Method for simultaneously extracting and detecting nucleic acid of listeria monocytogenes and salmonella and application

Abstract

The invention belongs to the technical field of food safety detection, and relates to a method for simultaneously extracting and detecting nucleic acid of listeria monocytogenes and salmonella. The method comprises the following steps: cracking listeria monocytogenes and salmonella by using a bacterial lysis solution and releasing nucleic acid of listeria monocytogenes and salmonella; the nucleic acid of the listeria monocytogenes and the nucleic acid of the salmonella are extracted at the same time through the synthesized magnetic beads Fe3O4 and Al < 3 + >, and the nucleic acid of the listeria monocytogenes and the nucleic acid of the salmonella are detected at the same time through double RPA / RT-RPA and RPA-LFA test paper. The method has the characteristics of rapidness, high sensitivity and low equipment requirement, and has practical application value in on-site instant detection of food safety.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of food safety detection, and particularly relates to a method for simultaneously extracting and detecting nucleic acid of Listeria monocytogenes and Salmonella and application thereof. BACKGROUND

[0002] Listeria monocytogenes (hereinafter referred to as Listeria monocytogenes) belongs to the genus Listeria and is a kind of gram-positive facultative anaerobic bacillus with important public health significance. As a typical zoonotic pathogenic bacterium, the bacterium can cause listeriosis through the food chain. The clinical manifestations are sepsis, meningitis and monocytosis, especially in newborns, the elderly and immunosuppressed populations, and the case fatality rate can reach 20%-30%. From the analysis of microbial physiological characteristics, Listeria monocytogenes has significant environmental adaptability and can grow at a temperature range of 0-45°C, especially it can still slowly proliferate under refrigeration conditions at 4°C, which makes it a major safety hazard for refrigerated ready-to-eat foods (such as chilled meat, dairy products, salad products). The current national standard (GB 4789.30) has listed it as a mandatory pathogenic bacterium, and a comprehensive detection method combining selective enrichment culture and molecular biology identification is required to ensure the microbial safety control of cold chain foods.

[0003] Salmonella, as an important member of Enterobacteriaceae, contains two species (Salmonella enterica and Salmonella bongori) and more than 2600 serotypes, and is the primary pathogenic bacterium causing foodborne diseases worldwide. The bacterium has a wide host adaptability and mainly colonizes in the intestinal microecosystem of humans and warm-blooded animals (such as poultry, livestock, and rodents), and can contaminate water sources, feed and food processing raw materials through feces, forming a "animal-food-human" transmission chain. The clinical manifestations after infection are mainly acute gastroenteritis, including abdominal pain, diarrhea, vomiting and fever, and some high-risk groups can develop bacteremia or extraintestinal infection. Due to the high frequency and high risk of the bacterium in public health events, its monitoring data has become one of the core indicators for evaluating the national foodborne disease burden and the effectiveness of food safety management.

[0004] In summary, Listeria monocytogenes and Salmonella, as two representative foodborne pathogenic bacteria, pose different challenges in risk prevention and control due to their special physiological characteristics and wide host adaptability. The current method for Listeria monocytogenes and Salmonella is the traditional culture method, which includes pre-enrichment, selective medium separation, physiological and biochemical identification, etc. The whole process generally takes 5-7 days, so the traditional culture method is time-consuming and labor-intensive. Simple and easy PCR-based molecular biology methods, such as real-time fluorescent PCR and multiplex PCR, are widely accepted due to their high specificity. However, such methods rely on temperature-changing equipment, which is not conducive to on-site real-time detection.

[0005] Recombinase polymerase amplification (RPA) is a new nucleic acid isothermal amplification technology, which has been widely used in the field of molecular diagnosis. Compared with traditional PCR method, RPA can be carried out at constant temperature throughout the process. The experiment is usually carried out at 37-42℃, and can be completed in 20-30 min, without PCR instrument and other thermal cycler, which is more suitable for rapid diagnosis in the field or on site. Therefore, based on RPA technology, combined with the pretreatment method of rapid and simple nucleic acid extraction, it is expected to detect Listeria monocytogenes and Salmonella simultaneously on site. SUMMARY

[0006] The application discloses a method for simultaneously extracting and detecting nucleic acid of Listeria monocytogenes and Salmonella, which comprises the following steps: using a bacterial lysis solution to lyse Listeria monocytogenes and Salmonella and release nucleic acid of Listeria monocytogenes and nucleic acid of Salmonella, and using synthesized magnetic beads Fe3O4@Al 3+ The nucleic acid of Listeria monocytogenes and the nucleic acid of Salmonella are simultaneously extracted, and the double RPA / RT-RPA and RPA-LFA test paper are combined to simultaneously detect the nucleic acid of Listeria monocytogenes and the nucleic acid of Salmonella.

[0007] Further, the bacterial lysis solution is prepared from guanidine hydrochloride, deoxycholic acid sodium and Tris-HCl.

[0008] Further, the magnetic beads Fe3O4@Al 3+ are obtained by using Al 3+ modified Fe3O4 magnetic beads.

[0009] Further, the primers and probes of the RPA / RT-RPA test paper comprise primers and probes of Listeria monocytogenes LM-5358 and primers and probes of Salmonella S-3120, wherein: The primers and probes of Listeria monocytogenes LM-5358 are as follows: The upstream primer is TAGTGCAACTTATGGAAGAAGAAAGCTCTCC; The downstream primer is TTTGTAATAAAGAGCTCAAAACAGCTTCTGA; The probe is CCGGTGTTTGATGTCGAATTTAATGGAAA / iTAMdT / A / idSp / / iBHQ2dT / GAAGCTTGGCAAACG-C3spacer. The primers and probes of Salmonella S-3120 are as follows: The upstream primer is TTCGGCGATGCAGCAGGCGCTGATAGCGAA; The downstream primer is TGTAGGTTCCGTGCCTTTTATTCAGATCCG; Probe: TATGCCGGATTCTCCACGCTGGACTCCG / iROXdT / G / idSp / T / iBHQ1dT / CGCGCCCGGAAAGTG-C3 spacer.

[0010] Further, the primers and probes of the RPA-LFA test paper include the primers and probes of Listeria monocytogenes LM-5358 and the primers and probes of Salmonella S-3120, wherein: The primers and probes of Listeria monocytogenes LM-5358 are as follows: Upstream primer: ATGGTTGGATGAGTGCGACGGAATGCCTTC; Downstream primer: TGGTTCATCTAGTACAAGGAGTTCTGGTCG; Probe: Digoxigenin-AGTACGTATTCAGGTGGAATGCGACAACGAC-THF-CGGGATTGCTCAAGC-C3 spacer; The primers and probes of Salmonella S-3120 are as follows: Upstream primer: ACCTTCGGCGATGCAGCAGGCGCTGATAGC; Downstream primer: TTCCCGAAGTCGTGTGTAGGTTCCGTGCC; Probe: FAM-ATCTGGCTGGCGCAACAATATGGCATTGAC-THF-CTATCGGCGTTAACG-C3 spacer.

[0011] The method for simultaneously extracting and detecting nucleic acids of Listeria monocytogenes and Salmonella is applied to the simultaneous detection of Listeria monocytogenes and Salmonella kit.

[0012] The method for simultaneously extracting and detecting nucleic acids of Listeria monocytogenes and Salmonella is applied to food safety and environmental protection.

[0013] Further, the dual RPA-LFA test paper is applied to artificially contaminated cheese, milk and beef samples.

[0014] The present application has the following beneficial effects: (1) The present application adopts a rapid lysis solution and Fe3O4@Al 3+ magnetic beads to extract nucleic acids, which can extract nucleic acids of Listeria monocytogenes and Salmonella within 30 min, and the concentration and purity are equivalent to those of the heat lysis method and the commercially available kit extraction method.

[0015] (2) This invention utilizes a rapid nucleic acid extraction method combined with dual RPA detection to rapidly and simultaneously detect Listeria monocytogenes and Salmonella. The entire process does not require the use of complex instruments, making it more suitable for on-site, real-time testing.

[0016] (3) The method constructed in this invention does not require bacterial culture and complex physiological and biochemical steps used in traditional detection methods, and the detection time is shortened by at least 2 days compared with traditional detection methods. All detection steps can be completed within 1 hour, and the detection limit can reach 5×10⁻⁶. 1 CFU / mL pure culture bacteria and 5×10 2 CFU / g of artificially contaminated food samples. Attached Figure Description

[0017] Figure 1 The construction and optimization of rapid bacterial lysis buffer were carried out. Figures A to C show the optimization of the dosage of each component in the lysis buffer: Figure A represents guanidine hydrochloride, Figure B represents sodium deoxycholate, and Figure C represents the dosage of Tris-HCl. Figures D to E show the optimal dosage of components analyzed by response surface methodology. Figures F to H show the optimization of lysis buffer treatment conditions: Figure F represents time, Figure G represents temperature, and Figure H represents volume. Figure 2 To utilize Fe3O4@Al 3+ Construction and optimization of magnetic beads for nucleic acid extraction; where: Figure A shows Fe3O4@Al 3+ The synthesis process of the particles and the principle of nucleic acid adsorption; Figures B to E show Fe3O4@Al 3+ Particle characterization: Figure B shows the appearance image, Figure C shows the SEM image, Figure D shows the XPS spectrum, and Figure E shows the hysteresis regression line; Figures F to H are used to evaluate Fe3O4@Al 3+ DNA extraction capacity of the particles: F figure represents dosage, G figure represents adsorption time, and H figure represents elution time; Figure 3 The construction and optimization of dual RPA / RT-RPA are shown in Figure A, where: M represents the label; band 1: Salmonella target (242 bp); band 3: Listeria monocytogenes target (192 bp); band 5: dual targets of Salmonella and Listeria monocytogenes; bands 2, 4, and 6 represent blank controls; Figure B shows the results of SYBR Green I binding to dual RPA; Figure C shows the fluorescence amplification curves of Salmonella and Listeria monocytogenes in dual RT-RPA; Figures D to F show the primer ratios for Listeria monocytogenes and Salmonella in the dual RT-RPA system: Figure D shows a primer ratio of 1.5:1.0; Figure E shows a primer ratio of 1.0:1.0; and Figure F shows a primer ratio of 1.0:1.5; Figures G to H show the optimization of probe dosage: Figure G shows the Salmonella probe; Figure H shows the Listeria monocytogenes probe. Figure 4 The construction, sensitivity, and specificity tests of the dual RPA-LFA were performed. Figure A shows the construction of the dual RPA-LFA; Figure B shows the specificity of the dual RPA-LFA detection; and Figure C shows the sensitivity of the dual RPA-LFA detection in pure cultures of Salmonella and Listeria monocytogenes. Figure 5 This paper presents the application of the dual RPA-LFA method in artificially contaminated cheese, milk, and beef samples. Figure A shows a schematic diagram of the dual RPA-LFA assay. Figures B to C demonstrate the sensitivity of the dual RPA-LFA assay for Salmonella and Listeria monocytogenes in artificially contaminated cheese, milk, and beef samples. Detailed Implementation

[0018] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings. These embodiments are implemented based on the technical solutions of the present invention, providing detailed implementation methods and specific operating procedures. However, the scope of protection of the present invention is not limited to the following embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0019] As a specific embodiment of the present invention, the following contents are included: 1. Construction and optimization of lysis buffer The lysis buffer constructed in this study mainly consisted of three components: guanidine salt (guanidine hydrochloride), surfactant (sodium deoxycholate), and buffer (Tris-HCl). The lysis effects of different concentrations of these three components on Listeria monocytogenes and Salmonella were investigated (evaluated by DNA content). The guanidine hydrochloride concentration ranged from 0.1 to 3.0 M. Figure 1 As shown in Figure A, the concentration of sodium deoxycholate is 0.05-0.30%, as... Figure 1 As shown in Figure B, the concentration of Tris-HCl is 0-9.0 M. Figure 1 As shown in Figure C. The optimal concentration range was selected for response surface methodology (RSM). A three-factor, three-level RSM design was used. The optimal component ratio was determined based on the experimental results and validated using this concentration ratio, as shown in Figure C. Figure 1 Figures D to E are shown in the diagram. The optimal lysis buffer formulation was determined, and the treatment conditions were optimized, including lysis time (5-30 min), lysis temperature (4-37℃), and lysis buffer volume (100-500 μL), as follows: Figure 1 Figures F through H are shown in the table. DNA concentration and quality were determined using a Nanodrop 2000.

[0020] Experimental results, such as Figure 1The results show that the optimal bacterial lysis buffer formulation is: 0.27 M guanidine hydrochloride, 0.15% sodium deoxycholate, and 6.50 mM Tris-HCl. The optimal treatment conditions include: adding 300 μL of lysis buffer and incubating at 37 °C for 15 min.

[0021] 2. Fe3O4@Al 3+ Optimization of magnetic bead synthesis and nucleic acid adsorption capacity Fe3O4 particles were added to a mixed solution consisting of 36 mL (0.84 M) NaOH solution, 20 mL of 1,4-dioxane, and 4 mL of epichlorohydrin (EPI). To ensure complete dissolution of the Fe3O4 particles in the homogeneous mixture, the mixture was ultrasonically dispersed for 5 min and then placed in a shaker at 25 °C and 180 rpm for 4 h. After magnetic separation, the product was washed with deionized water to obtain epoxidized Fe3O4 particles. These particles were then added to a mixture consisting of 40 mL iminodiacetic acid (IDA) and 40 mL Na2CO3-NaHCO3 buffer solution (0.1 M, pH 9.70), and the mixture was shaken at 30 °C and 200 rpm for 24 h. The IDA-modified Fe3O4 particles were collected by washing with deionized water and magnetic separation. IDA-modified Fe3O4 particles were dispersed in 40 mL of Al(NO3)3 (1 M) solution and incubated at 30 °C and 180 rpm for 12 h to form Fe3O4@Al 3+ The particles were washed with deionized water and then dispersed in Tris-HCl (10 mM, pH 8.0) buffer to obtain Fe3O4@Al particles with a final concentration of 20 mg / mL. 3+ Particles, such as Figure 2 Figure A shows the results. Fe3O4@Al was analyzed using scanning electron microscopy (SEM), X-ray photoelectron spectroscopy (XPS), and a vibrating sample magnetometer (VSM). 3+ The morphology, surface chemistry, and saturation magnetization of the particles were measured.

[0022] Fe3O4@Al 3+ The adsorption efficiency of particles for nucleic acids from Listeria monocytogenes and Salmonella was investigated. This included Fe3O4@Al 3+ The dosage (10-50 μL), adsorption time (1-15 min), and elution time (1-20 min) of Fe3O4@Al were determined based on the final nucleic acid concentration. 3+ Adsorption effect.

[0023] Experimental results, such as Figure 2 As shown. Fe3O4@Al 3+ The principles of nucleic acid synthesis and adsorption-elution, such as... Figure 2As shown in Figure A. Fe3O4 (black) and Fe3O4@Al 3+ The (dark brown) color indicates that the Fe3O4 surface has been modified, resulting in a color change. Figure 2 As shown in Figure B, the SEM morphology results show that the particles are spherical, uniform in size, and approximately 20-30 nm in size. Figure 2 The figure in Figure C is shown. XPS results prove that Al... 3+ Effectively modified on Fe3O4, such as Figure 2 The results are shown in Figure D. Saturation magnetization of Fe3O4@Al. 3+ It has a high magnetic strength, reaching approximately 72 emu / g, such as Figure 2 As shown in Figure E. Fe3O4@Al 3+ The optimal adsorption treatment is to add 40 μL of magnetic beads, adsorb for 3 min, and then elute for 10 min. Figure 2 The F-plot to H-plot are shown in the diagram.

[0024] 3. Primer and probe design Based on the previously screened Salmonella and Listeria monocytogenes specific target sequences: SEEPA511_RS03120 and AX10_RS05385, primers and probes, including RPA / RT-RPA and RPA-LFA, were designed. The primer and probe sequences used are listed in Table 1.

[0025] 4. Construction and optimization of dual RPA / RT-RPA and RPA-LFA Dual RPA reactions were constructed based on the designed primers and probes. RPA reaction reagents were provided by AMP Future Biotechnology Co., Ltd. The reaction system was referenced and slightly adjusted. For the 50 μL reaction system: Add 29.5 μL of AD buffer to each tube of RPA lyophilized powder, followed by 1 μL (10 μM) of each forward and reverse primer. Add 4 μL of nucleic acid template and 10 μL of ddH2O to the reaction tube, and finally add 2.5 μL of B buffer to the cap and mix thoroughly. After mixing, briefly and quickly centrifuge the reaction solution to the bottom and immediately place it in a 37°C incubator for 30 min. For the dual RT-PRP: Add 0.3 μL (10 μM) of each probe to the reaction system and reduce the amount of ddH2O. After thorough mixing, place the reaction solution in a Fast 7500 system to capture the fluorescence signal at 37°C for 60 cycles of 30 s each. Based on this, the primer ratios (2:1, 1:1, and 1:2) and probe usage (0.1–0.9 μL) were optimized. Following the dual RT-RPA reaction system, RPA amplification was performed using the corresponding colloidal gold kit, and the amplification results were detected using dual-line test strips.

[0026] Experimental results, such asFigure 3 and Figure 4 As shown. Based on the optimization results, the dual RPA system consisted of 29.5 μL AD buffer, 1 μL each of forward and reverse primers (10 μM), 4 μL nucleic acid template, and 10 μL ddH2O. Finally, 2.5 μL B buffer was added to the reaction tube cap. In the gel electrophoresis results, Salmonella was positive as a 242 bp band, and Listeria monocytogenes was positive as a 192 bp band. Figure 3 As shown in Figures A and B.

[0027] In dual RT-RPA, Salmonella positivity is indicated by a green amplification line, while Listeria monocytogenes positivity is indicated by a red amplification line. Figure 3 As shown in Figure C; the optimal primer ratio is 1:1; the optimal probe addition amount is 0.6 μL, as... Figure 3 The results are shown in the D to H diagrams. Therefore, the dual RT-RPA system is prepared by increasing the probe volume by 0.6 μL (10 μM) and decreasing the amount of ddH2O.

[0028] The double RPA-LFA system uses the same amount of reagents as RT-RPA, but the primer and probe sequences are different. In double RPA-LFA, the blue line represents the C line (Control), the red T1 line indicates Salmonella positivity, and the red T2 line indicates Listeria monocytogenes positivity. Figure 4 As shown in Figure A.

[0029] 5. Method specificity verification All bacterial strains used in this study are shown in Table 2. Thirteen strains (3 Salmonella strains, 3 Listeria monocytogenes strains, and 7 non-target bacteria strains) were selected for method specificity evaluation. The strains were streaked in TSA solid medium and incubated at 37°C for 24 h for activation. They were then transferred to TSB liquid medium and cultured overnight at 180 rpm and 37°C. The bacterial concentration was adjusted to 10-1. 7 CFU / mL, take 1 mL of bacterial culture, centrifuge at 10000 rpm for 5 min, and wash the bacterial precipitate with sterile water. Utilize lysis buffer to bind Fe3O4@Al 3+ Bacterial DNA was extracted using magnetic beads to verify the specificity of RPA-LFA. Sterile water was used as a negative control instead of the genomic template.

[0030] The experimental results showed positive results for Salmonella and Listeria monocytogenes, while the remaining 7 non-target bacteria did not show red bands, indicating that RPA-LFA has good specificity. Figure 4 As shown in Figure B.

[0031] 6. Evaluation of method sensitivity Listeria monocytogenes CICC21633 and Streptococcus enterica CMCC50041 were selected and cultured, and adjusted to ~5×10⁻⁵. 7 CFU / mL. Serially dilute the culture 10-fold to 5 CFU / mL. Similarly, use bacterial lysis buffer combined with Fe3O4@Al. 3+ Bacterial nucleic acids were extracted using magnetic beads at various dilution levels. Subsequently, the genomic template at each concentration was subjected to RPA-LFA dual detection to validate its sensitivity. Sterile water was used as a negative control instead of the genomic template.

[0032] Experimental results: The sensitivity of the dual RPA-LFA method at pure DNA concentration is 5 × 10⁻⁶. 1 CFU / mL, with good sensitivity, such as Figure 4 As shown in Figure C.

[0033] 7. Application of Dual RPA-LFA in Actual Food Samples Cheese, milk, and fresh beef samples were purchased from Nanjing Suguo Supermarket and confirmed to be free of Listeria monocytogenes and Salmonella using standard culture methods (Handbook of Bacteriological Analysis). 5g of each sample was weighed and inoculated to a final concentration of 5 × 10⁻⁶. 5 -10 0 CFU / g Listeria monocytogenes and Salmonella. Add 45 mL of buffered peptone water (BPW), homogenize thoroughly, and briefly centrifuge to remove fat. Take 1 mL of homogenate, centrifuge, and wash with PBS. Combine Fe3O4@Al with lysis buffer. 3+ Genomic templates were extracted using magnetic beads and subjected to dual RPA-LFA detection. The specific detection procedure is as follows: Figure 5 As shown in Figure A. Based on the detection results, as... Figure 5 As shown in Figures B to D, the dual RPA-LFA can detect 5×10⁻⁶ ions in cheese slices, milk, and fresh beef samples. 2 Listeria monocytogenes and Salmonella were detected at CFU / g. The entire detection process was completed within one hour, demonstrating short detection time and high sensitivity. Therefore, this method holds promise for rapid on-site detection of food samples.

[0034] Although the present invention has been disclosed above under optimal processing conditions, it is merely an exemplary embodiment used to illustrate the principles of the invention and is not intended to limit the invention. Those skilled in the art can make various improvements and modifications without departing from the essence of the invention, and these improvements and modifications also fall within the protection scope of the present invention.

[0035] Table 1. Primers and probes for dual RPA / RT-RPA and RPA-LFA

[0036] Table 2. Strain information and dual RPA specificity

[0037] The preferred embodiments of the present application have been described above with reference to the accompanying drawings, but this does not limit the scope of the claims of the present application. Any modifications, equivalent substitutions, and improvements made by those skilled in the art without departing from the scope and substance of the embodiments of the present application shall be within the scope of the claims of the present application.

Claims

1. A method for simultaneous extraction and detection of Listeria monocytogenes and Salmonella nucleic acids, characterized in that: The present application discloses a method for simultaneously detecting Listeria monocytogenes and Salmonella by using RPA-LFA test paper 3+ The present application discloses a method for simultaneously detecting Listeria monocytogenes and Salmonella by using RPA-LFA test paper The RPA / RT-RPA test paper includes primers and probes of Listeria monocytogenes LM-5358 and primers and probes of Salmonella S-3120. Primers and probes of Listeria monocytogenes LM-5358: Upstream primer: TAGTGCAACTTATGGAAGAAGAAAGCTCTCC; Downstream primer: TTTGTAATAAAGAGCTCAAAACAGCTTCTGA; Probe: CCGGTGTTTGATGTCGAATTTAATGGAAA / iTAMdT / A / idSp / / iBHQ2dT / GAAGCTTGGCAAACG-C3spacer; Primers and probes of Salmonella S-3120: Upstream primer: TTCGGCGATGCAGCAGGCGCTGATAGCGAA; Downstream primer: TGTAGGTTCCGTGCCTTTTATTCAGATCCG; Probe: TATGCCGGATTCTCCACGCTGGACTCCG / iROXdT / G / idSp / T / iBHQ1dT / CGCGCCCGGAAAGTG-C3spacer; The primers and probes of the RPA-LFA test paper include the primers and probes of Listeria monocytogenes LM-5358 and the primers and probes of Salmonella S-3120, wherein: Primers and probes of Listeria monocytogenes LM-5358: Upstream primer: ATGGTTGGATGAGTGCGACGGAATGCCTTC; Downstream primer: TGGTTCATCTAGTACAAGGAGTTCTGGTCG; Probe: Digoxigenin-AGTACGTATTCAGGTGGAATGCGACAACGAC-THF-CGGGATTGCTCAAGC-C3spacer; Primers and probes of Salmonella S-3120: Upstream primer: ACCTTCGGCGATGCAGCAGGCGCTGATAGC; Downstream primer: TTCCCGAAGTCGTGTGTAGGTTCCGTGCC; Probe: FAM-ATCTGGCTGGCGCAACAATATGGCATTGAC-THF-CTATCGGCGTTAACG-C3spacer.

2. The method for simultaneous extraction and detection of Listeria monocytogenes and Salmonella nucleic acids according to claim 1, characterized in that: The bacterial lysis solution is prepared from guanidine hydrochloride, deoxycholate sodium and Tris-HCl.

3. The method for simultaneous extraction and detection of Listeria monocytogenes and Salmonella nucleic acids according to claim 1, characterized in that: The magnetic beads Fe3O4@Al 3+ are obtained using Al 3+ modified Fe3O4 magnetic beads.

4. A method for simultaneous extraction and detection of Listeria monocytogenes and Salmonella nucleic acids for use in a kit for simultaneous detection of Listeria monocytogenes and Salmonella, characterized in that: The present application discloses a method for simultaneously detecting Listeria monocytogenes and Salmonella by using RPA-LFA test paper. 3+ The present application discloses a method for simultaneously detecting Listeria monocytogenes and Salmonella by using RPA-LFA test paper. The RPA / RT-RPA test paper includes primers and probes of Listeria monocytogenes LM-5358 and primers and probes of Salmonella S-3120. Primers and probes of Listeria monocytogenes LM-5358: Upstream primer: TAGTGCAACTTATGGAAGAAGAAAGCTCTCC; Downstream primer: TTTGTAATAAAGAGCTCAAAACAGCTTCTGA; Probe: CCGGTGTTTGATGTCGAATTTAATGGAAA / iTAMdT / A / idSp / / iBHQ2dT / GAAGCTTGGCAAACG-C3spacer; Primers and probes of Salmonella S-3120: Upstream primer: TTCGGCGATGCAGCAGGCGCTGATAGCGAA; Downstream primer: TGTAGGTTCCGTGCCTTTTATTCAGATCCG; Probe: TATGCCGGATTCTCCACGCTGGACTCCG / iROXdT / G / idSp / T / iBHQ1dT / CGCGCCCGGAAAGTG-C3spacer; Downstream primer: TGTAGGTTCCGTGCCTTTTATTCAGATCCG; Probe: TATGCCGGATTCTCCACGCTGGACTCCG / iROXdT / G / idSp / T / iBHQ1dT / CGCGCCCGGAAAGTG-C3spacer; The primers and probes of the RPA-LFA test paper comprise the primers and probes of Listeria monocytogenes LM-5358 and the primers and probes of Salmonella S-3120, wherein: The primers and probes of Listeria monocytogenes LM-5358: Upstream primer: ATGGTTGGATGAGTGCGACGGAATGCCTTC; Downstream primer: TGGTTCATCTAGTACAAGGAGTTCTGGTCG; Probe: Digoxigenin-AGTACGTATTCAGGTGGAATGCGACAACGAC-THF-CGGGATTGCTCAAGC-C3spacer; The primers and probes of Salmonella S-3120: Upstream primer: ACCTTCGGCGATGCAGCAGGCGCTGATAGC; Downstream primer: TTCCCGAAGTCGTGTGTAGGTTCCGTGCC; Probe: FAM-ATCTGGCTGGCGCAACAATATGGCATTGAC-THF-CTATCGGCGTTAACG-C3spacer.

5. Use of a method for simultaneous extraction and detection of Listeria monocytogenes and Salmonella nucleic acids in food safety and environmental protection, characterized in that: The present application discloses a method for simultaneously detecting Listeria monocytogenes and Salmonella by using RPA-LFA test paper. 3+ The present application discloses a method for simultaneously detecting Listeria monocytogenes and Salmonella by using RPA-LFA test paper. The RPA / RT-RPA test paper includes primers and probes of Listeria monocytogenes LM-5358 and primers and probes of Salmonella S-3120. The primers and probes of Listeria monocytogenes LM-5358: Upstream primer: TAGTGCAACTTATGGAAGAAGAAAGCTCTCC; Downstream primer: TTTGTAATAAAGAGCTCAAAACAGCTTCTGA; Probe: CCGGTGTTTGATGTCGAATTTAATGGAAA / iTAMdT / A / idSp / / iBHQ2dT / GAAGCTTGGCAAACG-C3spacer. The primers and probes of Salmonella S-3120: Upstream primer: TTCGGCGATGCAGCAGGCGCTGATAGCGAA; Downstream primer: TGTAGGTTCCGTGCCTTTTATTCAGATCCG; Probe: TATGCCGGATTCTCCACGCTGGACTCCG / iROXdT / G / idSp / T / iBHQ1dT / CGCGCCCGGAAAGTG-C3spacer; The primers and probes of the RPA-LFA test paper comprise the primers and probes of Listeria monocytogenes LM-5358 and the primers and probes of Salmonella S-3120, wherein: The primers and probes of Listeria monocytogenes LM-5358: Upstream primer: ATGGTTGGATGAGTGCGACGGAATGCCTTC; Downstream primer: TGGTTCATCTAGTACAAGGAGTTCTGGTCG; Probe: Digoxigenin-AGTACGTATTCAGGTGGAATGCGACAACGAC-THF-CGGGATTGCTCAAGC-C3spacer; Primers and probes for Salmonella S-3120: Upstream primer: ACCTTCGGCGATGCAGCAGGCGCTGATAGC; Downstream primer: TTCCCGAAGTCGTGTGTAGGTTCCGTGCC; Probe: FAM-ATCTGGCTGGCGCAACAATATGGCATTGAC-THF-CTATCGGCGTTAACG-C3spacer.

6. Use according to claim 5, characterized in that: Application of the double RPA-LFA test paper in artificially contaminated cheese, milk and beef samples.

Images