Lung poison cell screening model and construction and application thereof

Abstract

The invention belongs to the field of biological medicine, and relates to a lung poison cell screening model and construction and application thereof. The poison cell model provided by the invention contains a PPAR gamma promoter gene segment, a PPRE response element promoter gene segment and a reporter gene segment. The cell model can more sensitively and rapidly detect unknown toxicants with lung toxicity and also can perform early evaluation on whether drugs have side effects such as lung toxicity and the like, and has a good application prospect.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and relates to a cell screening model for lung toxins, its construction, and its application. Background Technology

[0002] Pulmonary fibrosis is a chronic interstitial lung disease in which the lung parenchyma and structure are damaged, lung plasticity is reduced, gas exchange capacity is impaired, and respiratory failure eventually occurs. The average survival time after diagnosis is only 3 to 5 years. Studies have shown that the incidence of pulmonary fibrosis is positively correlated with age, and with the increasing aging of the global population, the proportion of cases in various regions is also constantly increasing. Currently, pulmonary fibrosis is irreversible, and treatments can only slow down the progression of the disease. Fibrosis imposes a significant socioeconomic burden on modern society.

[0003] However, there are currently no drugs that can significantly reverse the progression of pulmonary fibrosis. Although some drugs, such as pirfenidone and nintedanib, can slow the decline in lung function, they cannot cure pulmonary fibrosis and have certain side effects. The treatment and drug development for pulmonary fibrosis face multiple challenges, including the complexity of the disease itself, the lack of effective treatments, drug side effects, patient heterogeneity, and the lack of biomarkers. These factors collectively contribute to the predicament in the development of drugs for pulmonary fibrosis. Furthermore, a large number of novel and unknown chemicals may promote the development of pulmonary fibrosis by inducing oxidative stress, inflammatory responses, and cell damage. Exposure to these novel and unknown toxins not only increases the risk of pulmonary fibrosis but also, due to their unknown properties, makes the diagnosis and treatment of pulmonary fibrosis more challenging, leading to greater uncertainty in patient prognosis and treatment response.

[0004] To address these challenges, we need to explore a method that can quickly predict and screen unknown pulmonary fibrosis toxins and conduct early assessments of whether drugs have side effects such as pulmonary fibrosis. Summary of the Invention

[0005] In some embodiments, the present invention provides a cell model for detecting toxins, the cell model containing a PPARγ promoter gene fragment, a PPRE response element promoter gene fragment, and a reporter gene fragment; the PPARγ promoter gene fragment and the PPRE response element promoter gene fragment are sequentially linked upstream of the coding region of the reporter gene.

[0006] In some implementations, the reporter gene includes a green fluorescent protein reporter gene, a chloramphenicol acetyltransferase reporter gene, a luciferase reporter gene, or a cell membrane-anchored luciferase. The luciferase reporter gene system is widely used in scientific research due to its high sensitivity. Compared with traditional methods for detecting fibrotic toxic indicators such as real-time quantitative PCR, Western blotting, immunofluorescence, and immunohistochemistry, luciferase reporter gene-based toxicity detection techniques are favored for their simplicity, speed, high sensitivity, and good reproducibility.

[0007] In some embodiments, the toxin is a pulmonary toxin. In some embodiments, the pulmonary toxin is a substance that can cause pulmonary fibrosis.

[0008] In some implementations, the lung toxin includes environmental toxins, chemical toxins, or drugs with lung-damaging toxic side effects.

[0009] In some implementations, the present invention constructs a rapid screening cell model for toxicants with lung toxicity (such as pulmonary fibrosis) based on PPARγ-luciferase reporter gene cells, which can more sensitively and rapidly detect unknown toxicants with pulmonary fibrosis effects and can also conduct early assessments of whether drugs have side effects such as pulmonary fibrosis.

[0010] In some implementations, the poison includes bleomycin, amiodarone, busulfan, or cisplatin.

[0011] In some implementations, the present invention found that the cytotoxicity screening cell model based on luciferase reporter genes of the present invention could not indicate the toxicity of cardiotoxic chemicals imatinib and isoproterenol, hepatotoxic chemicals diclofenac and trovafloxacin, immunotoxic chemicals rapamycin and procaine, neurotoxic chemicals metronidazole and oxaliplatin, and nephrotoxic chemicals indomethacin and methotrexate. Li Jinhong [2] mentioned that rapamycin can reduce lipid accumulation and leptin secretion after differentiation and maturation of 3T3-L1 preadipocytes, and may be related to its inhibition of PPARγ expression. In addition, Tadahito Shimada et al. [1] mentioned that in gastric epithelial cells, indomethacin upregulates the expression of TFF2 by activating PPARγ, and this upregulation can be blocked by the PPARγ-specific inhibitor GW9662, indicating that indomethacin works by activating PPARγ. Matteo Zanardelli et al. [3] mentioned that the expression of catalase in astrocytes treated with oxaliplatin was significantly reduced, while the PPARγ agonist rosiglitazone could partially restore its expression. This suggests that oxaliplatin may downregulate the expression of related enzymes by inhibiting the PPARγ signaling pathway. Jack,BU [4] mentioned that the effects of each component of CCC (continuous extraction and concentration) on the expression of PPARα and PPARγ proteins in differentiated 3T3-L1 adipocytes were studied. The results showed that isoproterenol treatment led to a decrease in the expression of PPARγ.

[0012] In some embodiments, the sequence of the PPARγ promoter gene fragment is shown in SEQ ID NO: 2.

[0013] In some embodiments, the sequence of the promoter gene fragment of the PPRE response element is shown in SEQ ID NO:1.

[0014] In some embodiments, the reporter gene is a luciferase reporter gene, and the sequence of the luciferase reporter gene fragment is shown in SEQ ID NO: 3.

[0015] In some embodiments, the present invention provides a vector derived from a backbone plasmid, wherein a PPARγ promoter gene fragment, a PPRE response element promoter gene fragment, and a reporter gene fragment are inserted into the backbone plasmid; the PPARγ promoter gene fragment and the PPRE response element promoter gene fragment are sequentially linked upstream of the coding region of the reporter gene.

[0016] In some embodiments, the backbone plasmid is selected from the GV130 vector.

[0017] In some embodiments, the reporter gene is selected from green fluorescent protein reporter gene, chloramphenicol acetyltransferase reporter gene, luciferase reporter gene or cell membrane anchored luciferase.

[0018] In some embodiments, the sequence of the PPARγ promoter gene fragment is shown in SEQ ID NO: 2.

[0019] In some embodiments, the sequence of the promoter gene fragment of the PPRE response element is shown in SEQ ID NO:1.

[0020] In some embodiments, the reporter gene is a luciferase reporter gene, and the sequence of the luciferase reporter gene fragment is shown in SEQ ID NO: 3.

[0021] In some implementations, the vector is a plasmid vector.

[0022] In some embodiments, the vector includes a Mini-TK promoter fragment, a CMV promoter fragment, an SV40 promoter fragment, an SP6 promoter fragment, an SV40 promoter fragment, a PPARγ promoter gene fragment, a luciferase reporter gene fragment, and a PPRE×3 response element fragment.

[0023] In some implementations, the Mini-TK promoter fragment is located between 2000bp and 4000bp.

[0024] In some implementations, the CMV promoter fragment is located between 1 bp and 2000 bp and between 4000 bp and 6000 bp.

[0025] In some implementations, the SV40 promoter segment is located between 6000bp and 8000bp and between 10000bp and 12000bp. In some implementations, the SP6 promoter segment is located between 4000bp and 6000bp.

[0026] In some implementations, the SV40 promoter segment is located between 16000bp and 17000bp.

[0027] In some implementations, the PPARγ promoter gene fragment is located between 4000 bp and 8000 bp.

[0028] In some implementations, the luciferase reporter gene fragment is located between 2000 bp and 6000 bp.

[0029] In some implementations, the PPRE×3 response element segment is located between 2000bp and 4000bp.

[0030] In some implementations, the PPRE×3 response element fragment is located upstream of the Mini-TK promoter fragment.

[0031] In some implementations, the vector is a vector used to prepare cell models for diagnosing lung toxins.

[0032] In some implementations, the vector is a lentiviral vector. A cell model for detecting toxins includes the aforementioned vector.

[0033] In some embodiments, the present invention provides the use of the vector in preparing cell models for detecting toxins. In some embodiments, the present invention provides a method for preparing a lung toxin cell model, comprising: (1) preparing a recombinant lentiviral vector connected to a PPARγ promoter gene fragment, a PPRE response element promoter gene fragment, and a reporter gene fragment; and (2) transfecting cells with the recombinant lentiviral vector to obtain a lung toxin cell model.

[0034] In some implementations, the method for preparing the recombinant lentiviral vector includes the steps of:

[0035] S1.1 Obtain the PPARγ promoter gene fragment, the PPRE response element promoter gene fragment, and the reporter gene fragment;

[0036] S1.2 vector digestion to obtain the target band;

[0037] S1.3 The target band digested by enzymes is ligated with the PPARγ promoter gene fragment, the PPRE response element promoter gene fragment, and the reporter gene fragment, and then transformed to obtain the recombinant lentiviral recombinant vector.

[0038] In some implementations, the connection in step (3) includes enzyme connection.

[0039] In some implementations, the carrier is a GV130 carrier.

[0040] In some implementations, the enzyme includes PacI and EcoRI.

[0041] In some embodiments, the transformation includes transforming the enzyme-ligated product into competent E. coli cells to obtain positive clone transformants.

[0042] In some implementations, the sequence of the positive clone transformant is shown in SEQ ID NO:10.

[0043] In some embodiments, the transformation process includes sequencing, followed by transfer of the target bacterial culture to LB liquid medium containing puromycin for recombinant vector extraction to obtain the recombinant lentiviral vector; in some embodiments, the vector includes a plasmid.

[0044] In some implementations, the step of transfecting cells with the lentiviral recombinant vector includes:

[0045] S2.1 Culture cells and infect them with the recombinant lentiviral vector. After infection, puromycin is added for screening. S2.1 Continue to expand the cells with puromycin to maintain the concentration. Once the target gene expression detection results are qualified, a stable cell line of the toxin cell model is obtained.

[0046] In some implementations, the cells transfected by the lentiviral recombinant vector include A549 cells, HeLa cells, THP-1 cells, or HEK293T cells.

[0047] In some implementations, the toxin is a substance that can cause pulmonary fibrosis.

[0048] In some implementations, the toxic substance includes environmental toxins, chemical toxins, or drugs with lung-damaging side effects.

[0049] In some implementations, the poison includes bleomycin, amiodarone, busulfan, or cisplatin.

[0050] In some embodiments, the sequence of the PPARγ promoter gene fragment is shown in SEQ ID NO: 2.

[0051] In some embodiments, the sequence of the promoter gene fragment of the PPRE response element is shown in SEQ ID NO:1.

[0052] In some embodiments, the reporter gene is a luciferase reporter gene, and the sequence of the luciferase reporter gene fragment is shown in SEQ ID NO: 3.

[0053] In some embodiments, the reporter gene includes a green fluorescent protein reporter gene, a chloramphenicol acetyltransferase reporter gene, a luciferase reporter gene, or a cell membrane anchored luciferase.

[0054] In some implementations, the PPARγ promoter gene fragment and the PPRE response element promoter gene fragment are linked upstream of the coding region of the reporter gene.

[0055] In some embodiments, the present invention provides a cell model for toxicant detection obtained by any of the methods described.

[0056] In some embodiments, the present invention provides a culture medium comprising the cell model described above.

[0057] In some embodiments, the present invention provides the application of the lung toxicity cell model in detecting toxins or screening drugs.

[0058] In some implementations, the detection of lung toxins includes monitoring toxins in the environment.

[0059] In some implementations, the poison includes chemical plant poisons.

[0060] In some implementations, the drug screening includes detecting the drug's toxic side effects.

[0061] In some implementations, the poison includes bleomycin, amiodarone, busulfan, or cisplatin.

[0062] Typically, pulmonary fibrosis toxins exist at low concentrations in daily life, and conventional methods for detecting them have low sensitivity. In some embodiments, the cell model provided by this invention can comprehensively characterize the toxicity of complex pulmonary fibrosis toxins, sensitively indicating the pulmonary fibrosis-related cytotoxic effects of complex toxins through the detection of cellular luciferase activity. Furthermore, in some cases, such as when chemical plant toxins cause significant environmental pollution and severely impact human health, the cell model provided by this invention is ideally suited for detecting these toxins. It is highly operable, sensitive, and suitable for high-throughput or large-scale detection, possessing significant practical and economic value.

[0063] In some embodiments, the cell model of the present invention, in practical applications, can be used to detect toxins in the environment by contacting the cell model of the present invention with the sample to be tested or exposing the cell model of the present invention to the environment to be tested, and comparing the cell model that has been contacted with the sample to be tested or exposed to the environment with the normal control (cell model that has not been contacted with the sample or environment). If the expression of luciferase in the cell model that has been contacted with the sample to be tested or exposed to the environment is higher than that in the normal control cell model, then the sample to be tested or the environment is determined to contain toxins.

[0064] In some embodiments, the present invention provides a method for screening drugs, wherein the drug to be screened is contacted with the cell model or the culture medium, and the toxic side effects of the drug to be screened are determined based on the toxic side effects of the drug to be screened.

[0065] In some implementations, this cell model of the present invention can be used in drug screening. For example, when a drug is in the development stage, it is necessary not only to verify that it has the corresponding therapeutic effect, but also to confirm that the toxic side effects of the newly developed drug do not exceed the prescribed range. Usually, animal experiments are required in the research. Animal experiments are not only time-consuming and costly, but also require specific locations. The cell model of the present invention is expected to become a new model for testing the toxic side effects of drugs (such as pulmonary toxic side effects) in a more economical, simple and efficient manner, and has a very good application prospect. Attached Figure Description

[0066] Figure 1 A schematic diagram of a lentiviral vector report map.

[0067] Figure 2 Microscopic morphology of A549 cell lines after stable transfection with lentiviral vector.

[0068] Figure 3 To stabilize the mRNA expression level of PPARγ and the luciferase activity in A549 cell lines transfected with lentiviral vector. (A) MRNA expression level of PPARγ. (B) Luciferase activity.

[0069] Figure 4 This figure shows the cell activity results after exposure to different concentrations of pulmonary fibrosis toxins.

[0070] Figure 5 The graph shows the luciferase activity results after exposure to different concentrations of pulmonary fibrosis toxins.

[0071] Figure 6 The results show the cell activity after exposure to toxins from other organs at different concentrations.

[0072] Figure 7 The graph shows the luciferase activity results after exposure to different concentrations of toxins in other organs.

[0073] Figure 8 The figure shows the luciferase activity results of the cell model prepared with PPRE×1 response element after bleomycin exposure. Detailed Implementation

[0074] The following specific embodiments further illustrate the technical solution of the present invention. These specific embodiments do not represent a limitation on the scope of protection of the present invention. Non-essential modifications and adjustments made by others based on the concept of the present invention still fall within the scope of protection of the present invention.

[0075] Although embodiments of the present invention have been shown and described herein, these embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

[0076] The specific embodiments of the present invention will be further described below with reference to the accompanying drawings. It should be noted that these descriptions of embodiments are intended to aid in understanding the invention and do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0077] Unless otherwise specified, the experimental methods used in the following embodiments of the present invention are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0078] Unless otherwise defined, all technical and scientific terms used herein are defined identically to those familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to the methods of this invention, with preferred methods and materials described in the detailed embodiments.

[0079] As used herein, the terms “comprising,” “having,” “containing,” and “including,” as well as other similar forms and their grammatical equivalents, are intended to be semantically equivalent and open-ended, because one or more items following any of these words do not imply an exhaustive list of those items or that they are limited to only the listed items. For example, an article “comprising” components A, B, and C may consist of components A, B, and C (i.e., containing only components A, B, and C), or may contain not only components A, B, and C, but may also include one or more other components. Therefore, it is intended and understood that “comprising” and its similar forms and their grammatical equivalents encompass disclosures of embodiments “consistently consisting of” or “comprises of.”

[0080] As used herein and in the appended claims, the singular forms “a / an,” “a / an,” and “the” include plural references unless the context clearly specifies otherwise. Thus, for example, reference to “a method” includes multiple such methods, and reference to “the segment” includes reference to one or more segments and their equivalents known to those skilled in the art, and so on.

[0081] Furthermore, unless otherwise stated, the use of "or" means "and / or". Similarly, "contains" and "includes" are interchangeable and are not intended to be restrictive.

[0082] It should be further understood that, when the term “comprising” is used to describe various embodiments, those skilled in the art will understand that, in certain specific circumstances, the language “substantially consisting of” or “consisting of” may be used instead to describe the embodiments.

[0083] It should be understood that this disclosure is not limited to the specific methods, schemes, and reagents described herein, and these methods are subject to change. The terminology used herein is for the purpose of describing specific embodiments or aspects only and is not intended to limit the scope of this disclosure.

[0084] In this embodiment, the cell model of the lung toxin contains a PPARγ promoter gene fragment, a PPRE response element promoter gene fragment, and a reporter gene fragment (luciferase reporter gene). The PPRE response element promoter gene fragment is sequentially linked upstream of the coding region of the reporter gene. The PPARγ promoter gene fragment is promoted by a separate CMV promoter. The vector includes a Mini-TK promoter fragment, a CMV promoter fragment, an SV40 promoter fragment, an SP6 promoter fragment, an SV40 promoter fragment, a PPARγ promoter gene fragment, a luciferase reporter gene fragment, and a PPRE×3 response element fragment. The Mini-TK promoter fragment is located between 2000 bp and 4000 bp; the CMV promoter fragment is located between 1 bp and 2000 bp and between 4000 bp and 6000 bp; the SV40 promoter fragment is located between 6000 bp and 8000 bp and between 1000 bp and 1000 bp. The SP6 promoter fragment is located between 0 bp and 12000 bp; the SV40 promoter fragment is located between 16000 bp and 17000 bp; the PPARγ promoter gene fragment is located between 4000 bp and 8000 bp; the luciferase reporter gene fragment is located between 2000 bp and 6000 bp; the PPRE×3 response element fragment is located between 2000 bp and 4000 bp; the PPRE×3 response element fragment is located upstream of the Mini-TK promoter fragment.

[0085] The materials used in the following embodiments of the present invention are as follows:

[0086] A549 cells were cultured in the laboratory according to standard procedures. Opti-MEM medium, F12K medium, LB medium and fetal bovine serum were purchased from Gibco. Cell culture plates of various sizes and white ELISA plates were purchased from Corning. Multifunctional ELISA reader was purchased from Mikoto Molecular Instruments Co., Ltd. Luciferase assay kit was purchased from Promega. Cell Counting Kit-8 (CCK-8) kit was purchased from Dojin, Japan.

[0087] ddH2O is sourced from: Tiangen Biotech Co., Ltd.

[0088] CutSmart Buffer 2 Source: New England Biolabs (NEB);

[0089] The GV130 vector was obtained from Shanghai Jikai Gene Chemical Technology Co., Ltd.

[0090] PacI is sourced from: Takara Bio Engineering (Dalian) Co., Ltd.;

[0091] EcoRI originates from: Takara Bio Engineering (Dalian) Co., Ltd.;

[0092] The AmMag Quatro Plasmid Purification Kit-24prep (water-eluting) is from Genscript Biotech Co., Ltd.; unless otherwise specified, the sequence from left to right in this article is 5'→3'.

[0093] Example 1: Method for constructing a rapid screening cell model for pulmonary fibrosis toxins

[0094] The construction method includes the following steps in sequence:

[0095] 1. Construct the PPRE×3-TKpromoter-firefly_Luciferase-CMV-NM_015869-3fag-SV40-puromycin lentivirus:

[0096] S1.1: Promoter synthesis: Obtain the PPRE×3 promoter fragment (SEQ ID NO:1:GCATGCCTGCAGGTCGACAGGGGACCAGGACAAAGGTCACGTTCGGGAGTCGACAGGGGACCAGGACAAAGGTCACGTTCGGGAGTCGACAGGGGACCAGGACAAAGGTCACGTTCGGGAGTCGACTCTAGAGGATCCGGCCCCGCCCA GCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCGAGGTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAACAGCGTCAACAGCGTGCCGCAGATCT);

[0097]

[0098]

[0099] S1.2: Vector digestion: First, prepare a 50 μL digestion system, including 42 μL ddH2O and 5 μL 10×CutSmart Buffer. 2 2 μL of purified GV130 vector plasmid DNA (1 μg / μL), 1 μL of PacI (10 U / μL), and 1 μL of EcoRI (10 U / μL) were added sequentially to the above reagent system. The mixture was gently pipetted and mixed, briefly centrifuged, and incubated at 37°C for 3 hours or overnight. The vector digestion products were then subjected to agarose gel electrophoresis, and the target band was recovered.

[0100] S1.3: PCR amplification of the PPRE×3 response element promoter fragment (primers are SEQ ID NO:4:TTTCTCTATCGATAGGTACCGCATGCCTGCAGGTCGACAGGGGACCAGGACAAAGGTCACGTTCGGGAGTCGACAGGGG and SEQ ID NO:5:CTTAGATCGCAGATCTCGAGAGATCTGCGGCACGCTGTTG), the PPARγ promoter fragment (primers are SEQ ID NO:6:GTTTAAACGGGCCCTCTAGACGCCACCATGGGTGAAACTCTGGGAGATTC and SEQ ID NO:7:CAGCGGTTTAACTATCTAGACTAGTACAAGTCCTTG) and the luciferase promoter fragment (primers are SEQ ID NO:8:GATCCAGTTTGGTTAATTAATCGATAGGTACCGCATGCCTGCAGGTCGACAGGGGACCAGGACAAAGGTCACGTTCGGGAGTCGACAGGGG and SEQ ID NO:5:CTTAGATCGCAGATCTCGAGAGATCTGCGGCCTGTTG), and SEQ ID NO:7:CTTAGATCGCAGATCTCGAGGTCGACAGGGG and SEQ ID NO:8:CTTAGATCGCAGATCTCGATAGGTACCGCATGCCTGCAGGTCGACAGGGGACCAGGACAAAGGTCACGTTCGGGAGTCGACAGGGG and SEQ ID NO:7:CTTAGATCGCAGATCTCGAGGTCGACAGGGG and SEQ ID NO:8 ... NO:9: CACACATTCCACAGGAATTCCTATTTGTCGTCATCATCCTTATAGTC): Prepare the PCR amplification reaction system, gently pipette to mix, briefly centrifuge, and place in a PCR instrument for reaction.

[0101] S1.4: Ligation and Transformation: The enzyme-digested GV130 vector was ligated with the amplified PPRE×3 response element promoter fragment, PPARγ promoter fragment, and luciferase promoter fragment at 4℃ for 18 h. After ligation, the ligation was performed and transformed into competent E. coli cells. The cells were gently tapped a few times to mix and incubated on ice for 30 min. The cells were then heat-shocked at 42℃ for 90 s and incubated in an ice-water bath for 2 min. 500 μL LLB medium was added, and the cells were incubated at 37℃ with shaking for 1 h. An appropriate amount of the bacterial culture was evenly spread onto a plate containing puromycin and incubated upside down in a constant temperature incubator for 12-16 h to obtain positive transformants.

[0102] S1.5: Sequencing: The identified positive clone transformants were inoculated into LB liquid medium containing 2 μg / mL puromycin and cultured at 37°C for 12-16 h. An appropriate amount of bacterial culture was then used for sequencing. The sequencing results were compared and analyzed with the target gene sequence.

[0103] Comparison results:

[0104] CAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATCCAGTTTGGTTAATTAATCGATAGGTAC

[0105] CGCATGCCTGCAGGTCGACAGGGGACCAGGACAAAGGTCACGTTCGGGAGTCGACAGGGGACCAGGACA

[0106] AAGGTCACGTTCGGGAGTCGACAGGGGACCAGGACAAAGGTCACGTTCGGGAGTCGACTCTAGAGGATC

[0107] CGGCCCCGCCCAGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCGAG

[0108] GTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAACA

[0109] GCGTCAACAGCGTGCCGCAGATCTCTCGAGATCTGCGATCTAAGTAAGCTTGGCATTCCGGTACTGTTGGTA

[0110] AAGCCACCATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCCGCTGGAAGATGGAAC

[0111] CGCTGGAGAGCAACTGCATAAGGCTATGAAGAGATACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATG

[0112] CACATATCGAGGTGGACATCACTTACGCTGAGTACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAA

[0113] CGATATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTTTATGCCGGTG

[0114] TTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATTTATAATGAACGTGAATTGCTCAAC

[0115] AGTATGGGCATTTCGCAGCCTACCGTGGTGTTCGTTTCCAAAAAGGGGTTGCAAAAAATTTTGAACGTGCA

[0116] AAAAAAGCTCCCAATCATCCAAAAAATTATTATCATGGATTCTAAAACGGATTACCAGGGATTTCAGTCGAT

[0117] GTACACGTTCGTCACATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTGCCAGAGTCCTTCGATAGG

[0118] GACAAGACAATTGCACTGATCATGAACTCCTCTGGATCTACTGGTCTGCCTAAAGGTGTCGCTCTGCCTCAT

[0119] AGAACTGCCTGCGTGAGATTCTCGCATGCCAGAGATCCTATTTTTGGCAATCAAATCATTCCGGATACTGCG

[0120] ATTTTAAGTGTTGTTCCATTCCATCACGGTTTTGGAATGTTTACTACACTCGGATATTTGATATGTGGATTTCG

[0121] AGTCGTCTTAATGTATAGATTTGAAGAAGAGCTGTTTCTGAGGAGCCTTCAGGATTACAAGATTCAAAGTGC

[0122] GCTGCTGGTGCCAACCCTATTCTCCTTCTTCGCCAAAAGCACTCTGATTGACAAATACGATTTATCTAATTTA

[0123] CACGAAATTGCTTCTGGTGGCGCTCCCCTCTCTAAGGAAGTCGGGGAAGCGGTTGCCAAGAGGTTCCATCT

[0124] GCCAGGTATCAGGCAAGGATATGGGCTCACTGAGACTACATCAGCTATTCTGATTACACCCGAGGGGGATGA

[0125] TAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTTTGAAGCGAAGGTTGTGGATCTGGATACCGGGAAAA

[0126] CGCTGGGCGTTAATCAAAGAGGCGAACTGTGTGTGAGAGGTCCTATGATTATGTCCGGTTATGTAAACAATC

[0127] CGGAAGCGACCAACGCCTTGATTGACAAGGATGGATGGCTACATTCTGGAGACATAGCTTACTGGGACGAA

[0128] GACGAACACTTCTTCATCGTTGACCGCCTGAAGTCTCTGATTAAGTACAAAGGCTATCAGGTGGCTCCCGC

[0129] TGAATTGGAATCCATCTTGCTCCAACACCCCAACATCTTCGACGCAGGTGTCGCAGGTCTTCCCGACGATG

[0130] ACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCACGGAAAGACGATGACGGAAAAAGAGATCGT

[0131] GGATTACGTCGCCAGTCAAGTAACAACCGCGAAAAAGTTGCGCGGAGGAGTTGTGTTTGTGGACGAAGTA

[0132] CCGAAAGGTCTTACCGGAAAACTCGACGCAAGAAAAATCAGAGAGATCCTCATAAAGGCCAAGAAGGGC

[0133] GGAAAGATCGCCGTGTAAACGCGTATGATTACGAATTAATTCGAGCTCGCCCGACATTGATTATTGACTAGTT

[0134] ATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTA

[0135] AATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTA

[0136] ACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACAT

[0137] CAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCC

[0138] CAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGAT

[0139] GCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCAT

[0140] TGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCC

[0141] CATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGT

[0142] CAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCG

[0143] CGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGAGTGACGTAAGTACCGCCTATAGAGTCT

[0144] ATAGGCCCACCCCCTTGGCTTCGTTAGAACGCGGCTACAATTAATACATAACCTTATGTATCATACACATACG

[0145] ATTTAGGTGACACTATAGAATAACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAACTG

[0146] CACCTCGGTTCTGCTAGCGTTTAAACGGGCCCTCTAGACGCCACCATGGGTGAAACTCTGGGAGATTCTCC

[0147] TATTGACCCAGAAAGCGATTCCTTCACTGATACACTGTCTGCAAACATATCACAAGAAATGACCATGGTTGA

[0148] CACAGAGATGCCATTCTGGCCCACCAACTTTGGGATCAGCTCCGTGGATCTCTCCGTAATGGAAGACCACT

[0149] CCCACTCCTTTGATATCAAGCCCTTCACTACTGTTGACTTCTCCAGCATTTCTACTCCACATTACGAAGACAT

[0150] TCCATTCACAAGAACAGATCCAGTGGTTGCAGATTACAAGTATGACCTGAAACTTCAAGAGTACCAAAGTG

[0151] CAATCAAAGTGGAGCCTGCATCTCCACCTTATTATTCTGAGAAGACTCAGCTCTACAATAAGCCTCATGAAG

[0152] AGCCTTCCAACTCCCTCATGGCAATTGAATGTCGTGTCTGTGGAGATAAAGCTTCTGGATTTCACTATGGAG

[0153] TTCATGCTTGTGAAGGATGCAAGGGTTTCTTCCGGAGAACAATCAGATTGAAGCTTATCTATGACAGATGTG

[0154] ATCTTAACTGTCGGATCCACAAAAAAAGTAGAAATAAATGTCAGTACTGTCGGTTTCAGAAATGCCTTGCA

[0155] GTGGGGATGTCTCATAATGCCATCAGGTTTGGGCGGATGCCACAGGCCGAGAAGGAGAAGCTGTTGGCGG

[0156] AGATCTCCAGTGATATCGACCAGCTGAATCCAGAGTCCGCTGACCTCCGGGCCCTGGCAAAACATTTGTAT

[0157] GACTCATACATAAAGTCCTTCCCGCTGACCAAAGCAAAGGCGAGGGCGATCTTGACAGGAAAGACAACAG

[0158] ACAAATCACCATTCGTTATCTATGACATGAATTCCTTAATGATGGGAGAAGATAAAATCAAGTTCAAACACA

[0159] TCACCCCCCTGCAGGAGCAGAGCAAAGAGGTGGCCATCCGCATCTTTCAGGGCTGCCAGTTTCGCTCCGTG

[0160] GAGGCTGTGCAGGAGATCACAGAGTATGCCAAAAGCATTCCTGGTTTTGTAAATCTTGACTTGAACGACCA

[0161] AGTAACTCTCCTCAAATATGGAGTCCACGAGATCATTTACACAATGCTGGCCTCCTTGATGAATAAAGATGG

[0162] GGTTCTCATATCCGAGGGCCAAGGCTTCATGACAAGGGAGTTTCTAAAGAGCCTGCGAAAGCCTTTTGGTG

[0163] ACTTTATGGAGCCCAAGTTTGAGTTTGCTGTGAAGTTCAATGCACTGGAATTAGATGACAGCGACTTGGCA

[0164] ATATTTATTGCTGTCATTATTCTCAGTGGAGACCGCCCAGGTTTGCTGAATGTGAAGCCCATTGAAGACATTC

[0165] AAGACAACCTGCTACAAGCCCTGGAGCTCCAGCTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTTGC

[0166] CAAGCTGCTCCAGAAAATGACAGACCTCAGACAGATTGTCACGGAACACGTGCAGCTACTGCAGGTGATC

[0167] AAGAAGACGGAGACAGACATGAGTCTTCACCCGCTCCTGCAGGAGATCTACAAGGACTTGTACGGAGGTG

[0168] GAGGATCAGACTACAAGGATGACGATGACAAGGATTACAAAGACGACGATGATAAGGACTATAAGGATGAT

[0169] GACGACAAATAG GAATTC CTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAG

[0170] GCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGC

[0171] AGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGT (SEQ ID NO: 10).

[0172] The alignment results show that the sequencing results are completely consistent with the target sequence.

[0173] S1.6: Plasmid Extraction: The correctly sequenced bacterial culture was transferred to 10 mL of LB liquid medium containing 2 μg / mL puromycin and incubated overnight at 37°C. Plasmid extraction was performed using the AmMag Quatro Plasmid Purification Kit-24prep (water elution) kit. The steps for extracting qualified plasmids are as follows:

[0174] (1) Collect the overnight cultured bacterial solution into a labeled 50mL centrifuge tube and centrifuge at 6000rpm for 3min;

[0175] (2) Discard the supernatant and mix the bacterial clump at the bottom of the centrifuge tube with the residual culture medium on a shaker.

[0176] (3) Place the centrifuge tube from step 2 into the corresponding sample tube position on the automatic extraction instrument;

[0177] (4) Place 40-45 mL of anhydrous ethanol into the corresponding reaction tube of the automatic extractor;

[0178] (5) Place the entire set of extraction reagents into the reagent rack of the automatic extractor, and then place the entire reagent rack into the corresponding position of the automatic extractor.

[0179] (6) Then prepare the appropriate number of pipette tips and collection tubes, and mark the plasmid number on the collection tubes;

[0180] (7) After preparation, check all equipment and confirm that everything is correct. Then close the automatic extraction chamber door and start the experiment.

[0181] (8) After the experiment, the plasmid was collected by centrifuging at 4500 rpm for 6 min using a 15 mL centrifuge.

[0182] (9) In a clean bench, transfer the collected plasmids into a sterile 1.5 mL EP tube;

[0183] (10) Take 20 μL of plasmid from step (9) for quality control, and the obtained plasmid report map is as follows: Figure 1 As shown, the PPRE×3-TK promoter-firefly_Luciferase-CMV-NM_015869-3fag-SV40-puromycin lentivirus was successfully obtained.

[0184] 2. Cells were transfected with PPRE×3-TK promoter-firefly_Luciferase-CMV-NM_015869-3fag-SV40-puromycin lentivirus:

[0185] S2.1: Preparation of target cells A549:

[0186] (1) Take the cell cryopreservation tubes out of the liquid nitrogen tank and quickly place them in a 37°C water bath, shaking them occasionally to thaw them as quickly as possible.

[0187] (2) After complete thawing, centrifuge at 1300 rpm for 3 min, wipe the cryovial with 75% alcohol for disinfection, and then transfer it to a biosafety cabinet.

[0188] (3) Remove the supernatant of the cryopreservation solution, add 1 mL of F12K complete culture medium containing 10% fetal bovine serum to resuspend the cells, inoculate the cell suspension into a 6-cm culture dish containing 3 mL of complete culture medium, gently shake and place in a 37℃, 5% CO2 incubator.

[0189] (4) Change the culture medium after 24 hours and continue culturing until the cell confluence reaches about 80% for passage culture to maintain good cell growth.

[0190] S2.2: Determination of puromycin drug screening concentration:

[0191] (1) A549 cells in the logarithmic growth phase were trypsinized and mixed with F12K complete medium containing 10% fetal bovine serum to prepare 6×10⁶ cells / year. 4 Cell suspension of cells / mL.

[0192] (2) Take 500 μL of cell suspension and seed it into 48-well plates (8 wells in total) and continue to culture.

[0193] (3) On the second day after plating, change the solution and add puromycin to the eight wells at final concentrations of 0 μg / mL, 0.5 μg / mL, 1 μg / mL, 2 μg / mL, 4 μg / mL, 6 μg / mL, 8 μg / mL and 10 μg / mL respectively.

[0194] (4) Observe the cell status under a microscope 48 hours after adding puromycin (the cell density of the untreated group is between 60% and 90%). At this time, the cells in the high-concentration puromycin group should be almost completely dead. If an effective killing concentration is not screened, the drug gradient screening needs to be redesigned. The lowest concentration designed will also kill all the cells, so the concentration should also be redesigned.

[0195] (5) By observing the cell state, the lowest concentration that would cause the cells to die completely, 2 μg / mL, was determined as the optimal concentration for screening puromycin for this cell.

[0196] S2.3: Viral infection of target cells

[0197] (1) A549 cells in the logarithmic growth phase were digested with trypsin and then prepared into 1×10⁻⁶ cells using F12K complete medium containing 10% fetal bovine serum. 5 Cell suspension of 10 cells / mL was seeded into 6-well culture plates and cultured to ensure that the plate coverage reached about 15-30% at the time of infection.

[0198] (2) Based on the MOI of A549 cells and cell infection conditions, change the infection medium and add 20 μL of virus (i.e., PPRE×3-TK promoter-firefly_Luciferase-CMV-NM_015869-3fag-SV40-puromycin lentivirus) per well for infection.

[0199] (3) Observe the cell status after infection and replace it with F12K complete medium containing 10% fetal bovine serum for continued culture. Generally, replace it with conventional medium about 8-16 hours after infection.

[0200] S2.4: After infection, cells are screened by adding puromycin.

[0201] 3. Screening for stable cell lines:

[0202] S3.1: Observe cell status and infection efficiency 72 hours after infection. Cells should be in good condition with no significant cell death, and the cell status of the lentivirus-infected group should be comparable to that of the control group.

[0203] S3.2: Add 2 μg / mL of puromycin and screen for at least 48 hours. Continue to screen and amplify infected cells, and collect cells for target gene expression detection to identify the target gene expression level.

[0204] S3.3: Cells maintained at a puromycin concentration were further expanded to obtain a stable A549 cell line transfected with the lentiviral vector. Microscopic observation of the cell morphology is shown as follows. Figure 2 As shown.

[0205] After the target gene expression detection results are satisfactory, the cells will be cryopreserved. The detection results are as follows: Figure 3 As shown in A and 3B, the mRNA expression level of PPARγ in the A549 cell line stably transfected with the lentiviral vector was significantly higher than that in untransfected A549 cells, and the luciferase activity of the A549 cell line stably transfected with the lentiviral vector was also significantly higher than that of the transfected A549 cells. The results demonstrate that this invention has indeed successfully obtained PPARγ-luciferase reporter gene-A549 cells.

[0206] Example 2: Application of the PPARγ-luciferase reporter gene-A549 cell model (hereinafter referred to as "A549 cell lung toxin cell model A") in predicting and screening pulmonary fibrosis toxins.

[0207] 2.1 Confirmation of maximum exposure concentrations for bleomycin, amiodarone, busulfan, and cisplatin

[0208] Four pulmonary fibrosis toxins—bleomycin, amiodarone, busulfan, and cisplatin—were selected as positive compounds to verify the accuracy of screening for pulmonary fibrosis toxins using the A549 cell lung toxin model A.

[0209] First, the cell viability of A549 cells (A549 cell lung toxin cell model A) 24 hours after exposure to bleomycin, amiodarone, busulfan, and cisplatin was detected using a CCK-8 assay kit. The maximum exposure concentration of the positive compounds was defined as the concentration at which cell viability reached 90%. The experimental results are as follows: Figure 4 As shown.

[0210] The maximum exposure concentration for bleomycin, amiodarone, busulfan, and cisplatin was ultimately determined to be 10 μM.

[0211] 2.2 A549 cell model for predicting and screening pulmonary fibrosis toxins

[0212] Within the maximum exposure concentration range, different gradient exposure concentrations were set, with six replicates for each group. Before exposure, the Opti-MEM medium of the transfected A549 cells (A549 cell lung toxin cell model A) was removed, and 200 μL of F12K complete medium containing 10% fetal bovine serum with various concentrations of pulmonary fibrosis toxins was added. After 24 h of exposure, the medium was aspirated, the cells were washed twice with PBS, and luciferase activity was detected using a luciferase assay system.

[0213] The method for detecting luciferase activity is as follows: 100 μL of cell lysis buffer is added to each well to lyse the cells. After complete lysis, the lysis products are collected, and 20 μL of the lysate is added to a 96-well microplate. 100 μL of firefly luciferase detection reagent is added and mixed well. The assay is performed on a microplate reader with an interval of 2 seconds and a measurement time of 10 seconds to obtain the biofluorescence of firefly luciferase. The stronger the toxicity of the pulmonary fibrosis toxin, the lower the luciferase activity and the weaker the biofluorescence.

[0214] Experimental results are as follows Figure 5 As shown. (Through) Figure 5 It can be seen that there are significant differences between the groups exposed to different concentrations of pulmonary fibrosis toxins and the control group (P<0.05). Exposure to pulmonary fibrosis toxins weakens luciferase activity, and there is a certain dose-response relationship between luciferase activity and the concentration of pulmonary fibrosis toxins.

[0215] The results show that the cytotoxicity screening system based on luciferase reporter gene constructed in this invention can screen out a variety of pulmonary fibrosis toxins, detect low concentrations of pulmonary fibrosis toxins, and the model has high accuracy.

[0216] Experimental Example 3

[0217] The method was the same as in Example 2, using the same cell model, except that 10 other organ toxicants were selected as negative compounds, including the cardiotoxic chemicals imatinib and isoproterenol, the hepatotoxic chemicals diclofenac and trovafloxacin, the immunotoxic chemicals rapamycin and procaine, the neurotoxic chemicals metronidazole and oxaliplatin, and the nephrotoxic chemicals indomethacin and methotrexate.

[0218] Similarly, the viability of A549 cells after 24 hours of exposure to 10 negative compounds was detected using the CCK-8 assay kit. The maximum exposure concentration of the negative compounds was defined as the concentration at which cell viability reached 90% or higher. The experimental results are as follows: Figure 6 As shown, 10 μM was ultimately determined to be the maximum exposure concentration for these 10 other organ toxicants.

[0219] Within the maximum exposure concentration range, different gradient exposure concentrations were set up, with 6 replicates for each group. Before exposure, the Opti-MEM medium of the transfected A549 cells was removed, and 200 μL of F12K complete medium containing 10% fetal bovine serum and various concentrations of negative compounds was added. After 24 h of exposure, the medium was aspirated, the cells were washed twice with PBS, and luciferase activity was detected using a luciferase assay system.

[0220] The method for detecting luciferase activity is as follows: 100 μL of cell lysis buffer is added to each well to lyse the cells. After complete lysis, the lysis products are collected. 20 μL of the lysate is added to a 96-well microplate, and 100 μL of firefly luciferase detection reagent is added and mixed well. The results are then measured on a microplate reader with a measurement interval of 2 seconds and a measurement time of 10 seconds. The biofluorescence of firefly luciferase is obtained. The stronger the toxicity of the toxin, the lower the luciferase activity and the weaker the biofluorescence.

[0221] Experimental results are as follows Figure 7 As shown. (Through) Figure 7 It was found that there were no significant differences between the negative compound exposure groups and the control group (P>0.05). Exposure to the negative compound did not affect luciferase activity, and there was no dose-response relationship between luciferase activity and other organ toxicants. These results indicate that the cytotoxicity screening system based on the luciferase reporter gene constructed in this invention has high specificity in screening for pulmonary fibrosis toxins.

[0222] Experimental Example 1

[0223] In this embodiment, the PPRE×3 response element promoter fragment is replaced with the PPRE×1 response element sequence (SEQ ID NO: 11AGGTGAAAGGGCAAAGCTTAGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAG) based on Example 1. Other conditions are the same as in Example 1, and an A549 cell lung toxin cell model (hereinafter referred to as A549 cell lung toxin cell model B) is obtained.

[0224] The A549 cell lung toxin model B was then used to predict and screen for pulmonary fibrosis toxins, similar to Example 2, except that the pulmonary fibrosis toxin was bleomycin. The results were as follows. Figure 8 As shown.

[0225] Among them, the Control group refers to the untreated A549 cell lung toxin cell model B; the 0.5h group refers to the A549 cell lung toxin cell model B treated with 10 μM bleomycin for 0.5h; the 1h group refers to the A549 cell lung toxin cell model B treated with 10 μM bleomycin for 1h; and the 1.5h group refers to the A549 cell lung toxin cell model B treated with 10 μM bleomycin for 1.5h.

[0226] [1] Li Jinhong. Effects and mechanisms of rapamycin on the function of 3T3-L1 preadipocytes [D]. Beijing: Peking Union Medical College, Chinese Academy of Medical Sciences, 2011.

[0227] 【2】Shimada T,KoitabashiA,Fujii Y,et al.PPARγmediates NSAIDs-inducedupregulation of TFF2 expression in gastric epithelial cells[J].FEBS Letters,2004,559(1-3):99-104.doi:10.1016 / S0014-5793(04)00035-2.

[0228] 【3】Zanardelli M, Micheli L, Cinci L, et al.OxaliplatinNeurotoxicityInvolves Peroxisome Alterations.PPARγAgonism as Preventive PharmacologicalApproach[J].PLoS ONE,2014,9(7):e102758.doi:10.1371 / journal.pone.0102758.

[0229] 【4】Jack, BUAn investigation into the Anti-obesity properties of Cyclopia. Stellenbosch University, 2016.

[0230] The embodiments described in this invention are merely illustrative examples and are not intended to limit the implementation of this invention. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principles of this invention should be considered equivalent substitutions and should fall within the protection scope of this invention.

Claims

1. A cell model for detecting toxins, characterized in that, The cell model contains a PPARγ promoter gene fragment, a PPRE response element promoter gene fragment, and a reporter gene fragment; the PPARγ promoter gene fragment and the PPRE response element promoter gene fragment are sequentially linked upstream of the coding region of the reporter gene.

2. The cell model as described in claim 1, characterized in that, The reporter genes include green fluorescent protein reporter gene, chloramphenicol acetyltransferase reporter gene, luciferase reporter gene or cell membrane anchored luciferase; Preferably, the poison is a lung poison; Preferably, the pulmonary toxin is a substance that can cause pulmonary fibrosis; Preferably, the pulmonary toxin includes environmental toxins, chemical plant toxins, or drugs with pulmonary toxicity. Preferably, the poison includes bleomycin, amiodarone, busulfan, or cisplatin; Preferably, the sequence of the PPARγ promoter gene fragment is shown in SEQ ID NO: 2; Preferably, the sequence of the PPRE response element promoter gene fragment is shown in SEQ ID NO:1; Preferably, the reporter gene is a luciferase reporter gene, and the sequence of the luciferase reporter gene fragment is shown in SEQ ID NO:

3.

3. A carrier, characterized in that, It is derived from a backbone plasmid, into which a PPARγ promoter gene fragment, a PPRE response element promoter gene fragment, and a reporter gene fragment are inserted; the PPARγ promoter gene fragment and the PPRE response element promoter gene fragment are sequentially linked upstream of the coding region of the reporter gene; Preferably, the backbone plasmid is selected from the GV130 vector; Preferably, the reporter gene is selected from green fluorescent protein reporter gene, chloramphenicol acetyltransferase reporter gene, luciferase reporter gene or cell membrane anchored luciferase; Preferably, the sequence of the PPARγ promoter gene fragment is shown in SEQ ID NO: 2; Preferably, the sequence of the PPRE response element promoter gene fragment is shown in SEQ ID NO:1; Preferably, the reporter gene is a luciferase reporter gene, and the sequence of the luciferase reporter gene fragment is shown in SEQ ID NO: 3; Preferably, the vector is a plasmid vector; Preferably, the vector comprises a Mini-TK promoter fragment, a CMV promoter fragment, an SV40 promoter fragment, an SP6 promoter fragment, an SV40 promoter fragment, a PPARγ promoter gene fragment, a luciferase reporter gene fragment, and a PPRE×3 response element fragment; Preferably, the Mini-TK promoter segment is located between 2000bp and 4000bp; Preferably, the CMV promoter fragment is located between 1bp and 2000bp and between 4000bp and 6000bp; Preferably, the SV40 promoter segment is located between 6000bp and 8000bp and between 10000bp and 12000bp; preferably, the SP6 promoter segment is located between 4000bp and 6000bp. Preferably, the SV40 promoter segment is located between 16000bp and 17000bp; Preferably, the PPARγ promoter gene fragment is located between 4000 bp and 8000 bp; Preferably, the luciferase reporter gene fragment is located between 2000 bp and 6000 bp; Preferably, the PPRE×3 response element segment is located between 2000bp and 4000bp; Preferably, the PPRE×3 response element segment is located upstream of the Mini-TK promoter segment; Preferably, the carrier is a carrier used to prepare a cell model for diagnostic toxins; Preferably, the vector is a lentiviral vector.

4. A cell model for detecting toxins, characterized in that, It includes the carrier as described in claim 3.

5. Use of the carrier according to claim 3 in preparing a cell model for detecting toxins.

6. A method for preparing a cell model for detecting toxins, characterized in that, include: Cells were transfected with the vector described in claim 3 to obtain a toxic cell model; Preferably, the vector is a lentiviral vector; Preferably, the method for preparing the lentiviral vector includes the following steps: S1.1 Obtain the PPARγ promoter gene fragment, the PPRE response element promoter gene fragment, and the reporter gene fragment; S1.2 The backbone vector is digested with enzymes to obtain the target band. S1.3 The target band digested by the enzyme is ligated with the PPARγ promoter gene fragment, the PPRE response element promoter gene fragment and the reporter gene fragment, and transformed to obtain the lentiviral vector; Preferably, in S1.3, the connection includes enzyme connection; Preferably, the skeleton carrier is a GV130 carrier; Preferably, the enzyme comprises PacI and EcoRI; Preferably, the transformation includes transforming the enzyme-ligated product into competent E. coli cells to obtain positive clone transformants; Preferably, the sequence of the positive clone transformant is shown in SEQ ID NO:10; Preferably, the process further includes sequencing after transformation, followed by transferring the target bacterial culture to LB liquid medium containing puromycin for recombinant vector extraction to obtain the lentiviral vector; Preferably, the vector is selected from plasmids; Preferably, the step of transfecting cells with the lentiviral vector includes: S2.1 Infect cells by adding the lentiviral vector described above, and then add puromycin for selection after infection; S2.1 The cells with puromycin added to maintain the concentration were further expanded. Once the target gene expression detection results were qualified, a stable cell line of the toxic cell model was obtained. Preferably, the cells transfected by the lentiviral recombinant vector include A549 cells, HeLa cells, THP-1 cells, or HEK293T cells. Preferably, the toxin is a substance that can cause pulmonary fibrosis; Preferably, the toxic substance includes environmental toxic substances, chemical plant toxic substances, or drugs with lung-damaging toxic side effects; Preferably, the poison includes bleomycin, amiodarone, busulfan, or cisplatin; Preferably, the sequence of the PPARγ promoter gene fragment is shown in SEQ ID NO: 2; Preferably, the sequence of the PPRE response element promoter gene fragment is shown in SEQ ID NO:1; Preferably, the reporter gene is a luciferase reporter gene, and the sequence of the luciferase reporter gene fragment is shown in SEQ ID NO: 3; preferably, the reporter gene includes a green fluorescent protein reporter gene, a chloramphenicol acetyltransferase reporter gene, a luciferase reporter gene, or a cell membrane anchored luciferase. Preferably, the PPARγ promoter gene fragment and the PPRE response element promoter gene fragment are linked upstream of the coding region of the reporter gene.

7. The cell model for detecting toxins obtained by the method of any one of claims 3-6.

8. A culture medium, characterized in that, The culture medium includes the cell model described in claim 1, 2, 4, or 7.

9. The application of the cell model for detecting toxins as described in claim 1, 2, 4, or 7 in detecting toxins or screening drugs; Preferably, the detection of toxins includes monitoring toxins in the environment; Preferably, the poison includes chemical plant poisons; Preferably, the drug screening includes detecting the drug's toxic side effects; Preferably, the poison includes bleomycin, amiodarone, busulfan, or cisplatin.

10. A method for screening drugs, characterized in that, The drug to be screened is contacted with the cell model described in claim 1, 2, 4, or 7, or the culture medium described in claim 8, and the drug to be screened is determined based on its toxic side effects.

Images