Application of traditional Chinese medicine composition in preparation of food, health food and / or medicine for relieving or improving sub-health caused by staying up late

Abstract

The invention relates to the technical field of food and / or medicine, and provides application of a traditional Chinese medicine composition in preparation of food, health food and / or medicine for relieving or improving sub-health caused by staying up late, the composition is prepared from the following raw materials in parts by weight: 100-500 parts of centella asiatica, 200-600 parts of pachyrhizua angulatus, 100-500 parts of hovenia dulcis thunb, 100-500 parts of lalang grass rhizome, 100-500 parts of hawthorn and 100-300 parts of chrysanthemum. The composition provided by the invention can relieve or improve sub-health states such as biological clock rhythm disorder and memory function decline caused by staying up late, reduces harm and injury after staying up late, meets new requirements of people for health, is beneficial to improving the life quality of people, and has a good market prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of food and / or medicine technology, and in particular to the application of a traditional Chinese medicine composition in the preparation of food, health food and / or medicine for relieving or improving sub-health caused by staying up late. BACKGROUND

[0002] In modern society, due to various factors of life and work, people's life rhythm is getting faster and faster, and the phenomenon of staying up late is becoming more and more common. The China Sleep Research Report 2022 pointed out that the sleep duration of Chinese people is insufficient, and the average sleep duration per day is 7.06 hours, which is nearly 1.5 hours shorter than ten years ago. Only 35% of Chinese people can sleep for 8 hours. The 2024 China Residents' Sleep White Paper released by the China Sleep Research Association shows that the average sleep time of Chinese residents is after midnight, and the average sleep duration is generally short, only 6.75 hours. It is particularly noteworthy that "post-00s" have become the main force of staying up late, showing a trend of "the younger, the more they can stay up". The data released by the 2024 China Residents' Sleep Health White Paper shows that the average sleep time of "post-00s" college students is 00:33, nearly half of the students use mobile phones for more than 8 hours a day, and 51% of them go to sleep after midnight, and 19% of them go to sleep after 2:00. This data reveals that "post-00s" college students have become the main force of staying up late. These data reports emphasize the seriousness of the problem of staying up late.

[0003] Staying up late is an unhealthy lifestyle habit, and its harm involves multiple aspects. Staying up late can harm the nervous system, endocrine system, immune system, and stress system of the body.

[0004] Staying up late directly interferes with the normal operation of the biological clock. The biological clock is a key mechanism that regulates the rhythm of physiological activities in our body, and it regulates our sleep-wake cycle, hormone secretion, body temperature, and many other physiological processes. When staying up late breaks this natural rhythm, the biological clock will be disordered, leading to a series of physiological disorders.

[0005] The disorder of the biological clock will further increase oxidative stress. Oxidative stress is caused by the imbalance between oxidation and antioxidant effects in the body, which can damage cells and tissues. The disorder of the biological clock can affect the normal function of the antioxidant system, making the body more susceptible to oxidative damage.

[0006] The disorder of the biological clock and the increase of oxidative stress can also activate inflammatory factors. Inflammatory factors are involved in immune responses under normal circumstances, but excessive or persistent inflammatory responses can cause tissue damage and disease. The disorder of the biological clock and oxidative stress can trigger the release of inflammatory factors, further exacerbating the inflammatory response.

[0007] The biological clock rhythm disorder can further affect the expression of biological clock related genes. The biological clock regulates the rhythmicity of the organism by regulating the expression level and activity of genes. When the biological clock rhythm is disordered, the expression level of some key genes will change, thereby affecting the stability of the biological clock and the normal progress of physiological activities. The change of the expression of biological clock related genes can further affect the memory. The biological clock is closely related to the memory function, which regulates the sleep quality, and sufficient sleep is the key to memory storage and retrieval. When the expression of biological clock related genes is abnormal, the sleep quality will decrease, thereby affecting the performance of memory. In addition, the biological clock also affects the peak period of attention and thinking activity, which is an important factor affecting memory. Scientists at Stanford University found that when the circadian rhythm is disrupted, the suprachiasmatic nucleus (SCN) of the brain will interfere with learning and memory. This shows that the disorder of the biological clock indeed has a negative impact on memory. Although the impact of staying up late on long-term memory is not obvious, it still causes significant damage to memory over a long period of time.

[0008] In addition, long-term staying up late can lead to biological clock rhythm disorder and even speed up the aging process. Sleep is an important way for the body to repair itself, and staying up late can accelerate the aging of the body and promote the occurrence of various diseases, and even cause sudden death of heart source.

[0009] In the information age, people inevitably stay up late for various reasons, and the number of people who stay up late voluntarily or involuntarily is high. However, the impact and damage of staying up late on the body are ignored by many people, and the great health problem hidden danger caused thereby has become a real problem that needs to be solved. Therefore, it is of great practical significance to seek a safe and effective composition containing traditional Chinese medicine ingredients for relieving or reducing the harm of staying up late, which is suitable for long-term use. SUMMARY

[0010] The purpose of the present application is to provide an application of a traditional Chinese medicine composition in the preparation of food, health food and / or medicine for relieving or improving sub-health caused by staying up late.

[0011] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions:

[0012] The application of the traditional Chinese medicine composition in the preparation of food, health food and / or medicine for relieving or improving sub-health caused by staying up late, wherein the traditional Chinese medicine composition is prepared from the following raw materials in parts by weight: 100-500 parts of Centella asiatica, 200-600 parts of Pachyrhizus, 100-500 parts of Hovenia dulcis, 100-500 parts of Imperata cylindrica, 100-500 parts of Crataegus pinnatifida, and 100-300 parts of Chrysanthemum.

[0013] Further, the traditional Chinese medicine composition is made from raw materials in the following weight proportions: 100 parts of Centella asiatica, 600 parts of Pueraria lobata, 100 parts of Hovenia dulcis, 500 parts of Imperata cylindrica, 100 parts of Crataegus pinnatifida, and 300 parts of Chrysanthemum.

[0014] Further, the traditional Chinese medicine composition is made from raw materials in the following weight proportions: 500 parts of Centella asiatica, 200 parts of Pueraria lobata, 500 parts of Hovenia dulcis, 100 parts of Imperata cylindrica, 500 parts of Crataegus pinnatifida, and 100 parts of Chrysanthemum.

[0015] Further, the traditional Chinese medicine composition is made from raw materials in the following weight proportions: 300 parts of Centella asiatica, 400 parts of Pueraria lobata, 300 parts of Hovenia dulcis, 300 parts of Imperata cylindrica, 300 parts of Crataegus pinnatifida, and 200 parts of Chrysanthemum.

[0016] Further, the traditional Chinese medicine composition is made from raw materials in the following weight proportions: 312 parts of Centella asiatica, 416 parts of Pueraria lobata, 312 parts of Hovenia dulcis, 312 parts of Imperata cylindrica, 312 parts of Crataegus pinnatifida, and 208 parts of Chrysanthemum.

[0017] Further, the sub-health caused by staying up late includes at least one of biological clock rhythm disorder, memory function decline (or memory function reduction), oxidative stress, or inflammatory response caused by staying up late.

[0018] Further, the sub-health caused by staying up late is biological clock rhythm disorder caused by staying up late.

[0019] Further, in the above application, the preparation form of the health food is an oral preparation.

[0020] Further, the oral preparation is a capsule, a tablet, a pill, a powder, a granule, an oral liquid, or a paste.

[0021] Further, the health food further comprises a supplementary material, the supplementary material is corn starch or sweet potato starch, and the weight of the supplementary material is 20-60 parts.

[0022] Further, the preparation method of the capsule comprises the following steps:

[0023] a. Raw material pretreatment: crushing Hovenia dulcis and reserving it;

[0024] b. Extraction: weighing Centella asiatica and Pueraria lobata, extracting them twice by ethanol reflux, filtering, and reserving the ethanol extract; weighing Hovenia dulcis, Imperata cylindrica, Crataegus pinnatifida, and Chrysanthemum, extracting them three times by water reflux, filtering the extract, and reserving the water extract;

[0025] c. Concentration: recovering ethanol from the ethanol extract obtained in step b, and concentrating it to an ethanol extract concentrate with a 60-degree hot-measuring relative density of 1.20-1.30 for reservation; reducing the pressure to concentrate the water extract obtained in step b to a water extract concentrate with a 60-degree hot-measuring relative density of 1.20-1.30 for reservation;

[0026] d. Drying: The alcohol extract concentrate and the water extract concentrate obtained in step c are vacuum dried respectively to obtain alcohol extract dry paste and water extract dry paste for standby;

[0027] e. Crushing: The alcohol extract dry paste and the water extract dry paste obtained in step d are crushed to pass through an 80-mesh sieve to obtain crushed powder for standby;

[0028] f. Mixing: The crushed powder obtained in step e is added to starch and mixed uniformly to obtain mixed powder for standby;

[0029] g. Granulation: The mixed powder obtained in step f is dry granulated to obtain granules for standby;

[0030] h. The granules obtained in step g are filled into capsules, packaged, inspected, and obtained.

[0031] Further, the preparation method of the above-mentioned capsules comprises the following steps:

[0032] a. Raw material pretreatment: The red dates are crushed for standby;

[0033] b. Extraction: The Centella asiatica and the Pueraria lobata are weighed, and 9 times the amount of 70% ethanol is added for reflux extraction for 2 hours each time, and the extract is filtered and combined, and the alcohol extract is standby; the red dates, Imperata cylindra, Crataegus pinnatifida Bunge, and Chrysanthemum are weighed, and 11 times the amount of water is added for reflux extraction for 1 hour each time, and the extract is filtered and combined, and the water extract is standby;

[0034] c. Concentration: The alcohol extract obtained in step b is recovered after ethanol is recovered, and concentrated to an alcohol extract concentrate with a 60-degree hot test relative density of 1.20-1.30 for standby; the water extract obtained in step b is reduced pressure concentrated to a water extract concentrate with a 60-degree hot test relative density of 1.20-1.30 for standby;

[0035] d. Drying: The alcohol extract concentrate and the water extract concentrate obtained in step c are vacuum belt dried respectively at a temperature of 110-120 degrees to obtain alcohol extract dry paste and water extract dry paste for standby;

[0036] e. Crushing: The alcohol extract dry paste and the water extract dry paste obtained in step d are crushed to pass through an 80-mesh sieve to obtain crushed powder for standby;

[0037] f. Mixing: The crushed powder obtained in step e is added to starch and mixed uniformly to obtain mixed powder for standby;

[0038] g. Granulation: The mixed powder obtained in step f is dry granulated to obtain granules for standby;

[0039] h. The granules obtained in step g are filled into capsules, packaged, inspected, and obtained.

[0040] The application is applied to adjusting the sub-health state caused by staying up late under the guidance of TCM theory and combining present medical theory, and a composition composed of gynostemma pentaphyllum, paeonia suffruticosa andrews, hovenia dulcis thunb, imperata cylindrica, crataegus pinnatifida bunge and chrysanthemum is used.

[0041] The monarch drug gynostemma pentaphyllum tastes bitter and pungent and is cold, and is returned to the liver, spleen and kidney channels. It can clear heat and remove dampness, and resolve toxicity and dissipate swelling. It is used for treating damp-heat jaundice, heatstroke, diarrhea, sandstone and blood stone, abscess and sore, and injury caused by falling and bruising. The Dian Nan Materia Medica records that it can treat meridian heat, dizziness, cold, body aches, loss of appetite, and so on. There is a theory of meridian flow in TCM theory, and the hours from 1 to 3 am are the time when the liver channel is in charge. The Yellow Emperor's Classic of Internal Medicine-Su Wen records that when people sleep, blood returns to the liver. The liver governs blood storage, and if people stay up late for a long time, blood cannot return to the liver, and the liver cannot be protected. The liver and the kidney are homologous, so the kidney yin is deficient, and staying up late for a long time can easily cause the deficiency of the spleen and stomach and the deficiency of the liver and kidney. Gynostemma pentaphyllum returns to the liver, spleen and kidney channels to protect the stomach and spleen, and has the effects of tonifying the liver and kidney and clearing heat and resolving toxicity.

[0042] The minister drug paeonia suffruticosa andrews is cool, and tastes sweet and pungent. It returns to the stomach and spleen channels. It can resolve the muscle and reduce fever, generate fluid, penetrate rash, raise yang and stop diarrhea. It belongs to the category of pungent and cool drugs for resolving the exterior. The Nature of Drugs records that it can treat the upper respiratory tract infection, vomiting, open the stomach and promote food intake, treat alcohol poisoning, and stop thirst. The Alternative Records records that it can treat headache caused by cold and wind, resolve the muscle, release the exterior, sweat, open the pores, treat gold wound and pain, and treat pain caused by wind, generate root juice, treat diabetes, and treat heat and high fever. The Theory of Spleen and Stomach records that if people are tired, the spleen is damaged first, and then the stomach cannot transport the water and nutrient essence, and the stomach is also damaged, finally leading to the deficiency of the spleen and stomach. Overwork and overuse of the brain can damage the spleen and stomach, and the function of the gastrointestinal nervous system is affected. Paeonia suffruticosa andrews enters the spleen and stomach channels to have the effects of tonifying qi and resolving the exterior, and invigorating the spleen and nourishing the stomach.

[0043] The minister drug hovenia dulcis thunb tastes sweet and sour, and is neutral. It returns to the heart and spleen channels. It can treat alcohol poisoning, heat, thirst, vomiting and incontinence. The Dian Nan Materia Medica records that it can tonify the middle and benefit qi. Phlegm fire is closed in the chest, and it can be resolved. The heart governs blood vessels and spirit, and the spleen is the root of acquired constitution and the source of blood and nutrient essence. Long-term staying up late can cause symptoms of injury to the heart and spleen, such as dizziness, swelling of the head, weakness of the limbs, poor memory, and so on. Hovenia dulcis thunb enters the heart and spleen channels and is combined with the monarch drug to have the effects of nourishing the heart and calming the spirit, and invigorating the spleen and tonifying qi.

[0044] The ministerial medicine white cana root, sweet, cold. Return to lung, stomach, bladder channel. Cool blood and stop bleeding, clear heat and diuretic. For blood heat hematemesis, bleeding, hematuria, heat, jaundice, edema, hot and painful; "Ben Jing": "main labor injury, virtual thin, spleen, blood stasis, blood clot, cold and heat, benefit small." Chinese medicine theory that Yin time, lung meridian, liver in the o'clock after the blood to the new, through the "lungs to the hundred pulse" and sent to the whole body, stay up late to reduce the body's immune function, leading to respiratory tract infection disease. "Ben Cao Jing Shu" discussion: "labor injury, virtual thin, must be hot, cana root, sweet, sweet, although cold but not stomach. Ganhanneng eliminate internal heat, so the main labor injury, virtual thin." Therefore, white cana root and the monarch medicine powder Anemarrhena asphodeloides compatibility together play the spleen and kidney, spleen, clear heat, symptoms of reduced immunity and endocrine disorders after staying up late. The formula in the invention is a natural plant that can be used for health care products, and the actual use amount of each raw material is within the safe dose range of each raw material, so the formula can completely ensure the safety of the human body.

[0045] The auxiliary medicine chrysanthemum is sweet and bitter, and slightly cold. It belongs to the lung and liver meridians. It can dispel wind and clear heat, calm the liver and improve eyesight. It is used for treating wind-heat cold, headache, dizziness, red and swollen eyes, and blurred vision. It is also used for treating liver qi deficiency. "Ben Jing" states that it can treat various wind-induced headaches, swelling and pain, and benefit blood and qi. "Bie Lu" states that it can treat waist pain, relieve chest heat, calm the stomach and intestines, benefit five pulses, and regulate four limbs. The liver eyes rely on blood for vision, and a deficiency of liver yin and blood can cause blurred vision. Chrysanthemum, which enters the liver meridian, can calm the liver and improve eyesight, and can also nourish the liver and spleen.

[0046] The auxiliary medicine hawthorn is sour, sweet, and slightly warm. It belongs to the spleen, stomach, and liver meridians. It can digest food, invigorate the stomach, disperse blood stasis, and is used for meat accumulation, stomach fullness, diarrhea, abdominal pain, blood stasis, and abdominal pain. Focal hawthorn can enhance the digestion and removal of stagnation. It is used for meat accumulation and unsmooth diarrhea. "Medical Chuan Zhong Shen Xi Lu" states that hawthorn, when combined with sweet medicines, can remove blood stasis without harming new blood, open stagnant qi without harming normal qi, and is particularly balanced. Hawthorn enters the spleen, stomach, and liver meridians and is used with other medicines to invigorate blood, dredge collaterals, and invigorate the spleen and disperse qi.

[0047] There is a saying about the meridian of the sun and the moon in ancient times, and there is a theory of biological clock today. Modern research has found that biological clock is involved in various aspects of human physiology and pathology. If the biological clock is disturbed for a long time, it will cause abnormalities in behavior, hormone level, sleep quality, body temperature, and metabolism. Disruption of circadian rhythm can lead to neuroendocrine dysfunction and decreased overall metabolic rate, and some metabolic products cannot be removed in time, increasing the risk of disease.

[0048] The composition of the invention is used with all medicines, which can nourish the heart and calm the mind, tonify the liver and kidney, benefit qi and invigorate the spleen, clear heat and resolve toxins, and is used for symptoms such as reduced immunity and endocrine disorders after staying up late. All raw materials in the formula are natural plants that can be used for health care products, and the actual use amount of each raw material is within the safe dose range of each raw material, so the formula can completely ensure the safety of the human body.

[0049] The application provides an application of a traditional Chinese medicine composition in preparation of food, health food and / or medicine for relieving or improving sub-health caused by staying up late, wherein the traditional Chinese medicine composition is composed of gynostemma pentaphyllum, pachyrhizus, hovenia dulcis thunb, imperata cylindrica, hawthorn and chrysanthemum, and has a synergistic effect after combination of the components, can regulate circadian rhythm gene BMAL1 and Clock RNA expression, improve learning and memory function, enhance body antioxidant capacity and reduce serum inflammatory factor level. The traditional Chinese medicine composition can relieve or improve biological clock rhythm disorder, memory function decline (or memory function recession), oxidative stress or inflammatory reaction and other sub-health states caused by staying up late, and reduce harm and damage after staying up late. The traditional Chinese medicine composition can be used as an active ingredient to prepare food, health food or medicine, and can be used for daily consumption to prevent health problems caused by staying up late. DETAILED DESCRIPTION

[0050] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application will be further described in detail below with examples. It should be understood that the specific examples described herein are only used to explain the present application, and are not used to limit the present application.

[0051] Example 1

[0052] The present embodiment provides a traditional Chinese medicine composition, which is made of raw materials in the following proportions: 100 g of gynostemma pentaphyllum, 600 g of pachyrhizus, 100 g of hovenia dulcis thunb, 500 g of imperata cylindrica, 100 g of hawthorn and 300 g of chrysanthemum.

[0053] The present embodiment provides a preparation containing the above traditional Chinese medicine composition, which further contains 20 g of corn starch, and the preparation method is as follows:

[0054] a. Raw material pretreatment: crush the hovenia dulcis thunb and reserve;

[0055] b. Extraction: weigh the gynostemma pentaphyllum and pachyrhizus according to the prescription amount, add 9 times the amount of 70% ethanol to reflux and extract twice, each for 2 hours, filter and combine the extraction liquid, and reserve the ethanol extraction liquid; add 11 times the amount of water to the hovenia dulcis thunb, imperata cylindrica, hawthorn and chrysanthemum to reflux and extract three times, each for 1 hour, filter and combine the extraction liquid, and reserve the water extraction liquid;

[0056] c. Concentration: after recovering ethanol from the ethanol extraction liquid obtained in step b, concentrate to an ethanol extraction concentrate with a 60-degree hot-measuring relative density of 1.20-1.30 for later use; reduce the pressure to concentrate the water extraction liquid obtained in step b to a water extraction concentrate with a 60-degree hot-measuring relative density of 1.20-1.30 for later use;

[0057] d. Drying: vacuum belt dry the ethanol extraction concentrate and the water extraction concentrate obtained in step c respectively at a temperature of 110 degrees to obtain ethanol extraction dry extract and water extraction dry extract for later use, and the obtained ethanol extraction dry extract and water extraction dry extract jointly constitute the above traditional Chinese medicine composition;

[0058] e, crushing: the alcohol extract dry paste and water extract dry paste obtained in step d are crushed and passed through an 80 mesh sieve, and the crushed powder is prepared for use;

[0059] f, mixing: the crushed powder obtained in step e is added to starch and mixed uniformly to obtain a mixed powder for use;

[0060] g, granulation: the mixed powder obtained in step f is dry granulated to obtain granules for use;

[0061] h, the granules obtained in step g are compressed into tablets, which are packaged, inspected, and obtained.

[0062] Example 2

[0063] The present example provides a traditional Chinese medicine composition, which is made of raw materials in the following proportions: 500g of Centella asiatica, 200g of Pueraria lobata, 500g of Hovenia dulcis, 100g of Imperata cylindrica, 500g of Crataegus pinnatifida, and 100g of Chrysanthemum.

[0064] The present example provides a preparation containing the above-mentioned traditional Chinese medicine composition, which also contains 60g of corn starch, and the preparation method is as follows:

[0065] a, raw material pretreatment: Hovenia dulcis is crushed and prepared for use;

[0066] b, extraction: Centella asiatica and Pueraria lobata are weighed according to the formula, and 7 times the amount of 70% ethanol is added for reflux extraction for 2 hours each time, and the extract is filtered and combined. The alcohol extract is prepared for use. Hovenia dulcis, Imperata cylindrica, Crataegus pinnatifida, and Chrysanthemum are added to 8 times the amount of water for reflux extraction for 1 hour each time, and the extract is filtered and combined. The water extract is prepared for use;

[0067] c, concentration: after recovering ethanol from the alcohol extract obtained in step b, the alcohol extract is concentrated to an alcohol extract concentrate with a relative density of 1.20-1.30 at 60 degrees for use. The water extract obtained in step b is reduced pressure concentrated to a water extract concentrate with a relative density of 1.20-1.30 at 60 degrees for use;

[0068] d, drying: the alcohol extract concentrate and water extract concentrate obtained in step c are respectively vacuum belt dried at a temperature of 120 degrees to obtain alcohol extract dry paste and water extract dry paste for use. The obtained alcohol extract dry paste and water extract dry paste together constitute the above-mentioned traditional Chinese medicine composition;

[0069] e, crushing: the alcohol extract dry paste and water extract dry paste obtained in step d are crushed and passed through an 80 mesh sieve, and the crushed powder is prepared for use;

[0070] f, mixing: the crushed powder obtained in step e is added to starch and mixed uniformly to obtain a mixed powder for use;

[0071] g, granulation: the mixed powder obtained in step f is dry granulated to obtain granules for use;

[0072] h. The granules obtained in step g are sized to obtain a powder, which is packaged, inspected and obtained.

[0073] Example 3

[0074] The present example provides a traditional Chinese medicine composition, which is made of raw materials in the following proportions: Centella asiatica 300g, Paeonia suffruticosa 400g, Hovenia dulcis 300g, Imperata cylindrica 300g, Crataegus pinnatifida 300g, and Chrysanthemum 200g.

[0075] The present example provides a preparation containing the above traditional Chinese medicine composition, which further contains corn starch 45g, and the preparation method is as follows:

[0076] a. Pretreatment of raw materials: Hovenia dulcis is crushed and prepared for use;

[0077] b. Extraction: Centella asiatica and Paeonia suffruticosa are weighed according to the prescription amount, and 9 times the amount of 80% ethanol is added for reflux extraction for 2 times, each for 2 hours. The extraction liquid is filtered and combined, and the alcohol extract is prepared for use. Hovenia dulcis, Imperata cylindrica, Crataegus pinnatifida, and Chrysanthemum are added with 10 times the amount of water for reflux extraction for 3 times, each for 1 hour. The extraction liquid is filtered and combined, and the water extract is prepared for use;

[0078] c. Concentration: After recovering ethanol from the alcohol extract obtained in step b, the alcohol extract is concentrated to an alcohol extract concentrate with a relative density of 1.20-1.30 at 60 degrees for hot measurement, which is prepared for use. The water extract obtained in step b is reduced pressure concentrated to a water extract concentrate with a relative density of 1.20-1.30 at 60 degrees for hot measurement, which is prepared for use;

[0079] d. Drying: The alcohol extract concentrate and the water extract concentrate obtained in step c are respectively subjected to vacuum belt drying at a temperature of 115 degrees to obtain alcohol extract dry extract and water extract dry extract, which are prepared for use. The obtained alcohol extract dry extract and water extract dry extract jointly constitute the above traditional Chinese medicine composition;

[0080] e. Crushing: The alcohol extract dry extract and the water extract dry extract obtained in step d are crushed and passed through an 80-mesh sieve to obtain crushed powder, which is prepared for use;

[0081] f. Mixing: The crushed powder obtained in step e is added with starch and mixed uniformly to obtain mixed powder, which is prepared for use;

[0082] g. Granulation: The mixed powder obtained in step f is dry granulated to obtain granules, which are prepared for use;

[0083] h. The granules obtained in step g are sized, packaged, inspected and obtained as granules.

[0084] Example 4

[0085] The present example provides a traditional Chinese medicine composition, which is made of raw materials in the following proportions: Centella asiatica 300g, Paeonia suffruticosa 400g, Hovenia dulcis 300g, Imperata cylindrica 300g, Crataegus pinnatifida 300g, and Chrysanthemum 200g.

[0086] The present embodiment provides a preparation containing the above-mentioned traditional Chinese medicine composition, which further contains corn starch 47 g, and the preparation method is as follows:

[0087] a. Pretreatment of raw materials: crush the Fructus Hoveniae, and reserve;

[0088] b. Extraction: weigh the Centella asiatica and Paeonia suffruticosa according to the prescription amount, and add 9 times the amount of 70% ethanol to reflux extract for 2 hours each time, filter and combine the extract, and reserve the alcohol extract; add 11 times the amount of water to the Fructus Hoveniae, Imperata cylindrica, Crataegus pinnatifida Bunge, and Chrysanthemum to reflux extract for 1 hour each time, filter and combine the extract, and reserve the water extract;

[0089] c. Concentration: after recovering ethanol from the alcohol extract obtained in step b, concentrate to an alcohol extract concentrate with a relative density of 1.20-1.30 at 60 degrees Celsius for reserve; reduce the pressure to concentrate the water extract obtained in step b to a water extract concentrate with a relative density of 1.20-1.30 at 60 degrees Celsius for reserve;

[0090] d. Drying: vacuum belt dry the alcohol extract concentrate and the water extract concentrate obtained in step c at a temperature of 110 degrees Celsius to obtain alcohol extract dry extract and water extract dry extract for reserve, and the alcohol extract dry extract and the water extract dry extract together constitute the above-mentioned traditional Chinese medicine composition;

[0091] e. Grinding: grind the alcohol extract dry extract and the water extract dry extract obtained in step d through an 80-mesh sieve, and reserve the ground powder;

[0092] f. Mixing: add the ground powder obtained in step e to the starch, and mix evenly to obtain a mixed powder for reserve;

[0093] g. Granulation: dry granulate the mixed powder obtained in step f to obtain granules for reserve;

[0094] h. Fill the granules obtained in step g into capsules, package, and test to obtain the product.

[0095] Example 5

[0096] The present embodiment provides a traditional Chinese medicine composition, which is made of the following raw materials in the following proportions: Centella asiatica 320 g, Paeonia suffruticosa 450 g, Fructus Hoveniae 285 g, Imperata cylindrica 266 g, Crataegus pinnatifida Bunge 323 g, and Chrysanthemum 213 g.

[0097] The present embodiment provides a preparation containing the above-mentioned traditional Chinese medicine composition, which further contains sweet potato starch 45 g, and the preparation method is as follows: prepare an oral liquid according to the conventional method.

[0098] Comparative Example 1

[0099] A composition, compared with Example 4, without adding the ingredient of Pueraria lobata, is made from the following raw materials in the following proportions: 312g of Centella asiatica, 312g of Hovenia dulcis Thunb, 312g of Imperata cylindrica, 312g of Crataegus pinnatifida Bge, and 208g of Chrysanthemum morifolium Ramat.

[0100] The preparation method is as follows:

[0101] a. Pretreatment of raw materials: crush Hovenia dulcis Thunb and prepare for use;

[0102] b. Extraction: weigh Centella asiatica according to the prescription amount, add 9 times the amount of 70% ethanol to reflux extract for 2 times, 2 hours each time, filter and combine the extract, and prepare the alcohol extract for use; add 11 times the amount of water to Hovenia dulcis Thunb, Imperata cylindrica, Crataegus pinnatifida Bge, and Chrysanthemum morifolium Ramat to reflux extract for 3 times, 1 hour each time, filter and combine the extract, and prepare the water extract for use;

[0103] c. Concentration: after recovering ethanol from the alcohol extract obtained in step b, concentrate to an alcohol extract concentrate with a relative density of 1.20-1.30 at 60 degrees Celsius for use; reduce the pressure to concentrate the water extract obtained in step b to a water extract concentrate with a relative density of 1.20-1.30 at 60 degrees Celsius for use;

[0104] d. Drying: separately vacuum belt dry the alcohol extract concentrate and the water extract concentrate obtained in step c at a temperature of 110 degrees Celsius to obtain alcohol extract dry extract and water extract dry extract for use, which together constitute the above-mentioned traditional Chinese medicine composition.

[0105] Comparative Example 2

[0106] A composition, compared with Example 4, without adding the ingredient of Centella asiatica, is made from the following raw materials in the following proportions: 416g of Pueraria lobata, 312g of Hovenia dulcis Thunb, 312g of Imperata cylindrica, 312g of Crataegus pinnatifida Bge, and 208g of Chrysanthemum morifolium Ramat.

[0107] The preparation method is as follows:

[0108] a. Pretreatment of raw materials: crush Hovenia dulcis Thunb and prepare for use;

[0109] b. Extraction: weigh Pueraria lobata according to the prescription amount, add 9 times the amount of 70% ethanol to reflux extract for 2 times, 2 hours each time, filter and combine the extract, and prepare the alcohol extract for use; add 11 times the amount of water to Hovenia dulcis Thunb, Imperata cylindrica, Crataegus pinnatifida Bge, and Chrysanthemum morifolium Ramat to reflux extract for 3 times, 1 hour each time, filter and combine the extract, and prepare the water extract for use;

[0110] c. Concentration: after recovering ethanol from the alcohol extract obtained in step b, concentrate to an alcohol extract concentrate with a relative density of 1.20-1.30 at 60 degrees Celsius for use; reduce the pressure to concentrate the water extract obtained in step b to a water extract concentrate with a relative density of 1.20-1.30 at 60 degrees Celsius for use;

[0111] d, drying: the alcohol extract and water extract obtained in step c are vacuum belt dried at 110 degrees, to obtain alcohol extract dry paste and water extract dry paste for standby, the alcohol extract dry paste and water extract dry paste obtained together constitute the above-mentioned traditional Chinese medicine composition.

[0112] Comparative example 3

[0113] A composition, compared with example 4, replaces the centella asiatica with honeysuckle, and is specifically made of the following proportion of raw materials: honeysuckle 312g, radix paeoniae 416g, hovenia dulcis 312g, imperata cylindrica 312g, hawthorn 312g, chrysanthemum 208g.

[0114] The preparation method is:

[0115] a, raw material pretreatment: crush the hovenia dulcis for standby;

[0116] b, extraction: take honeysuckle and radix paeoniae according to the formula amount, add 9 times the amount of 70% ethanol to reflux extract 2 times, 2 hours each time, filter the extract and combine, the alcohol extract is standby; hovenia dulcis, imperata cylindrica, hawthorn and chrysanthemum are added with 11 times the amount of water to reflux extract 3 times, 1 hour each time, filter the extract and combine, the water extract is standby;

[0117] c, concentration: after recovering ethanol from the alcohol extract obtained in step b, concentrate to 60 degrees of alcohol extract concentrate with a relative density of 1.20-1.30 for standby; reduce the pressure to concentrate the water extract obtained in step b to 60 degrees of water extract concentrate with a relative density of 1.20-1.30 for standby;

[0118] d, drying: the alcohol extract concentrate and water extract concentrate obtained in step c are vacuum belt dried at 110 degrees, to obtain alcohol extract dry paste and water extract dry paste for standby, the alcohol extract dry paste and water extract dry paste obtained together constitute the above-mentioned traditional Chinese medicine composition.

[0119] Comparative example 4

[0120] A composition, compared with example 4, replaces the radix paeoniae with radix bupleuri, and is specifically made of the following proportion of raw materials: centella asiatica 312g, radix bupleuri 416g, hovenia dulcis 312g, imperata cylindrica 312g, hawthorn 312g, chrysanthemum 208g.

[0121] The preparation method is:

[0122] a, raw material pretreatment: crush the hovenia dulcis for standby;

[0123] b, extraction: take centella asiatica and radix bupleuri according to the formula amount, add 9 times the amount of 70% ethanol to reflux extract 2 times, 2 hours each time, filter the extract and combine, the alcohol extract is standby; hovenia dulcis, imperata cylindrica, hawthorn and chrysanthemum are added with 11 times the amount of water to reflux extract 3 times, 1 hour each time, filter the extract and combine, the water extract is standby;

[0124] c, concentration: after recovering ethanol from the alcohol extract solution obtained in step b, concentrate to an alcohol extract concentrate solution with a relative density of 1.20-1.30 at 60 degrees Celsius for standby; reduce the pressure and concentrate the water extract solution obtained in step b to a water extract concentrate solution with a relative density of 1.20-1.30 at 60 degrees Celsius for standby;

[0125] d, drying: vacuum belt dry the alcohol extract concentrate solution and the water extract concentrate solution obtained in step c respectively at a temperature of 110 degrees Celsius to obtain alcohol extract dry extract and water extract dry extract for standby, and the alcohol extract dry extract and the water extract dry extract obtained together constitute the above-mentioned traditional Chinese medicine composition.

[0126] Test Example 1

[0127] In order to better verify the properties of the composition of the present application, a rat sleep deprivation model was constructed by using a composite modeling method (multi-platform water environment method + intraperitoneal injection of caffeine, cyclophosphamide), and the improvement effect of the composition obtained in Example 4 and Comparative Examples 1-4 on the sleep deprivation injury of rats was observed and verified.

[0128] 1 Experimental materials

[0129] 1.1 Test product

[0130] The test products (test substances) used were prepared according to Example 4 and Comparative Examples 1-4, and were provided by Hebei Yiling Pharmaceutical Research Institute Health Branch. The specific prescription composition of each test substance is shown in the following table.

[0131] Table 1

[0132] Example 4 Comparative Example 1 Comparative Example 2 Comparative Example 3 Comparative Example 4 Pueraria lobata / Pueraria lobata Pueraria lobata Bupleurum falcatum Centella asiatica Centella asiatica / Honeysuckle Centella asiatica Hovenia dulcis Hovenia dulcis Hovenia dulcis Hovenia dulcis Hovenia dulcis Imperata cylindrica Imperata cylindrica Imperata cylindrica Imperata cylindrica Imperata cylindrica Crataegus pinnatifida Crataegus pinnatifida Crataegus pinnatifida Crataegus pinnatifida Crataegus pinnatifida Chrysanthemum morifolium Chrysanthemum morifolium Chrysanthemum morifolium Chrysanthemum morifolium Chrysanthemum morifolium

[0133] Dose setting: each test drug was administered to rats at 8 times the clinical dose, as shown in the following table:

[0134] Table 2

[0135]

[0136]

[0137] Note: ① Extracted paste rate of medicinal materials, wherein Example 21.6%, Comparative Example 1 19.2%, Comparative Example 2 20.9%, Comparative Example 3 22.4%, Comparative Example 4 20.3%;

[0138] ② Human g / d (test substance) g calculation formula = crude drug * extract rate;

[0139] ③ Human 8 times dose g / kg calculation formula = test substance weight / 60 * 8.

[0140] 1.2 Solvents and main reagents

[0141] 1.2.1 Solvents

[0142] Purified water, made by Shijiazhuang Heling Pharmaceutical Co., Ltd.

[0143] 1.2.2 Main reagents

[0144] Total protein (TP) assay kit, Nanjing Jiancheng Biological Engineering Institute, item number A045-2-2.

[0145] Total superoxide dismutase (T-SOD) test kit, Nanjing Jiancheng Biological Engineering Institute, item number A001-1-2.

[0146] Malondialdehyde (MDA) assay kit, Nanjing Jiancheng Biological Engineering Institute, item number A003-1-2.

[0147] Interleukin-6 (IL-6) kit, Abeam, item number: ab119548.

[0148] Tumor necrosis factor-α (TNF-α) kit, Abeam, item number: ab100785.

[0149] RNeasy Mini Kit, QIAGEN, item number: 74104.

[0150] PrimeScript RT reagent Kit, TaKaRa, item number: RR037A.

[0151] TB Green Premix Ex Taq II, TaKaRa, item number: RR820A.

[0152] 1.2.3 Primer information

[0153] The required primer information is shown in the following table.

[0154] Table 3

[0155] Primer name Primer sequence (5'-3') β-actin-F GCCATGTACGTAGCCATCCA β-actin-R GAACCGCTCATTGCCGATAG BMAL1-F GACTCCAGACATTCCTTCCGC BMAL1-R CTATGTGGGGGTTCTCACCAAGAA Clock-F GCCGCAGAATAGCACCCAGAGT Clock-R ACTTGGCACCATGACGGCCC

[0156] 1.3 Experimental system

[0157] 1.3.1 Animal pedigree: SD rats.

[0158] 1.3.2 Animal level: SPF level.

[0159] 1.3.3 Animal gender and quantity: 60, of which 0 are female and 60 are male, 56 are used in this test.

[0160] 1.3.4 Animal age: about 6-8 weeks old.

[0161] 1.3.5 Animal weight: 220-240 g.

[0162] 1.3.6 Animal certification unit, date of receipt, certificate number: Beijing Huafukang Biotechnology Co., Ltd., license number: SCXK(Jing)2019-0008, date of receipt: December 7, 2023, 110322231103838327.

[0163] 1.3.7 Quarantine process: The newly received animals were adaptively fed for 5 days. During this period, the animals had no abnormalities in drinking, eating and health status, and no signs of disease and death were found.

[0164] 1.3.8 Feed: experimental mouse mixed granular feed, manufacturer: Beijing Huafukang Biotechnology Co., Ltd.

[0165] 1.3.9 Drinking water: clean water was filled and the animals were free to drink, and the water was changed once a day.

[0166] 1.3.10 Bedding: ordinary corn cob bedding, provided by Beijing Keao Cooperation Feed Co., Ltd.

[0167] 1.3.11 Identification: animal identification used experimental animal marker pen, provided by Japan EPS Group, item number AM15.

[0168] 2 Test method

[0169] 2.1 Test grouping

[0170] The experimental animals were randomly divided into 7 groups according to body weight: normal group, model group, Example 4 group, Comparative Example 1 group, Comparative Example 2 group, Comparative Example 3 group, and Comparative Example 4 group, 8 in each group.

[0171] 2.2 Administration method

[0172] A suitable size of disposable sterile syringe and gavage needle were selected for gavage administration, and the administration volume was 10 ml / kg. The normal group and the model group were given the same volume of purified water. Drug administration was performed once a day, and continuous administration was performed for 28 days.

[0173] 2.3 Model making

[0174] After grouping, the experimental modeling was started. The modeling method was composite modeling method, that is, caffeine and cyclophosphamide were injected intraperitoneally, and water environment method was intervened at the same time, for a total of 4 weeks. Before water environment deprivation was performed for 1 week, the modeling animals were injected intraperitoneally with caffeine (60 mg / kg) and cyclophosphamide (10 mg / kg) at regular times every day, and the normal group animals were injected with the same amount of normal saline. From the second week to the end of the fourth week, water environment sleep deprivation (18 hours per day) was performed. The normal group was placed in a deprivation box covered with wire mesh, the box was filled with water, and the water surface was 2 cm away from the round table. The remaining groups were directly placed on the circular platform without wire mesh covering, and the water surface was 1 cm away from the platform. The rats were always awake and could not sleep because they were afraid of falling into the water. Four rats were placed in each deprivation box. The box was cleaned regularly every day, and the rats were placed back into the breeding cage for 6 hours before being placed in the deprivation box. Food and water were added in time, and the administration was performed after the model was completed every day.

[0175] 2.4 Index detection

[0176] The next day after the last administration, the rat's grip strength was first determined, and then the rat's water maze test was performed (continuous training for 5 days before testing); after the behavior test, the experimental animals were anesthetized with isoflurane, blood was taken from the abdominal aorta, centrifuged at 3000 r / min for 10 minutes, and serum was separated for detection of inflammatory factor levels; after blood collection, brain tissue was dissected, part of the brain tissue homogenate was prepared for detection of antioxidant indexes, and the remaining brain tissue was frozen in liquid nitrogen for detection of molecular biology indexes.

[0177] 2.5 Related staff notification

[0178] When the animals were purchased, the animal room was notified, and when the animals showed abnormal conditions, the pathology room was notified for processing.

[0179] 2.6 Instrument system

[0180] Metler ME104E analytical balance, METTLER TOLEDO;

[0181] DT2000 electronic balance, Changshu Shuangjie Testing Instrument Factory.

[0182] XR601 type grip strength meter, Shanghai Xinsuo Information Technology Co., Ltd.

[0183] ANY-maze animal behavior analysis system, Stoelting Company, USA.

[0184] Gene Speed 1580R high-speed refrigerated centrifuge, Gene Co., Ltd.

[0185] ZWYR-240 constant temperature incubation oscillator, Shanghai Zhi Cheng Analysis Instrument Manufacturing Co., Ltd.

[0186] TECAN Infinite M200 Pro microplate reader, TECAN.

[0187] Multi-sample tissue grinder, Shanghai Jingxin Company.

[0188] T100 Thermol cycler PCR instrument, Bio-Rad Laboratories.

[0189] Sorvall ST 16 / 16R high-speed refrigerated centrifuge, Thermo Fisher Scientific.

[0190] LightCycler 96 system, Roche, Germany.

[0191] 2.7 Statistical method

[0192] The experimental data were expressed as mean ± standard deviation (x ± s). Statistical analysis was performed using SPSS software, and one-way ANOVA was used for comparison of means. First, the homogeneity of variance was tested. If the variance was homogeneous, the least significant difference method (LSD) was used. If the variance was not homogeneous, Dunnett's T3 test was used. The test level was 0.05 and 0.01.

[0193] 3 Results

[0194] 3.1 General state and forelimb grip strength

[0195] Before modeling, the rats in each group were active and had good activity, and their fur was lustrous. During the initial modeling stage, excessive excitement, dull and withered hair occurred. In the later modeling stage, the rats showed decreased excitement, listlessness, disheveled hair, and sluggish reaction. Compared with the model group, the fur luster, mental state, and activity of each drug group were improved to varying degrees. The normal group was in good condition throughout the experiment, with flexible activity, normal sleep, and normal food intake.

[0196] The forelimb grip strength of rats in each group was detected, and the results are shown in Table 4. Compared with the normal group, the forelimb grip strength of rats in the model group was significantly decreased (P < 0.01). Compared with the model group, the forelimb grip strength of rats in each drug group was increased to varying degrees, and the forelimb grip strength of rats in Example 4 and Comparative Example 4 was significantly increased (P < 0.05). No statistical difference was found between the drug groups (P > 0.05).

[0197] Table 4 Body weight and grip strength of rats in each group at the end of the experiment

[0198]

[0199] Note: Compared with the normal group, ##P < 0.01; compared with the model group, *P < 0.05, **P < 0.01.

[0200] 3.2 Body weight

[0201] The body weight of each group after the experiment is shown in Table 4. Compared with the normal group: the body weight of the model group was significantly reduced after the experiment (P<0.01). Compared with the model group: the body weight of each administration group was increased to varying degrees, among which the body weight of the rats in the Example 4, Comparative Example 2, Comparative Example 3, and Comparative Example 4 groups was significantly increased (P<0.05 or P<0.01). There was no statistical difference between each administration group (P>0.05).

[0202] 3.3 Learning and memory function

[0203] The Morris water maze is a classic method for detecting learning and memory. In this experiment, the total swimming distance and the latency to platform were used to measure the learning and memory ability of rats, and the specific results are shown in Table 5. Compared with the normal group: the latency to platform and the total swimming distance of the model group were significantly prolonged (P<0.01). Compared with the model group: the latency to platform and the total swimming distance of the rats in the Example 4 group were significantly shortened (P<0.05), and the latency to platform of the rats in the Comparative Example 3 and Comparative Example 4 groups was significantly shortened (P<0.05). There was no statistical difference between each administration group (P>0.05).

[0204] Table 5 Morris water maze results of each group in the experiment

[0205]

[0206] Note: Compared with the normal group: ##P<0.01; Compared with the model group: *P<0.05.

[0207] 3.4 Serum inflammatory factors

[0208] The serum inflammatory levels of each group in the experiment are shown in Table 6. Compared with the normal group: the TNF-α and IL-6 levels of the model group were significantly increased (P<0.01). Compared with the model group: the TNF-α and IL-6 levels of the rats in the Example 4 and Comparative Example 3 groups were significantly reduced (P<0.05 or P<0.01), and the TNF-α level of the rats in the Comparative Example 4 group was significantly reduced (P<0.05). Compared between each administration group: the serum inflammatory factor levels of the Example group were significantly lower than those of Comparative Example 2 (P<0.05).

[0209] Table 6 Serum inflammatory factor levels of each group in the experiment

[0210]

[0211] Note: Compared with the normal group: ##P<0.01; Compared with the model group: *P<0.05, **P<0.01; Compared with the Example: △P<0.05.

[0212] 3.5 Antioxidant capacity of brain tissue

[0213] The results of the antioxidant capacity of brain tissue in each group are shown in Table 7. Compared with the normal group, the SOD activity of the model group was significantly decreased (P<0.01), and the MDA content was significantly increased (P<0.01). Compared with the model group, the SOD activity of the rats in Example 4 group and Comparative Example 3 group was increased, and the MDA content was decreased (P<0.05 or P<0.01), and the MDA content of the rats in Comparative Examples 1 and 4 was decreased (P<0.05). Comparison between each administration group: the MDA content of the rats in Example 4 group was significantly lower than that in Comparative Examples 1, 2 and 3 groups (P<0.05).

[0214] Table 7 Antioxidant capacity of brain tissue in each group of the test

[0215]

[0216] Note: Compared with the normal group: ##P<0.01; compared with the model group: *P<0.05, **P<0.01; compared with Example 4 group: ΔP<0.05.

[0217] The results of the expression levels of circadian rhythm genes BMAL1 and Clock RNA in brain tissue in each group of the test are shown in Table 8. Compared with the normal group, the expression levels of BMAL1 and Clock in the model group were significantly decreased (P<0.01). Compared with the model group, the expression levels of BMAL1 and Clock in Example 4 group, Comparative Example 3 group and Comparative Example 4 group were significantly increased (P<0.05 or P<0.01). No statistical difference was found between each administration group (P>0.05).

[0218] Table 8 Expression levels of circadian rhythm genes BMAL1 and Clock RNA in brain tissue in each group of the test

[0219]

[0220]

[0221] Note: Compared with the normal group: ##P<0.01; compared with the model group: *P<0.05, **P<0.01.

[0222] 4. Conclusion

[0223] The sleep-deprived rat model is constructed by using the composite modeling method (multi-platform water environment method + intraperitoneal injection of caffeine and cyclophosphamide), and the improving effects of the compositions obtained from the application examples and different group proportions on the sleep-deprived damage of rats are observed. The test results show that the application examples and the comparative examples 3 and 4 can significantly improve the body weight of the sleep-deprived rats, improve the learning and memory function, enhance the antioxidant capacity of the body, reduce the serum inflammatory factor level, and increase the expression level of the circadian rhythm genes BMAL1 and Clock RNA, and the improving effect of the application examples is particularly significant.

[0224] From the above data, it can be known that the composition of the application is composed of traditional Chinese medicines Yixuecao, Fengan, Zhidouzi, Baomao, Shanzha and JuHua, the composition achieves the synergistic effect of relieving or improving the sub-health caused by staying up late by compounding specific components in a specific ratio, and can be applied to the preparation of health care food, functional food or medicine with the function of relieving or improving the sub-health caused by staying up late, so as to meet the daily needs of people's pursuit of health.

[0225] The above only describes the preferred embodiments of the application and is not intended to limit the application. Any modification, equivalent replacement or improvement made within the spirit and principle of the application shall be included in the protection scope of the application.

Claims

1. The application of a traditional Chinese medicine composition in the preparation of foods, health foods, and / or medicines that alleviate or improve sub-health caused by staying up late, characterized in that, The traditional Chinese medicine composition is made from the following raw materials in parts by weight: Centella asiatica 100-500 parts, Pueraria lobata 200-600 parts, Hovenia dulcis 100-500 parts, Imperata cylindrica 100-500 parts, Crataegus pinnatifida 100-500 parts, and Chrysanthemum morifolium 100-300 parts.

2. The application of the traditional Chinese medicine composition as described in claim 1 in the preparation of foods, health foods, and / or medicines that alleviate or improve sub-health caused by staying up late, characterized in that, The traditional Chinese medicine composition is made from the following raw materials in parts by weight: 100 parts of Centella asiatica, 600 parts of Pueraria lobata, 100 parts of Hovenia dulcis, 500 parts of Imperata cylindrica, 100 parts of Crataegus pinnatifida, and 300 parts of Chrysanthemum morifolium.

3. The application of the traditional Chinese medicine composition as described in claim 1 in the preparation of foods, health foods, and / or medicines that alleviate or improve sub-health caused by staying up late, characterized in that, The traditional Chinese medicine composition is made from the following raw materials in parts by weight: 500 parts of Centella asiatica, 200 parts of Pueraria lobata, 500 parts of Hovenia dulcis, 100 parts of Imperata cylindrica, 500 parts of Crataegus pinnatifida, and 100 parts of Chrysanthemum morifolium.

4. The application of the traditional Chinese medicine composition as described in claim 1 in the preparation of foods, health foods, and / or medicines that alleviate or improve sub-health caused by staying up late, characterized in that, The traditional Chinese medicine composition is made from the following raw materials in parts by weight: 300 parts Centella asiatica, 400 parts Pueraria lobata, 300 parts Hovenia dulcis, 300 parts Imperata cylindrica, 300 parts Crataegus pinnatifida, and 200 parts Chrysanthemum morifolium.

5. The application of the traditional Chinese medicine composition as described in claim 1 in the preparation of foods, health foods, and / or medicines that alleviate or improve sub-health caused by staying up late, characterized in that, The traditional Chinese medicine composition is made from the following raw materials in parts by weight: Centella asiatica 312 parts, Pueraria lobata 416 parts, Hovenia dulcis 312 parts, Imperata cylindrica 312 parts, Crataegus pinnatifida 312 parts, and Chrysanthemum morifolium 208 parts.

6. The application of the traditional Chinese medicine composition as described in claim 1 in the preparation of foods, health foods, and / or medicines that alleviate or improve sub-health caused by staying up late, characterized in that, The sub-health conditions caused by staying up late include at least one of the following: disruption of the biological clock rhythm, decreased memory function, oxidative stress, or inflammatory response.

7. The application of the traditional Chinese medicine composition as described in claim 6 in the preparation of foods, health foods, and / or medicines that alleviate or improve sub-health caused by staying up late, characterized in that, The sub-health caused by staying up late refers to the disruption of the biological clock rhythm due to staying up late.

8. The use of the traditional Chinese medicine composition according to any one of claims 1 to 5 in the preparation of foods, health foods, and / or medicines that alleviate or improve sub-health caused by staying up late, characterized in that, The dosage form of the health food is an oral preparation.

9. The application of the traditional Chinese medicine composition as described in claim 8 in the preparation of foods, health foods, and / or medicines that alleviate or improve sub-health caused by staying up late, characterized in that, The oral preparations are capsules, tablets, pills, powders, granules, oral liquids, or ointments.

10. The application of the traditional Chinese medicine composition as described in claim 9 in the preparation of foods, health foods, and / or medicines that alleviate or improve sub-health caused by staying up late, characterized in that, The health food also contains excipients, which are corn starch or sweet potato starch, in portions of 20-60 parts by weight.

11. The application of the traditional Chinese medicine composition as described in claim 10 in the preparation of foods, health foods, and / or medicines that alleviate or improve sub-health caused by staying up late, characterized in that, The method for preparing the capsules includes the following steps: a. Raw material pretreatment: Crush the seeds of the Japanese raisin tree and set aside; b. Extraction: Weigh Centella asiatica and Pueraria lobata, reflux extract with ethanol twice, filter, and reserve the ethanol extract; extract Rahu jujuba, Imperata cylindrica, Crataegus pinnatifida and Chrysanthemum morifolium with water three times, filter the extract, and reserve the water extract. c. Concentration: After recovering the ethanol from the alcohol extract obtained in step b, concentrate it to a concentration with a relative density of 1.20-1.30 measured at 60 degrees Celsius for later use; concentrate the water extract obtained in step b under reduced pressure to a concentration with a relative density of 1.20-1.30 measured at 60 degrees Celsius for later use. d. Drying: The concentrated alcohol extract and concentrated water extract obtained in step c are vacuum dried to obtain alcohol extract dry paste and water extract dry paste for later use. e. Grinding: Grind the alcohol extract and water extract obtained in step d through an 80-mesh sieve and set the powder aside. f. Mixing: Add the powder obtained in step e to the starch and mix evenly to obtain a mixed powder for later use; g. Granulation: The mixed powder obtained in step f is granulated by dry method to obtain granules for later use; h. Fill capsules with the granules obtained in step g, package them, and inspect them to obtain the final product.

12. The application of the traditional Chinese medicine composition as described in claim 11 in the preparation of foods, health foods, and / or medicines that alleviate or improve sub-health caused by staying up late, characterized in that, The method for preparing the capsules includes the following steps: a. Raw material pretreatment: Crush the seeds of the Japanese raisin tree and set aside; b. Extraction: Weigh Centella asiatica and Pueraria lobata, add 9 times the amount of 70% ethanol and reflux extract twice, 2 hours each time. Filter and combine the extracts, and keep the ethanol extract for later use. Add 11 times the amount of water and reflux extract three times, 1 hour each time. Filter and combine the extracts, and keep the water extract for later use. c. Concentration: After recovering the ethanol from the alcohol extract obtained in step b, concentrate it to a concentration with a relative density of 1.20-1.30 measured at 60 degrees Celsius for later use; concentrate the water extract obtained in step b under reduced pressure to a concentration with a relative density of 1.20-1.30 measured at 60 degrees Celsius for later use. d. Drying: The concentrated alcohol extract and concentrated water extract obtained in step c are respectively subjected to vacuum belt drying at a temperature of 110-120 degrees to obtain alcohol extract dry extract and water extract dry extract for later use. e. Pulverization: Pulverize the alcohol extract and water extract obtained in step d, pass them through an 80-mesh sieve, and set the pulverized powder aside. f. Mixing: Add the powder obtained in step e to the starch and mix evenly to obtain a mixed powder for later use; g. Granulation: The mixed powder obtained in step f is granulated by dry method to obtain granules for later use; h. Fill capsules with the granules obtained in step g, package them, and inspect them to obtain the final product.

Images