optimal reaction temperature was 42℃ ( Figure 6 ).

[0085] Table 2, RPA combined with Cas12b detection of strawberry vein banding virus reaction system optimization experimental treatment setting

[0086]

[0087] Through the above amplification condition optimization, the following RPA combined with Cas12b detection of strawberry vein banding virus method was obtained: the total volume of the reaction system was 29 μL, which contained 10 nM SVBV RPA-F 2 μL, 10 nM SVBV RPA-R 2 μL, 50 ng / μL AaCas12b 1 μL, 10×AaCas12b Buffer 2.5 μL, 800 nM ssDNA probe1 (or ssDNA probe2) 0.5 μL, 100 ng / μL sgRNA 1 μL, ddH2O 5 μL, magnesium acetate 2 μL, dry powder dissolving solution 12 μL.

[0088] The reaction procedure is as follows: the components and templates are added to the system, and when ssDNA probe 1 is used, the reaction is carried out at 42℃ for 60 min, the product is added dropwise on the test strip and waits for 15 min; when ssDNA probe 2 is used, the reaction is carried out at 42℃ for 60 min, and the fluorescence is observed. When ssDNA probe 1 is used, the reaction product is diluted with sterile ddH2O to 50 μL, and the diluted product is added to the sample pad of the test strip, and the dropwise position does not exceed the MAX line. When a band appears in the T zone of the test strip, it is positive, indicating that the strawberry leaf contains strawberry veinbanding virus; there is no band in the T zone and the C zone, which is invalid. When ssDNA probe 2 is used, the fluorescence signal is observed by exciting and emitting wavelength of 488 / 520 nm after RPA combined with Cas12b reaction. When the fluorescence signal appears or green fluorescence is observed, it indicates that the strawberry leaf contains strawberry veinbanding virus.

[0089] Example 3: Establishment of the kit for detecting strawberry veinbanding virus by RPA combined with Cas12b according to the present application

[0090] The kit for detecting strawberry veinbanding virus by RPA combined with Cas12b according to the present application comprises AaCas12b, 10×AaCas12b Buffer, sgRNA, ssDNA probe 1, ssDNA probe 2, amplification buffer A, magnesium acetate, isothermal amplification freeze-dried powder, sterile ddH2O, SVBV upstream and downstream primers (primer pair SVBV RPA-F / SVBV RPA-R), and positive control.

[0091] The positive control is as follows:

[0092] The positive control: the positive sample is amplified with primer pair PCR-F / PCR-R to obtain specific fragment sequence (sequence 6 in the sequence table), purified and recovered, respectively, and connected with pBM32 vector, transformed into DH5α, and after the positive clone obtained is verified by sequencing, the plasmid is extracted and used as the positive control of the kit.

[0093] The kit can be used for detecting SVBV virus and realizing the RPA combined with Cas12b detection system for strawberry veinbanding virus established according to example 2.

[0094] Example 4: Specificity verification of the detection system according to the present application

[0095] In order to verify the specificity of the primers designed in the application, the total RNA of strawberry leaves infected with strawberry mild yellow edge virus (SMYEV), strawberry mottle virus (SMoV) and strawberry vein banding virus (SVBV) was extracted by using an EASYspin plant RNA rapid extraction kit, and reverse transcription was performed by using a reverse transcription reagent purchased from Baorui Biotechnology (Beijing) Co., Ltd. The above samples were detected by using the RPA combined with Cas12b detection system for strawberry vein banding virus established in Example 2, and no specific results were found, indicating that the detection method established in the application has strong specificity.

[0096] Example 5: Comparison of the sensitivity of the RPA combined with Cas12b detection system for strawberry vein banding virus of the application and the PCR detection system

[0097] The DNA of the diseased strawberry leaves obtained in Example 1 was diluted by 10 times gradient to 10 -1 ~ 10 -8 The undiluted and diluted DNA was used as a template to detect SVBV by using PCR and the multiple RPA combined with Cas12b detection system for strawberry vein banding virus established in Example 4, and the results showed that when the RPA combined with Cas12b was used to detect SVBV, the samples diluted by 10 times, 100 times, 1000 times, 10000 times, 100000 times and 1000000 times could all detect SVBV (Fig. 2A); when PCR was used to detect SVBV, the band of SVBV was fuzzy when diluted by 1000 times (Fig. 2B), and the above results showed that the detection sensitivity of RPA-Cas12b technology was 1000 times higher than that of PCR technology. Figure 6 ​

[0098] Example 6: Detection of strawberry leaf samples collected in the field by using the detection kit of the application

[0099] The detection kit of the application was used to detect 8 strawberry leaf samples collected in the field and showing virus disease symptoms, and the results showed that SVBV virus was detected in samples 1, 4 and 6. The results of fluorescence probe detection, test strip detection and PCR detection were consistent.​​

Claims

1. A rapid detection method for strawberry vein banding virus (SVBV) using an RPA-binding Cas12b primer combination, characterized in that, It includes an RPA primer set, sgRNA, and a probe; the RPA primer set consists of an upstream primer as shown in Sequence 1 of the sequence listing and a downstream primer as shown in Sequence 2 of the sequence listing; the sequence of the sgRNA is shown in Sequence 3 of the sequence listing; the structure of the probe sequence is 5′-FAM-TTTTTTT-Biotin-3′ or 5′-FAM-TTTTTTT-BHQ1-3′; FAM is the fluorescent group of the probe, and Biotin and BHQ1 are the quenching groups of the probe.

2. A rapid test kit for detecting whether strawberries are infected with strawberry vein virus, comprising the RPA-Cas12b primer combination as described in claim 1.

3. The kit according to claim 2, characterized in that: The kit also includes AaCas12b, 10×AaCas12b Buffer, Amplification Buffer A, Magnesium Acetate, Isothermal Amplification Lyophilized Powder, and Sterile ddH2O.

4. The kit according to claim 2, characterized in that: The kit also includes a positive control; the positive control is a recombinant plasmid consisting of the nucleotide fragment described in sequence 6 of the sequence listing and pBM23.

5. The kit according to claim 4, characterized in that: The kit also includes primers for detecting positive plasmids of strawberry vein virus, the primers being composed of nucleotides shown in sequence 4 and sequence 5 of the sequence listing.

6. The application of the RPA-Cas12b primer combination of claim 1 and the kit of any one of claims 2-5 in the rapid detection of strawberry variegation virus infection.

7. A method for rapidly detecting whether strawberries are infected with strawberry vein virus, comprising the following steps: 1) Extract total DNA from strawberry leaf samples; 2) Using total DNA from plant samples as a template, RPA-bound Cas12b amplification was performed using the primers described in claim 1 or the kit described in any one of claims 2-5; The total volume of the RPA-Cas12b detection reaction system was 29 μL, of which... It contains 12 μL of dry powder dissolving solution, 2 μL of magnesium acetate, 1 μL of AaCas12b, 1 μL of sgRNA, 2.5 μL of 10×AaCas12b Buffer, 0.5 μL of 800 nM ssDNA probe1 (or ssDNA probe2), 2.0 μL of SVBV RPA-F, 2.0 μL of SVBV RPA-R, 1.0 μL of DNA, and 5.0 μL of sterile ddH2O. (3) Result determination: When the probe is 5′-FAM-TTTTTTT-Biotin-3′, the reaction product is diluted to 50 μL with sterile ddH2O. The diluted product is added to the sample pad of the test strip, and the drop position does not exceed the MAX line. When a band appears in the T area of ​​the test strip, it is positive, indicating that the strawberry leaf contains strawberry vein virus. No bands in the T and C areas are invalid. When the probe is 5′-FAM-TTTTTTT-BHQ1-3′, after the RPA reacts with Cas12b, the fluorescence signal is observed by the corresponding instrument with excitation and emission wavelengths of 488 / 520 nm. When a fluorescence signal appears or green fluorescence is observed, it indicates that the strawberry leaf contains strawberry vein virus.

8. The method according to claim 7, characterized in that: The reaction conditions for RPA-Cas12b amplification were: constant temperature reaction at 42℃ for 60 min; the RPA-Cas12b amplification reaction procedure was: when using ssDNA probe1, RPA-Cas12b reaction amplification at 42℃ for 60 min, and the product was dropped onto the test strip and the result was observed after 15 min. When using ssDNA probe2, react with RPA-Cas12b at 42℃ for 60 min, and observe the fluorescence under UV light.

Images