Method for screening candidate genes and SNP (Single Nucleotide Polymorphism) sites related to residual feed intake of Sahu hybrid sheep

Abstract

The invention provides a method for screening candidate genes and SNP (Single Nucleotide Polymorphism) loci related to residual feed intake of Sahu hybrid sheep, which is characterized by comprising the following steps: S1, collecting jugular vein blood samples of the Sahu hybrid sheep, and extracting genomic DNA (Deoxyribose Nucleic Acid) of the blood samples for quality detection; the method comprises the following steps: S1, extracting DNA, S2, carrying out whole genome re-sequencing on the extracted DNA and carrying out genotyping to obtain SNP genotype data, and S3, carrying out reference genome comparison, SNP detection and genotype quality control. And S4, carrying out whole genome association analysis on the residual feed intake character of the Sahu hybrid sheep to obtain a significant SNP site. The nucleotide sequence of the SNP site obviously related to the residual feed intake of the Sahu hybrid sheep, which is obtained by the method provided by the invention, is as shown in SEQ ID NO.1, the basic group R at the 51st site of the sequence is A or G, the gene mutation causes the nucleotide of the sequence to generate polymorphism, and when the marker is mutated into G, the Sahu hybrid sheep shows lower residual feed intake.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of sheep molecular markers, and particularly relates to a method for screening a candidate gene and a SNP site group related to residual feed intake of Sahiwal crossbred sheep. BACKGROUND

[0002] Sheep are important economic animals in livestock production, and mutton is one of the most important meats in the world. In sheep farming, feed efficiency (FE) is a key economic trait that has a significant impact on farming efficiency and sustainable development (Ferreira J, Chay-Canul AJ, De Barbieri I, et al. Compilations and updates on residual feed intake in sheep[J]. Tropical animal health and production, 2024, 56(5):172.). Feed efficiency refers to the rate at which livestock and poultry can convert feed to meet their production performance requirements for growth, reproduction, milk production, egg production, and the maintenance of normal physiological functions. It is one of the important economic traits of livestock and poultry. The main indicators for evaluating the feed efficiency of livestock and poultry are feed conversion ratio (FCR) and residual feed intake (RFI). RFI refers to the difference between actual feed intake and the expected feed intake required for production (Koch RM, Swier LA, Chambers D, et al. Efficiency of feed use in beef cattle[J]. Journal of Animal Science, 1963, 22(2):486-494.). In sheep production, feed costs are on the rise and account for 65% to 70% of the total production cost. RFI is determined by the genetic background of livestock, and studies have shown that RFI is an independent trait independent of phenotypes such as feed intake and average daily weight gain, with medium to high heritability, and its variation can be inherited (Zhang X, Wang W, Mo F, et al. Association of residual feed intake with growth and slaughtering performance, blood metabolism, and body composition in growing lambs[J]. Scientific reports, 2017, 7(1):12681.). Therefore, using RFI for selection can reduce feed intake without reducing weight gain, thereby improving the economic benefits of the population.

[0003] The Suffolk-Huzhou hybrid sheep is a new type of sheep breed developed through crossbreeding male Suffolk sheep with female Huzhou sheep. It exhibits significant hybrid vigor and is one of the important new breeds in the current meat sheep industry. The Suffolk-Huzhou hybrid sheep possess many excellent traits, such as rapid growth, high reproductive performance, good meat quality, tender meat, suitability for producing fattened lambs, and strong adaptability. Therefore, it is suitable for large-scale farming and offers significant economic benefits.

[0004] Genome-wide association analysis (GWIA) involves searching for variant sites—single nucleotide polymorphisms (SNPs)—across the entire genome and then screening for SNPs associated with target phenotypic traits. With the development of next-generation sequencing technology, GWIA has become a routine method for unlocking genotype-phenotype associations in crop and animal breeding research (Liu HJ, Yan J. Crop genome wide association study: a harvest of biological relevance. Plant J. 2019 Jan; 97(1):8 18.).

[0005] While existing research confirms the heritability of RFI (radical fibrillation), it has failed to systematically elucidate its genetic basis in the specific high-quality population of Suffolk-Hu sheep. Conventional genome-wide association studies (GWAS) primarily focus on purebred sheep (such as Hu sheep or Suffolk sheep), while Suffolk-Hu sheep exhibit significant population stratification issues due to their high heterozygosity and complex genome structure. This invention, through the development of a dedicated GWAS workflow for hybrid sheep, successfully identified for the first time in Suffolk-Hu sheep seven core candidate RFI genes and twelve functional SNP loci, providing direct targets for molecular breeding and enabling precise breeding that "does not reduce weight gain and reduces feed consumption." Summary of the Invention

[0006] The purpose of this invention is to provide a method for screening candidate genes and SNP loci related to the remaining feed intake of Sahu hybrid sheep. The method involves genotyping the blood DNA of 214 Sahu hybrid sheep through whole-genome resequencing, and further using genome-wide association analysis to screen SNPs that are significantly associated with the remaining feed intake trait of Sahu hybrid sheep, thus providing new molecular markers for the selection of the remaining feed intake trait in Sahu hybrid sheep.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] A method for screening candidate genes and SNP sites related to residual feed intake in Sahu crossbred sheep includes the following steps:

[0009] S1. Collect jugular vein blood samples from Sahu hybrid sheep and extract genomic DNA from the blood samples for quality testing;

[0010] S2. Perform whole-genome resequencing on the extracted DNA to perform genotyping and obtain SNP loci.

[0011] S3, Reference genome comparison, SNP detection, genotype quality control;

[0012] S4. Genome-wide association analysis of the residual feed intake trait in S4-Sahu hybrid sheep revealed significantly associated SNP loci.

[0013] As described above, preferably, the quality detection is performed using an ultraviolet spectrophotometer, requiring the absorbance ratio of the DNA sample at 260 nm to 280 nm to be between 1.7 and 2.1; otherwise, the DNA sample should be taken again.

[0014] As described above, preferably, whole-genome resequencing for genotyping involves using Plink 1.9 software to convert the raw sequencing data into VCF format, followed by quality control of the VCF format file using VCFtools 0.1.16 software, with the following conditions: minimum allele frequency ≥ 0.05; deletion rate ≤ 0.8; retention of 2 allele loci; minimum allowed sequencing depth of 4 and maximum allowed sequencing depth of 1000; genotype quality value > 10; base quality value > 30.

[0015] The method described above, preferably, involves genome-wide association analysis of the residual feed intake trait in Sahu crossbred sheep by calculating average daily gain (ADG) and mid-metabolous weight (MBW) based on phenotypic data, and then calculating residual feed intake (RFI) using ADG and MBW. The formula used is: RFI j =FI j -(β0+β1MBW j +β2ADG j ); where FI j Let βj be the actual dry matter intake of the j-th animal, β0 be the regression intercept, and β1 be the mean square root weight (MBW). j The regression coefficient, β2 is ADG j The regression coefficient, RFI j For the RFI of the j-th sheep; MBW j Let MBW be the intermediate metabolic weight of the j-th animal, calculated as MBW = [0.5 × (FBW)]. j -IBW j )]0.75 calculation, FBW j IBW represents the final body weight of the j-th animal at the end of the experiment. j The initial experimental weight of the j-th animal; ADG j The average daily weight gain of animal j was calculated as ADG = (final body weight - initial body weight) / number of days of measurement; and the remaining feed intake trait was used for subsequent genome-wide association analysis.

[0016] As described above, preferably, the genome-wide association analysis employs a mixed linear model, utilizing the FarmCPU model from the rMVP package in R language for genome-wide association analysis.

[0017] As described above, preferably, the FarmCPU model is Y = Pα + Zμ + ε

[0018] Where Y represents the individual's phenotypic value, P is the significant SNP matrix, α represents the fixed effect including principal components, Z represents the individual kinship matrix, and μ represents the distribution N(0, σ²). μ 2 The random effect of K) is used, and ε is the error term. Based on this model, genome-wide association analysis was performed on high-quality SNP loci and RFI traits. According to the results of the genome-wide association analysis, the Bonferroni method was used to adjust the significance level. The total number of SNPs obtained by dividing 1 by S2 was used as the threshold for determining significant association. Manhattan plots and quantile quantile plots were drawn using the CMplot package of R language. For SNP loci above the threshold, the T-test method was used to test the residual feed intake trait of different genotypes of Sahu crossbred sheep populations, so as to obtain the genotypes with significant differences.

[0019] In the method described above, preferably, the gene containing the significantly associated SNP site is the GPR63 gene. The significantly associated SNP site is the 51st bp position of the sequence shown in SEQ ID NO.1, where R represents A or G. When the genotype of Sahu crossbred sheep is GG, the remaining feed intake is significantly lower than that of AA type individuals.

[0020] As described above, preferably, the phenotypic data collection involves selecting 56-day-old weaned lambs with clear pedigrees and no disease, raising them in individual pens with free access to feed, and measuring the daily weight gain and daily feed intake of the Sahu crossbred sheep starting at 100 days of age to calculate the remaining feed intake; the measurement ends at 180 days of age, and jugular vein blood is collected.

[0021] The beneficial effects of this invention are as follows:

[0022] The present invention provides a method for screening candidate genes and SNP sites related to the remaining feed intake of Sahu crossbred sheep. Genome-wide association analysis is used to screen for SNP molecular markers significantly associated with the remaining feed intake of Sahu crossbred sheep. The nucleotide sequence of this molecular marker is shown in SEQ ID NO.1, where R at position 51 represents A or G. Because there is an A / G mutation at position 51 of the above sequence, an A / G mutation occurs in the crossbred sheep GPR63 gene at this site.

[0023] This molecular marker can be used for assisted selection and prediction of the residual feed intake trait in Sahu crossbred sheep. When the polymorphism at position 51 is G, Sahu crossbred sheep exhibit lower residual feed intake. This provides technical support for early selection of complex RFI traits and rapid homozygosity of trait alleles, accelerating the progress of genetic selection. By screening individuals with low residual feed intake, feed efficiency in sheep populations can be significantly improved, energy waste reduced, feeding costs effectively lowered, and economic benefits increased. The dominant allele loci in the bred strain are in a high-frequency or homozygous state, which can largely avoid the problem of trait segregation in offspring during the application of new strains to breeding line innovation. Attached Figure Description

[0024] Figure 1 This is a flowchart illustrating the method of screening candidate genomes related to the remaining feed intake of Sahu crossbred sheep according to the present invention.

[0025] Figure 2 This is a Manhattan plot for genome-wide association analysis. The plot shows the residual feed intake trait in Sahu crossbred sheep. SNPs with strong correlation signals above the threshold were selected for further analysis; the identified SNP markers are located on sheep chromosome 8.

[0026] Figure 3 This is a quantile plot for genome-wide association analysis, which studies the residual feed intake trait in Sahu crossbred sheep.

[0027] Figure 4 A violin diagram showing the analysis of different genotypes and remaining feed intake traits at the SNP loci screened in this invention in 214 Sahu crossbred sheep. Detailed Implementation

[0028] This invention provides a method for screening candidate genes and SNP loci related to the remaining feed intake of Sahu crossbred sheep, as illustrated in the flowchart below. Figure 1 As shown, it includes the following steps:

[0029] S1. Collect jugular vein blood samples from Sahu hybrid sheep and extract genomic DNA from the blood samples for quality testing;

[0030] S2. Perform whole-genome resequencing on the extracted DNA to perform genotyping and obtain SNP locus data.

[0031] S3, Reference genome comparison, SNP detection, genotype quality control;

[0032] S4. Genome-wide association analysis of the residual feed intake trait in S-hu hybrid sheep revealed significant SNP loci.

[0033] This invention utilizes a provided method to collect blood samples from 214 Sahu hybrid sheep from Minqin Defu Agricultural Co., Ltd., extract DNA, and perform quality testing. The 214 DNA samples meeting quality standards were sent to Beijing Novogene Co., Ltd. for genome resequencing. Simultaneously, the phenotypic data of these 214 Sahu hybrid sheep, namely daily weight gain and daily feed intake, were systematically measured. By combining SNP locus data with their phenotypic data, and using the rMVP package in R language and the FarmCPU model, major genes and functional mutation sites (SNPs) associated with the remaining feed intake trait in Sahu hybrid sheep were screened. This provides new molecular markers for the auxiliary selection and predictive improvement of remaining feed intake in Sahu hybrid sheep, and is of great significance for the auxiliary screening of Sahu hybrid sheep.

[0034] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.

[0035] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in the embodiments are analytical grade or higher. The data used in this invention are selected from 56-day-old weaned Sahu crossbred lambs with clear pedigrees and no disease from Minqin Defu Agricultural Co., Ltd., which are raised in single pens and have free access to feed. The daily weight gain and daily feed intake of the Sahu crossbred lambs are measured starting at 100 days of age to calculate the remaining feed intake. The measurement ends at 180 days of age, and jugular vein blood samples are collected.

[0036] Example 1

[0037] The target trait for genome selection is RFI (Reactive Factor Injection), and whole-genome SNP genotyping is performed using resequencing, which includes the following steps:

[0038] (1) Blood samples were collected from the jugular veins of 214 Sahu crossbred sheep at 180 days of age from Minqin Defu Agricultural Co., Ltd. DNA was extracted and quality tested. DNA extraction was performed using a blood DNA extraction kit. The purity, integrity, and concentration of the obtained DNA were determined using a ThermoNanodrop 2000 UV spectrophotometer. The quality standards were: the absorbance ratio at 260 nm to 280 nm should be between 1.7 and 2.1, and the DNA concentration of the sample must exceed 50 ng / μL. Otherwise, DNA extraction should be repeated. The 214 DNA samples meeting the quality standards were sent to Beijing Novogene Co., Ltd. for genome resequencing to obtain the original data.

[0039] (2) The raw data were converted to VCF format using Plink 1.9 software, and then the VCF format files were quality controlled using VCFtools 0.1.16 software. The quality control conditions were: minimum allele frequency ≥ 0.05; deletion rate ≤ 0.8; retention of 2 allele loci; minimum allowed sequencing depth of 4 and maximum allowed sequencing depth of 1000; genotype quality value > 10; base quality value > 30. After quality control, 16,184,815 high-quality SNP loci were retained for the genome-wide association analysis study in Example 2.

[0040] Example 2: Genome-wide association analysis of SNP molecular markers with residual feed intake traits

[0041] The experiment used the same blood samples taken from 214 Sahu sheep individuals in Example 1 to measure their initial and final body weight and feed intake during the 100-180 stage. The average daily weight gain and mid-term metabolic weight were calculated to determine the remaining feed intake. The specific formula is as follows:

[0042] Average daily weight gain (ADG, kg / d) = (final weight - initial weight) / number of days measured.

[0043] Mid-cycle metabolic body weight (MBW) = [0.5 × (FBW)] j -IBW j )] 0.75 FBW j IBW represents the final body weight of the j-th animal at the end of the experiment. j Let be the initial experimental weight of the j-th animal.

[0044] Remaining feed intake: RFI j =FI j -(β0+β1MBW j +β2ADG j ), among which, FI j Let βj be the actual dry matter intake of the j-th animal, β0 be the regression intercept, and β1 be the mean square root weight (MBW). j The regression coefficient, β2 is ADG j The regression coefficient, RFI j Let RFI be the RFI of the j-th sheep.

[0045] The remaining feed intake trait will be used in subsequent genome-wide association studies.

[0046] Genome-wide association analysis (GWIA) employed a mixed linear model, utilizing the FarmCPU model from the rMVP package in R. The specific model is as follows:

[0047] Y = Pα + Zμ + ε

[0048] Where Y represents the individual's phenotypic value, P is the significant SNP matrix, α represents the fixed effect including principal components, Z represents the individual kinship matrix, and μ represents the distribution N(0, σ²). μ 2 The random effects of K) are represented by ε, which is the error term. Based on this model, genome-wide association analysis was performed on high-quality SNP sites and RFI traits.

[0049] Based on the results of the genome-wide association analysis, the significance level was adjusted using the Bonferroni method, and 1 was divided by the total number of SNPs (i.e., 1 / 949864) to obtain 10.528e. -6 As a threshold for determining significant association, a Manhattan plot was drawn using the CMplot package in R (the result is shown below). Figure 2 ) and Quantile quantile plot (results as follows) Figure 3 Genome annotation was performed on SNP sites above the threshold line to screen for SNP sites located in the GPR63 gene. The sequence of this site is shown in SEQ ID NO.1, where R at position 51 indicates A or G.

[0050] SEQ ID NO.1:TCAGGAAAATTCCACATTCTGTGTGGCTATACAAA TTAAAAAATAGATAARTGTTGCTTGGTTTAGTGTTGGGCTAAGATTCTGATACATTCTTTTTTAAA

[0051] The T-test was used to examine the residual feed intake trait in different genotypes of Sahu crossbred sheep populations. The results are as follows: Figure 4 As shown, 0 / 0 represents genotype AA, 0 / 1 represents genotype AG, and 1 / 1 represents genotype GG. A highly significant difference (P<0.01) was found between AA and GG individuals. The residual feed intake of the AG genotype was lower than that of the AA genotype, but the difference was not significant. The residual feed intake of the GG genotype was significantly lower than that of the AG genotype (P<0.05), and the residual feed intake of the AG genotype was between that of the AA and GG genotypes. For individuals with genotype GG, their residual feed intake was significantly lower than that of AA individuals. Therefore, when this marker mutation is G, Sahu crossbred sheep have lower residual feed intake, which is beneficial to improving the feed efficiency of Sahu crossbred sheep. This significantly associated SNP locus can be used for assisted breeding to screen for Sahu crossbred sheep with low residual feed intake and to breed feed-saving meat sheep.

Claims

1. A method for screening candidate genes and SNP loci related to residual feed intake in Sahu crossbred sheep, characterized in that, It includes the following steps: S1. Collect jugular vein blood samples from Sahu hybrid sheep and extract genomic DNA from the blood samples for quality testing; S2. Perform whole-genome resequencing on the extracted DNA to perform genotyping and obtain SNP locus data. S3, Reference genome comparison, SNP detection, genotype quality control; S4. Genome-wide association analysis of the residual feed intake trait in S4-Sahu hybrid sheep revealed significantly associated SNP loci.

2. The method as described in claim 1, characterized in that, The quality inspection is performed using a UV spectrophotometer, requiring the absorbance ratio of the DNA sample at 260nm to 280nm to be between 1.7 and 2.1; otherwise, the DNA sample should be taken again.

3. The method as described in claim 1, characterized in that, For whole-genome resequencing and genotyping, Plink 1.9 software was used to convert the raw sequencing data into VCF format. Subsequently, VCFtools 0.1.16 software was used to perform quality control on the VCF format files under the following conditions: minimum allele frequency ≥ 0.05; deletion rate ≤ 0.8; retention of 2 allele loci; minimum allowed sequencing depth of 4 and maximum allowed sequencing depth of 1000; genotype quality value > 10; base quality value > 30.

4. The method as described in claim 1, characterized in that, Genome-wide association analysis of the residual feed intake trait in Sahu crossbred sheep involved calculating average daily gain (ADG) and mid-metabolous weight (MBW) based on phenotypic data, and then calculating residual feed intake (RFI) using ADG and MBW. The formula used was: RFI j =FI j -(β0+β1MBW j +β2ADG j ); where FI j Let βj be the actual dry matter intake of the j-th animal, β0 be the regression intercept, and β1 be the mean square root weight (MBW). j The regression coefficient, β2 is ADG j The regression coefficient, RFI j For the RFI of the j-th sheep; MBW j Let MBW be the intermediate metabolic weight of the j-th animal, calculated as MBW = [0.5 × (FBW)]. j -IBW j )]0.75 calculation, FBW j IBW represents the final body weight of the j-th animal at the end of the experiment. j The initial experimental weight of the j-th animal; ADG j The average daily weight gain of animal j was calculated as ADG = (final body weight - initial body weight) / number of days of measurement; and the remaining feed intake trait was used for subsequent genome-wide association analysis.

5. The method as described in claim 1, characterized in that, Genome-wide association analysis was performed using a mixed linear model, specifically the FarmCPU model from the rMVP package in R.

6. The method as described in claim 5, characterized in that, The FarmCPU model is Y = Pα + Zμ + ε. Where Y represents the individual's phenotypic value, P is the significant SNP matrix, α represents the fixed effect including principal components, Z represents the individual kinship matrix, and μ represents the distribution N(0, σ²). μ 2 The random effect of K) is used, and ε is the error term. Based on this model, genome-wide association analysis was performed on high-quality SNP loci and RFI traits. The Bonferroni method was used to adjust the significance level according to the results of the genome-wide association analysis. The total number of SNPs obtained by dividing 1 by S2 was used as the threshold for determining significant association. Manhattan plots and quantile quantile plots were drawn using the CMplot package of R language. For SNP loci above the threshold, the T-test method was used to test the residual feed intake trait of different genotypes of Sahu crossbred sheep populations with significant association loci. Significantly associated SNP loci and their genotypes were obtained if there were significant differences.

7. The method as described in claim 6, characterized in that, The gene containing the significantly associated SNP site is the GPR63 gene. The significantly associated SNP site is the 51st bp of the sequence shown in SEQ ID NO.1, where R represents A or G. When individuals of Sahu crossbred sheep with the genotype GG have a significantly lower residual feed intake than individuals with the AA genotype.

8. The method as described in claim 4, characterized in that, Phenotypic data were collected by selecting healthy, disease-free 56-day-old weaned lambs with clear pedigrees, who were housed in individual pens with free access to feed. Starting at 100 days of age, the daily weight gain and daily feed intake of the Sahu crossbred lambs were measured to calculate the remaining feed intake. The measurement was completed at 180 days of age, and jugular vein blood samples were collected.

Images