Lactobacillus plantarum capable of relieving enteritis and toxicity of polystyrene nano plastic and application of lactobacillus plantarum

Abstract

The invention discloses lactobacillus plantarum capable of relieving enteritis and toxicity of polystyrene nano-plastics, and the preservation number of the lactobacillus plantarum is CGMCC (China General Microbiological Culture Collection Center) NO.31420. The lactobacillus plantarum can be used for relieving enteritis and toxicity of polystyrene nano-plastics. The strain is obtained by separating and purifying baby feces, and can grow on an MRS culture medium, and the bacterial colony is round, off-white, smooth and opaque. Experiments show that the lactobacillus plantarum can effectively adsorb PS-NPs, promote the PS-NPs to be discharged along with excrement, reduce accumulation of the PS-NPs in organs, and significantly reduce toxicity and inflammatory response of organs such as liver and kidney of mice. In addition, the strain can repair the intestinal barrier function, regulate liver metabolism and relieve enteritis symptoms. The invention further provides a probiotic preparation containing the strain, and the probiotic preparation can be prepared into granules, capsules, tablets or oral liquid and the like and is used for preventing or treating intestinal injury and inflammatory diseases caused by PS-NPs. The strain is safe and efficient, and has a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of strains and biological agents for alleviating the toxicity of PS-NPs, specifically involving a strain of *Lactobacillus plantarum* that can alleviate enteritis and polystyrene nanoplastic toxicity and its application. Background Technology

[0002] Plastic is a strong, lightweight material whose resistance to degradation and its moldability make it one of the most versatile materials. Due to physical and chemical changes, large plastic products can break down into smaller particles; plastic particles with a diameter of less than 100 nm are called nanoplastics (NPs). Polystyrene nanoplastics (PS-NPs), as a novel pollutant, have been widely detected in various aquatic environments and readily serve as carriers for other small-molecule pollutants. Humans can easily ingest them from food packaging, salt, and drinking water, posing a serious threat to human health. Long-term exposure to PS-NPs can cause certain toxicity to the respiratory, immune, and nervous systems. Furthermore, the concentration of plastic particles in the feces of patients with inflammatory bowel disease is significantly higher than that of healthy individuals. Therefore, promoting the elimination of PS-NPs from the body, reducing PS-NP damage to the intestines, and alleviating enteritis have become research hotspots.

[0003] Probiotics are a general term for active beneficial microorganisms that colonize the human gut and reproductive system. *Lactobacillus plantarum* is closely related to human life, not only widely found in various foods such as fruits, meats, milk, cheese, and vegetables, but also in the gastrointestinal tract. *Lactobacillus plantarum* can be used to treat hypertension, diabetes, obesity, and cardiovascular diseases, and can alleviate inflammatory bowel disease through multiple pathways. This invention screened a strain with good adsorption effects on PS-NPs, and further used this strain as a therapeutic agent to remove PS-NPs from the body and reduce their harmful effects, which is of great significance for maintaining host health. Summary of the Invention

[0004] The purpose of this invention is to provide a *Lactobacillus plantarum* that can alleviate enteritis and PS-NPs toxicity and its application. The *Lactobacillus plantarum* can colonize the body and adsorb PS-NPs in the body, promoting the excretion of PS-NPs with feces, thereby alleviating the toxicity caused by PS-NPs and playing an important role in maintaining the health of the host.

[0005] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0006] A plant-based Lactobacillus species that can alleviate enteritis and polystyrene nanoplastic toxicity has been deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.31420.

[0007] Furthermore, the *Lactobacillus plantarum* is obtained by isolating and purifying it from infant feces;

[0008] Its 16S rDNA sequence is shown in the sequence listing; it can grow on MRS solid medium, and the colonies are round, smooth and opaque, grayish-white, small and dense; the optimal growth temperature is 37℃ and the culture time is 12 hours.

[0009] The present invention also provides the application of *Lactobacillus plantarum*, which has the ability to alleviate enteritis and polystyrene nanoplastic toxicity, in the preparation of biological agents that alleviate enteritis and PS-NPs toxicity. The *Lactobacillus plantarum* can promote the excretion of PS-NPs with feces, reduce the accumulation of PS-NPs in organs, reduce the toxicity of PS-NPs to various organs of mice, and significantly reduce the inflammatory response in mice.

[0010] Furthermore, the aforementioned *Lactobacillus plantarum* can reduce the accumulation of PS-NPs in organs, alleviate histopathological damage, inhibit inflammatory responses, relieve enteritis, repair the intestinal barrier, and regulate liver metabolism.

[0011] Furthermore, the nanoplastic is one or more of polystyrene, polyvinyl chloride, and polypropylene;

[0012] The PS-NPs are obtained from food.

[0013] Furthermore, the effective dose of PS-NPs for *Lactobacillus plantarum* is 10 mg / kg body weight; the viable count of *Lactobacillus plantarum* used is 5 × 10⁻⁶. 9 CFU / mL.

[0014] The present invention also provides a probiotic preparation comprising live Lactobacillus plantarum, which has the ability to alleviate enteritis and polystyrene nanoplastic toxicity, and / or its fermentation products.

[0015] Furthermore, it also includes one or more of the following: Lactobacillus acidophilus, Leuconostoc mesenteroides, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus casei, Lactobacillus helveticus, Streptococcus thermophilus, Lactobacillus rhamnosus, Lactobacillus paracasei, Lactobacillus salivarius, Leuconostoc mesenteroides, Lactobacillus brevis, Bifidobacterium longum, Bifidobacterium infantis, Bifidobacterium brevis, Bifidobacterium bifidum, Bacillus coagulans, Lactococcus, Lactobacillus curvatureii, Lactobacillus reuteri, Lactobacillus casei, Pediococcus pentosus, Lactobacillus bulgaricus, Lactobacillus gasseri, or Streptococcus thermophilus.

[0016] Furthermore, the preparation is in the form of granules, capsules, tablets, pills, or oral liquid.

[0017] The present invention also provides the application of Lactobacillus plantarum, which has the ability to alleviate enteritis and polystyrene nanoplastic toxicity, in the preparation of drugs or functional foods that alleviate enteritis and PS-NPs toxicity.

[0018] The present invention has the following advantages and beneficial effects:

[0019] This invention establishes mouse models by exposing healthy mice and mice with enteritis to low doses of PS-NPs, and then treating them with *Lactobacillus plantarum* ZP-6. The aim is to provide new insights into the application of probiotics and the prevention and mitigation of human damage caused by harmful substances such as PS-NPs. Results show that *Lactobacillus plantarum* ZP-6 provided by this invention can promote the excretion of PS-NPs in feces, reduce the accumulation of PS-NPs in organs, thereby alleviating the toxicity of PS-NPs to various organs in mice, and significantly reducing the inflammatory response in mice. The *Lactobacillus plantarum* ZP-6 screened in this invention is a safe strain that can effectively alleviate the biotoxicity caused by PS-NPs, and has high research and application value. Attached Figure Description

[0020] Figure 1 This is a colony diagram of Lactobacillus plantarum ZP-6;

[0021] Figure 2 The effects of PS-NPs on physical indicators in healthy mice and mice with enteritis;

[0022] Figure 3 The effect of Lactobacillus plantarum ZP-6 on the body weight changes of healthy mice and mice with enteritis in mitigating the toxicity of PS-NPs;

[0023] Figure 4 Lactobacillus plantarum ZP-6 alleviated changes in organ coefficients in healthy mice affected by PS-NPs toxicity;

[0024] Figure 5 The changes in organ coefficients in mice with PS-NPs toxic enteritis were mediated by Lactobacillus plantarum ZP-6.

[0025] Figure 6 The content of PS-NPs in the blood and feces of healthy mice was measured by Lactobacillus plantarum ZP-6 to alleviate PS-NPs toxicity.

[0026] Figure 7 The level of PS-NPs in the blood of mice with PS-NPs-toxic enteritis alleviated by Lactobacillus plantarum ZP-6;

[0027] Figure 8The content and distribution of PS-NPs in the organs and intestines of healthy mice that were treated with Lactobacillus plantarum ZP-6 to alleviate PS-NPs toxicity;

[0028] Figure 9 The content and composition of PS-NPs in organs and intestines of mice with PS-NPs-toxic enteritis alleviated by Lactobacillus plantarum ZP-6;

[0029] Figure 10 These are pathological sections of organs and intestines from healthy mice that have been shown to have been treated with Lactobacillus plantarum ZP-6 to alleviate PS-NPs toxicity.

[0030] Figure 11 The effect of Lactobacillus plantarum ZP-6 on the expression of inflammatory factors in healthy mice that alleviate PS-NPs toxicity;

[0031] Figure 12 The effect of Lactobacillus plantarum ZP-6 on the expression of inflammatory factors in mice with PS-NPs toxic enteritis. Detailed Implementation

[0032] The following examples further illustrate the above-described content of the present invention in detail, but should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Reagents and instruments used, unless otherwise specified, are all conventional products purchased through legitimate commercial channels.

[0033] Example 1:

[0034] Culture, isolation and screening of strains

[0035] 1. Screening of strains capable of adsorbing PS-NPs in vitro

[0036] Prepare MRS (Man Rogosa Sharpe) liquid culture medium: 1000mL ultrapure water, 10g peptone, 10g beef extract, 5.0g yeast extract, 5g sodium acetate, 5g glucose, 2g potassium dihydrogen phosphate, 1.0mL Tween 80, 2.0g diamine citrate, 20g calcium carbonate, 0.58g magnesium sulfate, 0.25g manganese sulfate. Adjust the pH of the mixture to 6.2-6.5.

[0037] To prepare MRS solid medium: add 15-20g agar to 1000ml MRS liquid medium.

[0038] Fresh or frozen fecal samples were suspended in sterile phosphate-buffered saline (1:10) and swirled until large particles were dispersed. The suspension was then filtered sequentially through sterile 200-mesh, 400-mesh, and 800-mesh filters to remove undigested food and smaller particles. 100 μL of the mixture was serially diluted, spread onto MRS agar, and anaerobically incubated at 37°C for 36 h until single colonies appeared for microscopic examination. Based on the microscopic results, the applicant screened 32 potential lactic acid bacteria strains, named ZP-1, ZP-2, ..., ZP-32. Single colonies were picked and cultured in liquid MRS medium for further spread isolation, undergoing 3-5 purification and isolation cycles to obtain pure cultures of different morphologies. The pure cultures were then picked and incubated overnight at 37°C to obtain the initial screening bacterial suspension.

[0039] 2. Isolation of strains capable of adsorbing PS-NPs in vitro

[0040] 2.1 Preparatory work

[0041] Prepare PS-NPs solution: Add 0.02g of 100nm PS-NPs to a volumetric flask, add sterile water to make up to 200ml, mix thoroughly using a vortex mixer to prepare a 100μg / ml stock solution, and dilute with sterile water to the required concentration before use.

[0042] Strain activation culture: Take out the lactic acid bacteria strains stored in vacuum freeze-drying, inoculate them into MRS liquid medium, and incubate at 37℃ for 36h, then activate them 2-3 times consecutively.

[0043] Preparation of bacterial suspension: Centrifuge the lactic acid bacteria strain culture medium (6000 r / min, 4℃, 15 min), collect the bacterial cells, wash twice with sterile physiological saline by centrifugation and resuspend, and adjust the strain cell concentration to 5 × 10⁻⁶. 9 CFU / mL.

[0044] 2.2 Detection of the ability of strains to adsorb PS-NPs

[0045] Determination of PS-NPs adsorption efficiency by bacterial cells: Centrifuge 1 mL of bacterial suspension for 10 min (4℃, 6000 r / min), discard the supernatant, add 1 mL of PS-NPs solution (40 μg / mL), mix well, and adsorb at 37℃ for 2 h. After adsorption, centrifuge again for 10 min, collect the supernatant, and calculate the adsorption rate using the direct counting method under a microscope. The blank control was a microplastic solution without lactic acid bacteria. Each group was repeated in triplicate.

[0046] The adsorption rate of PS-NPs by the strain was calculated using the following formula:

[0047] Adsorption rate (%) = [(Number of polystyrene nanoplastics in blank - Number of polystyrene nanoplastics in sample) / Number of polystyrene nanoplastics in blank] × 100%.

[0048] 2.3 Selection of strains for adsorbing PS-NPs

[0049] The adsorption rates of PS-NPs were determined using lactic acid bacteria strains ZP-1-ZP-32, and strains with high overall adsorption capacity were selected.

[0050] The results showed that among the 32 potential lactic acid bacteria strains isolated, strain ZP-6 had the highest adsorption rate for plasticizers, at 71.41%. Subsequent experiments used Lactobacillus plantarum ZP-6 to treat PS-NPs.

[0051] Example 2:

[0052] Strain identification:

[0053] 1. Colony morphology identification

[0054] The colony image of strain ZP-6 inoculated on MRS agar medium is shown below. Figure 1 As shown, the colonies are round, smooth and opaque, grayish-white, and tiny.

[0055] 2. Molecular biological identification

[0056] The 16S rDNA sequence of strain ZP-6 was obtained by sequencing and compared with the NCBI database, confirming that the strain is *Lactobacillus plantarum*. The specific 16S rDNA sequence is as follows:

[0057] GTGCTATACTGCAGTCGAACGAACTCTGGTATTGATTGGTGCTTGCATC

[0058] ATGATTTACATTTGAGTGAGTGGCGAACT

[0059] GGTGAGTAACACGTGGGAAACCTGCCCAGAAGCGGGGGATAACACCT

[0060] GGAAACAGATGCTAATACCGCATAACAA

[0061] CTTGGACCGCATGGTCCGAGCTTGAAAGATGGCTTCGGCTATCACTTT

[0062] TGGATGGTCCCGCGGCGTATTAGCTAGAT

[0063] GGTGGGGTAACGGCTCACCATGGCAATGATACGTAGCCGACCTGAGAG

[0064] GGTAATCGGCCACATTGGGACTGAGACA

[0065] CGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATG

[0066] GACGAAAGTCTGATGGAGCAACGCCGCG

[0067] TGAGTGAAGAAGGGTTTCGGCTCGTAAAACTCTGTTGTTAAAGAAGA

[0068] ACATATCTGAGAGTAACTGTTCAGGTATT

[0069] GACGGTATTTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCG

[0070] CGGTAATACGTAGGTGGCAAGCGTTGTCC

[0071] GGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTTTTAAGTCTGATG

[0072] TGAAAGCCTTCGGCTCAACCGAAGAAGT

[0073] GCATCGGAAACTGGGAAACTTGAGTGCAGAAGAGGACAGTGGAACT

[0074] CCATGTGTAGCGGTGAAATGCGTAGATATA

[0075] TGGAAGAACACCAGTGGCGAAGGCGGCTGTCTGGTCTGTAACTGACG

[0076] CTGAGGCTCGAAAGTATGGGTAGCAAAC

[0077] AGGATTAGATACCCTGGTAGTCCATACCGTAAACGATGAATGCTAAGTG

[0078] TTGGAGGGTTTCCGCCCTTCAGTGCTGC

[0079] AGCTAACGCATTAAGCATTCCGCCTGGGGAGTACGGCCGCAAGGCTGA

[0080] AACTCAAAGGAATTGACGGGGGCCCGC

[0081] ACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCTACGCGAAGAACCTT

[0082] ACCAGGTCTTGACATACTATGCAAATCTA

[0083] AGAGATTAGACGTTCCCTTCGGGGACATGGATACAGGTGGTGCATGGT

[0084] TGTCGTCAGCTCGTGTCGTGAGATGTTGG

[0085] GTTAAGTCCCGCAACGAGCGCAACCCTTATTATCAGTTGCCAGCATTA

[0086] AGTTGGGCACTCTGGTGAGACTGCCGGTG

[0087] ACAAACCGGAGGAAGGTGGGGATGACGTCAAATCATCATGCCCCTTAT

[0088] GACCTGGGCTACACACGTGCTACAATGG

[0089] ATGGTACAACGAGTTGCGAACTCGCGAGAGTAAGCTAATCTCTTAAAG

[0090] CCATTCTCAGTTCGGATTGTAGGCTGCAA

[0091] CTCGCCTACATGAAGTCGGAATCGCTAGTAATCGCGGATCAGCATGCC

[0092] GCGGTGAATACGTTCCCGGGCCTTGTACA

[0093] CACCGCCCGTCACACCATGAGAGTTTGTAACACCCAAAGTCGGTGGG

[0094] GTAACCTTTTAGGGAACCACCGCCTAAGTTGA

[0095] In summary, based on the colony morphology, physiological and biochemical characteristics, and molecular biological identification results of strain ZP-6, strain ZP-6 was identified as a novel Lactobacillus plantarum strain and named Lactobacillus plantarum ZP-6.

[0096] Example 3:

[0097] Lactobacillus plantarum ZP-6 alleviates enteritis and reduces biotoxicity caused by PS-NPs exposure.

[0098] 1. Preparation of fluorescent PS-NPs

[0099] Weigh 0.01 mg of Nile Red dye and add it to 1 mL of chloroform. Store in the dark for later use. Disperse 250 mg of PS-NPs in 49 mL of a mixture of ultrapure water and DMSO (v:v = 1:1). Add Nile Red dye to the PS-NPs solution at 75 °C and continue heating for 30 min. Immediately after heating, place the solution in an ice-water solution to cool. Filter the cooled solution through a 30 nm polycarbonate membrane. Transfer the PS-NPs on the membrane to pure water and store in the dark. Used for subsequent gavage and in vivo concentration determination in mice.

[0100] 2. Grouping and processing of experimental animals

[0101] Thirty-five Kunming mice were randomly divided into a healthy group and an enteritis group after one week of acclimatization. The healthy group included: a control group (Con group), a *Lactobacillus plantarum* ZP-6 group (LP group), a PS-NPs exposure group (NPs group), and a *Lactobacillus plantarum* ZP-6 and PS-NPs co-treatment group (NL group). The enteritis group included: a colitis model group (DSS group), a PS-NPs and colitis model group (DN group), and a *Lactobacillus plantarum* ZP-6 and PS-NPs and colitis model group (DNL group). Mice were administered PBS buffer via gavage daily. Mice in the colitis model group had free access to a solution containing 3% DSS. The experimental groups were administered the corresponding solutions via gavage for 28 days. During the gavage period, mouse weight was recorded on days 0, 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20, and feces were collected for PS-NPs excretion determination. After gavage, mice were euthanized by cervical dislocation, and serum, organ tissues, etc., were collected for subsequent analysis.

[0102] 3. Effects of PS-NPs on physical indicators in healthy mice and mice with enteritis

[0103] The collected mouse livers, kidneys, and spleens were weighed, and the organ coefficients of the mice were calculated using the following formula. The relative expression levels of inflammatory factors were determined using quantitative real-time PCR. The levels of PS-NPs in the mice were calculated by measuring the fluorescence values ​​of PS-NPs in mouse blood, feces, and organ tissues. The livers, kidneys, and spleens were fixed in 4 wt% paraformaldehyde, dehydrated using a gradient ethanol method, cleared with xylene, embedded in paraffin, stained with hematoxylin and eosin, and finally examined as histopathological sections.

[0104] Organ coefficient = organ weight / mouse body weight

[0105] Experimental results are as follows Figure 2 As shown, (ac) organ coefficients of liver, kidney, and spleen; (de) relative expression levels of inflammatory factors; (f) PS-NP content; and (g) histopathological sections of colon tissue from colitis mice. Increased epithelial damage, crypt disappearance, and enhanced inflammatory cell infiltration in mice induced by DSS indicated successful establishment of the colitis mouse model. PS-NP treatment significantly increased the liver and spleen coefficients of colitis mice compared to healthy mice (P < 0.05); compared to healthy mice, the accumulation of PS-NPs in the blood, liver, colon, jejunum, and ileum of colitis mice was also significantly increased (P < 0.05). Furthermore, the levels of inflammatory factors in colitis mice were significantly higher than in healthy mice after PS-NP treatment. These results indicate that PS-NPs have a more severe impact on colitis mice compared to healthy mice.

[0106] 4. Effects of Lactobacillus plantarum ZP-6 on the body weight changes of healthy mice and mice with enteritis in mitigating PS-NPs toxicity.

[0107] Experimental results are as follows Figure 3 As shown, there was no significant difference in body weight among the healthy mice, indicating that PS-NPs did not affect mouse body weight. The body weight of the mice in the enteritis group showed a trend of first decreasing and then increasing. There was no significant difference in body weight between the DSS group and the DN group, indicating that PS-NPs did not affect the decrease and recovery of mouse body weight.

[0108] 5. Lactobacillus plantarum ZP-6 alleviates changes in organ coefficients in healthy mice due to PS-NPs toxicity.

[0109] Experimental results are as follows Figure 4 As shown, the PS-NPs exposure experiment resulted in a significant decrease in the kidney coefficient of mice in the NPs group compared with the control group (P<0.05), while there were no significant differences in the organ coefficients of the liver and spleen among the four treatment groups (P>0.05). Treatment with *Lactobacillus plantarum* ZP-6 did not significantly improve the kidney coefficient in mice, indicating that *Lactobacillus plantarum* ZP-6 did not significantly alleviate the effects of PS-NPs at the organ level.

[0110] 6. Changes in organ coefficients in mice with PS-NPs toxic enteritis alleviated by Lactobacillus plantarum ZP-6

[0111] Experimental results are as follows Figure 5 As shown, after PS-NPs treatment, the coefficients of the liver, kidney, and spleen were significantly different from those of the control group, with the liver and spleen coefficients significantly increased (P<0.05) and the kidney coefficient significantly decreased (P<0.05). However, there was no significant difference in the coefficients of the three organs between the DSS group and the control group (P>0.05), indicating that PS-NPs caused organ lesions in colitis mice. Furthermore, there was no significant difference in organ coefficients between the *Lactobacillus plantarum* ZP-6 treatment group and the DN group (P>0.05), indicating that *Lactobacillus plantarum* ZP-6 did not alleviate the effect of PS-NPs on organ weight.

[0112] 7. Lactobacillus plantarum ZP-6 alleviates PS-NP toxicity; PS-NP levels in the blood and feces of healthy mice.

[0113] Blood and feces were collected from mice within 24 hours after the first gavage. Treatment with *Lactobacillus plantarum* ZP-6 was administered 4 hours after gavage with PS-NPs. The content of PS-NPs in blood and feces was determined by fluorescence values. The experimental results are as follows: Figure 6 As shown, after oral administration of PS-NPs to mice, the blood PS-NP levels initially increased and then decreased, reaching a peak at 4 hours. After oral administration of *Lactobacillus plantarum* ZP-6, PS-NP levels decreased over the period of 4-24 hours. Compared to the NPs group, oral administration of *Lactobacillus plantarum* ZP-6 resulted in a reduction in the final blood PS-NP levels. After ingestion, a portion of the PS-NPs in mice was absorbed into the bloodstream, while the remainder was excreted in the feces. The results are as follows... Figure 6 As shown in (b), without treatment with *Lactobacillus plantarum* ZP-6, the excretion of PS-NPs initially increased and then decreased. After treatment with *Lactobacillus plantarum* ZP-6, the overall trend of PS-NP excretion was the same as that of the NPs group, but the excretion of PS-NPs was higher at 8, 12, and 24 hours. This indicates that *Lactobacillus plantarum* ZP-6 promotes the excretion of PS-NPs in feces, thereby reducing the internalization of PS-NPs into the bloodstream and further reducing the accumulation of PS-NPs in mice.

[0114] 8. Lactobacillus plantarum ZP-6 alleviates PS-NPs toxic enteritis in mice; PS-NPs levels in blood.

[0115] Blood samples were collected from mice in the DN and DNL groups via orbital blood sampling on days 3, 5, 7, 9, 11, and 13 after the establishment of the colitis model. The experimental results are as follows: Figure 7As shown, the level of PS-NPs in the blood of DN group mice showed a trend of first increasing and then decreasing. From day 3 to day 9, the mice's body weight continuously decreased, indicating that the symptoms of colitis in the mice were aggravating. At this time, the colonic epithelial barrier was damaged, and PS-NPs entered the blood through the intestinal barrier. After day 10, the level of PS-NPs in the blood decreased. In the DNL group, the changes in the level of PS-NPs in the blood were basically the same as those in the DN group, indicating that during this period, Lactobacillus plantarum ZP-6 had no significant intervention effect on the accumulation of PS-NPs in the blood.

[0116] 9. Lactobacillus plantarum ZP-6 alleviates PS-NP toxicity: PS-NP content and distribution in organs and intestines of healthy mice.

[0117] PS-NPs content such as Figure 8 As shown in (a), the accumulation of PS-NPs in mice was significantly reduced after treatment with Lactobacillus plantarum ZP-6. Conversely, the fecal nanoplastic content increased significantly after treatment with Lactobacillus plantarum ZP-6, reflecting a trend that was not observed in mouse tissues.

[0118] To observe the distribution of PS-NPs in various mouse organs, frozen sections of the liver, kidney, spleen, colon, duodenum, jejunum, and ileum were examined using a fluorescence microscope. The results are as follows: Figure 8 As shown in (b), fluorescent PS-NPs were enriched in different organs and tissues after ingestion by mice. After treatment with Lactobacillus plantarum ZP-6, the enriched fluorescent PS-NPs in various organs and tissues were significantly reduced. As can be seen from the figure, except for the ileum tissue, there were almost no fluorescent PS-NPs in the other organs and tissues of the NL group mice, which indicates that Lactobacillus plantarum ZP-6 can reduce the accumulation of PS-NPs in various organs.

[0119] This indicates that treatment with Lactobacillus plantarum ZP-6 promotes the excretion of PS-NPs, reduces the accumulation of PS-NPs in organs, and thus alleviates the toxic effects of PS-NPs on mice.

[0120] 10. The content and distribution of PS-NPs in organs and intestines of mice with PS-NPs-induced enteritis alleviated by Lactobacillus plantarum ZP-6.

[0121] The content of PS-NPs in various organs of mice with enteritis is as follows: Figure 9 As shown in (a), blood, liver, and colon are the organs with the highest PS-NP content. After treatment with Lactobacillus plantarum ZP-6, the accumulation of PS-NPs in organ tissues was significantly reduced.

[0122] The distribution of PS-NPs in various organs of mice with enteritis is as follows: Figure 9As shown in (b), the distribution of PS-NPs in various organs of mice with enteritis was similar to that of healthy mice, with PS-NPs present in all organs. Unlike healthy mice, fluorescence was still visible in frozen sections of various organs of the DNL group mice, especially in the intestinal tissue, although the fluorescence of PS-NPs was relatively less compared to the DN group.

[0123] The above results indicate that Lactobacillus plantarum ZP-6 can promote the excretion of PS-NPs in feces and reduce the accumulation of PS-NPs in organs.

[0124] 11. Pathological sections of organs and intestines of healthy mice that alleviated PS-NPs toxicity using Lactobacillus plantarum ZP-6.

[0125] To gain a more intuitive understanding of the effects of PS-NPs on mouse organs, paraffin sections of mouse liver, kidney, spleen, and colon were stained using an H&E staining kit, and the sections were analyzed. The results are as follows: Figure 10 As shown in the pathological section of the liver (a), PS-NPs caused deep staining and swollen nuclei in the mouse hepatocytes, indicating that PS-NPs can cause mild liver damage. For the kidney (b), PS-NPs caused swelling of the proximal tubules and inflammatory cell infiltration, indicating that PS-NPs also damage the kidney. (c) shows that the spleen did not show obvious pathological changes. Figure (d) is a tissue section of the colon, and the results show that PS-NPs treatment caused significant lesions in the mouse colon tissue, including damaged intestinal villi, inflammatory cell infiltration, and intestinal structural disruption. In the NL group, the staining results of the liver, kidney, and colon tissue sections showed no pathological damage, similar to the tissue state of healthy mice. This indicates that gavage administration of *Lactobacillus plantarum* ZP-6 reduced the impact of PS-NPs on the organ state of mice, restoring the organs to normal levels.

[0126] 12. Effects of Lactobacillus plantarum ZP-6 on the expression of inflammatory factors in healthy mice that alleviate PS-NPs toxicity.

[0127] This invention selected four inflammatory cytokines—IL-1β, IL-6, IL-10, and TNF-α—and investigated the inflammatory response induced by PS-NPs in the liver and colon tissues of healthy mice by measuring their relative expression levels in the liver and colon. The results are as follows: Figure 11As shown in Figure (ad), PS-NPs significantly upregulated the relative expression levels of IL-1β, IL-6, IL-10, and TNF-α in the liver. Figure (eh) represents the relative expression levels of various inflammatory factors in the colon; similarly, the levels of inflammatory factors were significantly increased. This indicates that PS-NPs induce significant inflammatory responses in the liver and colon of mice, affecting their normal physiological functions. After treatment with *Lactobacillus plantarum* ZP-6, compared with the NPs group, except for no significant change in the expression level of TNF-α in the liver, the expression levels of other enteritis factors in the liver and colon were reduced to varying degrees. Therefore, based on the results of inflammatory factor expression, *Lactobacillus plantarum* ZP-6 can significantly reduce the levels of inflammatory factors in mice, alleviate the inflammatory response, and thus mitigate the adverse effects of PS-NPs.

[0128] 13. Effects of Lactobacillus plantarum ZP-6 on the expression of inflammatory factors in mice with PS-NPs toxic enteritis

[0129] PS-NPs reduced the expression levels of IL-1β and TNF-α inflammatory factor genes in the liver and colon of mice with enteritis, as shown in the following figures. Figure 12 As shown in Figures (a, c), the relative levels of IL-1β and TNF-α in the liver of mice in the DN group were significantly higher than those in the control group (P<0.01), and the expression levels of both inflammatory factors in the DN group were also significantly higher than those in the DSS group (P<0.01). This indicates that PS-NP exposure may lead to liver inflammation in colitis mice.

[0130] Similarly, PS-NPs treatment significantly increased the expression levels of IL-1β and TNF-α genes in the colon (b, d) compared to the control and DSS groups (P<0.01), indicating that PS-NPs also promoted further exacerbation of colitis. Under the influence of *Lactobacillus plantarum* ZP-6, the relative expression levels of both pro-inflammatory factors in the liver and colon significantly decreased (P<0.01), meaning that *Lactobacillus plantarum* ZP-6 could significantly alleviate the inflammatory response induced by PS-NPs in colitis mice.

[0131] In conclusion, foodborne Lactobacillus plantarum ZP-6 can reduce the accumulation of PS-NPs in tissues and organs, promote their excretion in feces, and alleviate inflammatory responses, significantly reducing the damage caused by PS-NPs in mice and providing a basis for repairing PS-NP-induced damage to the body.

[0132] The *Lactobacillus plantarum* ZP-6 provided by this invention can be used alone as a probiotic, or in combination with other probiotics such as *Lactobacillus acidophilus*, *Leuconostoc mesenteroides*, *Lactobacillus helveticus*, *Streptococcus thermophilus*, *Lactobacillus rhamnosus*, *Lactobacillus paracasei*, *Lactobacillus brevis*, *Bifidobacterium longum*, *Bifidobacterium infantis*, *Bacillus coagulans*, *Lactococcus*, *Lactobacillus curvaturei*, *Lactobacillus reuteri*, *Lactobacillus casei*, *Pediococcus pentosus*, *Lactobacillus bulgaricus*, *Lactobacillus gasseri*, and *Streptococcus thermophilus*, to maintain human or animal health, thus expanding the application field of probiotics and possessing extremely high application value.

[0133] The above embodiments describe the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are only illustrative of the principles of the present invention. Various changes and modifications can be made to the present invention without departing from the scope of the principles of the present invention, and all such changes and modifications fall within the protection scope of the present invention.

Claims

1. A plant-based Lactobacillus that alleviates enteritis and reduces the toxicity of polystyrene nanoplastics, characterized in that: Its classification name is Lactobacillus plantarum, and it is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.31420.

2. The *Lactobacillus plantarum* according to claim 1, characterized in that: The *Lactobacillus plantarum* was isolated and purified from infant feces; Its 16S rDNA sequence is shown in the sequence listing; It can grow on MRS solid medium, and the colonies are round, smooth and opaque, grayish-white, and tiny and dense. The optimal growth temperature is 37℃, and the culture time is 12 hours.

3. The application of *Lactobacillus plantarum* according to claim 1 or 2 in the preparation of biological agents to alleviate enteritis and PS-NPs toxicity, characterized in that: The plant lactobacillus can promote the excretion of PS-NPs in feces and reduce the accumulation of PS-NPs in organs; Reduce the toxicity of PS-NPs to various organs in mice; It significantly reduced the inflammatory response in mice.

4. The application according to claim 3, characterized in that: The plant lactobacillus can reduce the accumulation of PS-NPs in organs and alleviate histopathological damage; It inhibits inflammatory responses, relieves enteritis, repairs the intestinal barrier, and regulates liver metabolism.

5. The application according to claim 3 or 4, characterized in that: The nanoplastic is one or more of polystyrene, polyvinyl chloride, and polypropylene; The PS-NPs are obtained from food.

6. The application according to any one of claims 3-5, characterized in that: The effective dose of PS-NPs for Lactobacillus plantarum is 10 mg / kg body weight; The viable count of *Lactobacillus plantarum* used was 5 × 10⁻⁶. 9 CFU / mL.

7. A probiotic preparation, characterized in that: It contains live Lactobacillus plantarum as described in any one of claims 1-2 and / or its fermentation products.

8. The probiotic preparation according to claim 7, characterized in that: It also includes one or more of the following: Lactobacillus acidophilus, Leuconostoc mesenteroides, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus casei, Lactobacillus helveticus, Streptococcus thermophilus, Lactobacillus rhamnosus, Lactobacillus paracasei, Lactobacillus salivarius, Leuconostoc mesenteroides, Lactobacillus brevis, Bifidobacterium longum, Bifidobacterium infantis, Bifidobacterium brevis, Bifidobacterium bifidum, Bacillus coagulans, Lactococcus, Lactobacillus curvatureii, Lactobacillus reuteri, Lactobacillus casei, Pediococcus pentosus, Lactobacillus bulgaricus, Lactobacillus gasseri, or Streptococcus thermophilus.

9. The probiotic preparation according to claim 7 or 8, characterized in that: The preparation is in the form of granules, capsules, tablets, pills, or oral liquid.

10. The use of the probiotic preparation according to any one of claims 7-9 in the preparation of drugs or functional foods for relieving enteritis and PS-NPs toxicity.

Images