TaMCT gene for regulating wheat grains and application of TaMCT gene
By knocking out and overexpressing the wheat TaMCT gene using CRISPR/Cas9 technology, the MEP pathway in wheat grains was regulated, and carotenoid synthesis was enhanced, solving the problems of insufficient grain plumpness and size, and thus increasing wheat yield.
Patent Information
- Application Number
- CN202511527444.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-24
- Publication Date
- 2025-12-12
AI Technical Summary
Existing technologies are insufficient to effectively regulate the starch synthesis process in wheat grains, resulting in insufficient grain plumpness and size, which affects yield.
By knocking out the wheat TaMCT gene using CRISPR/Cas9 technology and overexpressing the TaMCT gene using a recombinant vector, the MEP pathway in wheat grains is regulated, carotenoid synthesis is enhanced, and grain growth is promoted.
It significantly increases wheat grain length and thousand-grain weight, thereby increasing wheat yield.
Smart Images
Figure CN121109440A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of plant molecular genetics, in particular to a TaMCT gene for regulating wheat grains and application thereof. BACKGROUND
[0002] Wheat is one of the most important food crops in the world, and its yield improvement is crucial for food security and nutrition supply. During the grain filling stage of wheat, carbon sources produced by photosynthetic organs are transported to grains through phloem, and then used to synthesize starch and other storage substances in endosperm cells. Therefore, the level of grain filling determines the plumpness and size of grains, thereby affecting the yield of wheat.
[0003] 2-C-methyl-D-erythritol-4-phosphate cytidylyltransferase, also known as methyl erythritol phosphate cytidylyltransferase (MCT), is a key enzyme in the MEP pathway, a key pathway for the biosynthesis of terpenoids, and is widely present in plants and most prokaryotes. The 2-methyl-D-erythritol-4-phosphate (MEP) pathway in plants can produce five-carbon isoprenoid precursors: isoprenyl pyrophosphate (IPP) and its isomer dimethylallyl pyrophosphate (DMAPP). Through continuous condensation reactions of IPP and DMAPP, ten-carbon GPP, fifteen-carbon FPP, and twenty-carbon GGPP can be produced. GGPP produced by the MEP pathway not only provides the main raw material for the synthesis of photosynthetic pigments (carotenoids and chlorophyll), but is also essential for the synthesis of plastoquinone and tocopherol, and is an important precursor for the synthesis of hormones such as gibberellins. Therefore, GGPP in plants plays an important role in distributing metabolic flow and regulating diterpene product synthesis.
[0004] Carotenoid biosynthesis is an important source of plant hormones abscisic acid (ABA), gibberellin, and strigolactone (SL), and has been reported to play a key role in regulating tillering and yield in plants. Overexpression of TaGL1-B1 in wheat promotes the accumulation of carotenoids, increases grain length, and promotes yield increase (Mohsin et al., 2023). DN, a carotenoid isomerase in rice, regulates tillering and yield through the carotenoid biosynthesis pathway (Ding et al., 2024). Therefore, it is of great significance to analyze the MEP pathway regulated by TaMCT to improve wheat yield. SUMMARY
[0005] The present application aims to provide a TaMCT gene for regulating wheat grains and application thereof, and to improve wheat yield.
[0006] The technical solution claimed in the present application is as follows: The application provides a wheat TaMCT gene for regulating wheat kernels, and the nucleotide sequence of the wheat TaMCT gene is shown in SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3.
[0007] In specific embodiments of the application, the genomic sequence accession number of the wheat TaMCT gene with the sequence shown in SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3 is TraesCS5A02G143000, TraesCS5B02G141800 and TraesCS5D02G149000, respectively; and the version of the genome is the Chinese Spring reference genome 1.1 version.
[0008] The application also provides the wheat TaMCT gene described above for use in regulating wheat kernels.
[0009] The application also provides a recombinant vector comprising the wheat TaMCT gene described above; and the recombinant vector is a plant overexpression vector.
[0010] The application also provides the recombinant vector described above for use in regulating wheat kernels.
[0011] Beneficial effects: The application provides a wheat TaMCT gene for regulating wheat kernels, and experiments prove that the wheat TaMCT gene can regulate wheat kernels and improve the yield of wheat, thereby proving that the wheat TaMCT gene plays an important role in regulating wheat kernels and provides new gene resources and breeding resources for wheat breeding.
[0012] Sequence listing SEQ ID NO:1 ATGGCGGCGGTCTGGATGGCGTTGGCGGTGATGCTGGTCGCTGCTGCTCAGGTGGCGGTGGCTGCCCCGGTGATGGCGCCGGCCTTCCTCTGGGCGCCCAAGAACTACGGACTTAGTCCCAATGAGGCTAAAGAAGTAGTCCACTATCAGACAATCTCCCCAAAGAGTTTAGCTGATTCTGTTCTCGAGGAAGGTGGCTGGTCAAACTTGGTGTGTTCAAAGGATGGTCCTCAAAAGAATGTTGATGTTGCAGTTCTTTTTCTTGGATCAAAGCTACAATCATCAGACATCTCTAAAGATAAACAGGTCGATCCTGCTTTAGCGGACATACTAAAGCTGTCCTTCTCAAGCTCCGAGTTTTCCATGGCATTCCCTTATGTTGCCATGTCAGACGACGAAGCACTAGAGAACTCATTGCTATCTGGATTTACTGAGAATTGTGAGGATGGTTCTGGAGGAAATCATATCACTTACACAGACACGTGTACTGCAAGCAGTGAAAGTGTGAAGAAACATCTGAACATGGATTCTGTTCAAGACTTGGTGAAGTCACGGATGGGAAACAACCAACCAACTGAGCTAATCGTCTTCTGTAGCGGTGGTTTCAAGGACAATGCAAAATCAGAAGGGCAGTTGCTTTTGGATCTGGTTTCTGTTCTTGACAAGTCTGGGGCTAAATACACAGTTCTTTACGCATCTCAACCCTATGGTTTGCTGGAGAATCCTTCGGACCTGCCATTAGCCAGGTATCTTGCAGAGAAGACCAATACAACTAAACCTGTCCTAGAGAAATGCGATGGAGAATGTCAATTAAAATCAACTCTCCTGGAAGGAGTTTTTGTGGGTGTGGTGCTGCTTATCATCTTGATATCAGGACTTTGCTGCATGATGGGGATCGATACCCCGTCAAGGTTTGAGGCTCCCCAGGATTAA SEQ ID NO: 2 ATGGCGGCGGTCTGGATGGCGTTGGCGGTGATGCTGGTCGCTGCTGCTCAGGTGGCGGTGGCTGCCCCGGTGACGGCGCCGGCCTTCCTCTGGGCTCCCAAGAACTACGGACTTAGTCCCAATGAGGCTAAAGAAGTAGTCCACTATCAGACAATCTCCCCAAAGAGTTTAGCTGATTCTGTTCTCGAGGAAGGTGGCTGGTCGAACTTGGTGTGTTCAAAGGATGGTCCTCAAAAGAATGTTGATGTTGCAGTTCTTTTTCTTGGATCAAAGCTACAATCATCAGACATCTCTAAAGATAAACAAGTCGATCCTGCTTTAGCGGACATACTAAAGCTGTCCTTCTCAAGCTCTGAGTTTTCCATGGCATTCCCTTATGTTGCCATGTCAGACGACGAAGCACTAGAGAACTCATTGCTATCTGGATTTACTGAGAATTGTGAGGATGGTTCTGGAGGAAATCATATCACTTACACAGACACGTGTACTGCAAGCAGTGAAAGTGTGAAGAAACATCTGAACATGGATTCTGTTCAAGACTTGGTGAAGTCACGGATGGGAAACAACCAACCAACTGAGCTAATCGTCTTCTGTAGCGGTGGTTTCAAGGACAGTACAAAATCAGAAGGGCAGTTGCTTTTGGATCTGGTTTCTGTTCTTGACAAGTCTGGGGCTAAATACACAGTTCTTTACGCTTCTCAACCCTATGGTTTGCTGGAGAATCCTTCGGACCTGCCATTAGCCAGGTATCTTGCAGAGAAGACCAACACAACTAAACCTGTCCTAGAGAAATGTGATGGAGAGTGCCAATTAAAATCAACTCTCCTGGAAGGAGTTTTTGTGGGTGTAGTGCTGCTTATCATCTTGATATCAGGACTTTGCTGCATGATGGGGATCGATACTCCATCAAGATTTGAGGCTCCCCAGGATTAA SEQ ID NO: 3 ATGGCGGCGGTCTGGATGGCGTTGGCGGTGATGCTGGTCGCTGCTGCTCAGGTGGCGGTGGCTGCCCCGGTGACGGCGCCGGCCTTCCTCTGGGCGCCCAAGAACTACGGACTCAGTCCCAATGAGGTTAAAGAAGTAGTCCACTATCAGACAATCTCCCCAAAGAGCTTAGCTGATTCTGTTCTTGAGGAAGGTGGCTGGTCAAACCTGGTGTGTTCAAAGGATGGTCCTCAAAAGAATGTCGATGTTGCAGTCCTTTTTCTTGGATCAAAGCTATCCTTCTCAAGCTCCGAGTTTTCCATGGCATTCCCTTATGTGGCCATGTCAGACGACGAAGCATTGGAGAACTCATTGCTATCTGGATTTACTGAGAATTGTGAGGATGGTTCTGGAGGAAATCATATCACGTACACAGACACGTGTACTGCAAGCAGTGAAAGTGTGAAGAAACATCTGAACATGGATTCTGTTCAAGACTTGGTGAAGTCACGGATGGGAAACAACCCAAGTGGACCAACTGAGCTAATTGTCTTCTGCAGCGGTGGTTTCAAGGATAATGCAAAAACAGAAGGACAGTTGCTTTTGGATCTGGTTTCTGTTCTTGACAAGTCTGGGGCAAAATACACAGTTCTTTACGCTTCTCAACCCTATGGTTTGCTGGAGAATCCTTCGGACCTGCCATTAGCCAGGTATCTTGCAGAGAAGACCAATACAACTAAACCTGTCCTAGAGAAATGCGATGGAGAGTGCCAATTAAAATCAACTCTCCTGGAAGGAGTTTTTGTGGGTGTAGTGCTGCTTATCATCTTGATATCAGGACTTTGCTGCATGATGGGGATCGATACTCCATCAAGGTTTGAGGCTCCCCAGGATTAA BRIEF DESCRIPTION OF DRAWINGS
[0013] Figure 1 TaMCT gene edited lines in embodiments of the application Tamct-1 , Tamct-2Edit site sequence changes; PAM sequences are marked in red, and black dashed lines indicate sequence deletions; Tamct-1 , Tamct-2 They are all knockout mutants obtained using CRISPR / Cas9 technology, only the knockout methods are different, resulting in different mutants.
[0014] Figure 2 In the embodiments of the present invention, Fielder, Tamct-1 , Tamct-2 Changes in plant phenotype and grain morphology. Detailed Implementation
[0015] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for explanation and illustration only and do not limit the scope of the present invention in any way.
[0016] First set of embodiments This set of embodiments provides the TaMCT gene that regulates wheat grains, and the nucleotide sequence of the wheat TaMCT gene is shown in SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3.
[0017] In a specific embodiment of the present invention, the accession numbers of the wheat TaMCT gene sequences shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3 are TraesCS5A02G143000, TraesCS5B02G141800, and TraesCS5D02G149000, respectively; the version of the genome is the Chinese Spring Reference Genome version 1.1.
[0018] Second set of embodiments, a recombinant vector This set of embodiments provides a recombinant vector, which includes the wheat TaMCT gene described in the first set of embodiments.
[0019] In a specific embodiment of the present invention, the recombinant vector is a plant overexpression vector.
[0020] Third set of embodiments, one application This set of examples provides the application of the wheat TaMCT gene described in the first set of examples or the recombinant vector described in the second set of examples in regulating wheat grains.
[0021] Experimental Example Experimental Example 1. Construction of CRISPR knockout mutant of wheat TaMCT gene Target sites were designed for conserved sites in the wheat TaMCT gene (nucleotide sequences shown in SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3). By designing these targets, TaMCT gene sites 5A, 5B, and 5D were knocked out. Figure 1 The designed target sequence is shown in SEQ ID NO:4, as follows: Target: GACTTGGTGAAGTCACGGATGGG (SEQ ID NO:4) The target site was ligated into a CRISPR knockout vector, and the embryos of wild-type wheat variety Fielder were infected using Agrobacterium-mediated wheat genetic transformation. The embryos were then obtained through tissue culture. Tamct-1 , Tamct-2 These two knockout mutant lines were used for subsequent experiments.
[0022] Experimental Example 2. Phenotypic Identification of CRISPR Knockout Mutants of the Wheat TaMCT Gene 1. Experimental Materials and Methods Wild-type Fielder and mutant Tamct-1 , Tamct-2 Planted in the transgenic experimental field of the Institute of Crop Science, Chinese Academy of Agricultural Sciences, with 15 plants per row and a row length of 2 meters, the wheat was harvested at maturity, and the grain length, grain width, and thousand-grain weight were measured. At least 8 replicates were performed each time.
[0023] 2. Experimental Results Compared to wild-type Fielder, such as Figure 2 As shown, the TaMCT gene-editing mutant Tamct-1 , Tamct-2 Plant growth was significantly inhibited, and the strains were edited. Tamct-1 , Tamct-2 The particle width was significantly affected. Tamct-2 The length of the grains also decreased significantly. Tamct-1 , Tamct-2 The thousand-grain weight was significantly reduced.
[0024] The embodiments described above are some, but not all, of the embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art through related deductions and substitutions based on the inventive concept, without inventive effort, are within the scope of protection of the present invention.
Claims
1. The TaMCT gene that regulates wheat grains, characterized in that, The nucleotide sequence of the wheat TaMCT gene is shown in SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:
3.
2. The TaMCT gene regulating wheat grains as described in claim 1, characterized in that, The genome accession numbers for the wheat TaMCT gene sequences shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3 are TraesCS5A02G143000, TraesCS5B02G141800, and TraesCS5D02G149000, respectively.
3. The TaMCT gene regulating wheat grains as described in claim 2, characterized in that, The genome version is the Chinese Spring Reference Genome version 1.
1.
4. A recombinant vector, characterized in that, Includes the wheat TaMCT gene as described in any one of claims 1-3.
5. The recombinant vector according to claim 5, characterized in that, The recombinant vector is a plant overexpression vector.
6. The application of the wheat TaMCT gene according to any one of claims 1-3 or the recombinant vector according to any one of claims 4-5 in regulating wheat grains.