GhRALF4L and GhRALF30L gene clusters and application thereof in creating high-temperature male sterile line of cotton

Abstract

The invention discloses GhRALF4L and GhRALF30L gene clusters and an application of the GhRALF4L and GhRALF30L gene clusters in creating a high-temperature male sterile line of cotton. The invention provides two RALF gene clusters GhRALF4L and GhRALF30L related to the high-sensitivity male sterility character of cotton, the two RALF gene clusters comprise 28 related genes in total, and the coding sequences of the genes are respectively shown as SEQ ID NO.1-28. The two gene clusters regulate the high-temperature fertility of drugs and pollen of upland cotton through a dose effect, and a gene editing mutant with higher editing efficiency is more sensitive to high-temperature stress, i.e., the more serious function loss of GhRALF4L and GhRALF30L causes the more serious high-temperature male sterility. According to the gene editing mutant created on the basis of the discovery, the sterility character has the definite high-temperature induction characteristic, that is, the mutant is normal in fertility under the normal-temperature condition and shows abortion only under the high-temperature condition.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to the GhRALF4L and GhRALF30L gene clusters and their application in creating high-temperature male-sterile cotton lines. Background Technology

[0002] Cotton is a globally important economic crop and natural fiber crop, occupying an indispensable position in the national economy. Its products are widely used in textiles, edible oils, animal feed, and pharmaceuticals. With population growth and upgrading consumption demands, improving cotton yield and quality has become a core requirement for industrial development, and variety improvement is a key pathway to achieving this goal. Hybrid breeding, as the mainstream method for cotton variety improvement, can effectively combine the superior traits of parents and improve the comprehensive agronomic traits of hybrid offspring. However, current technology still faces bottlenecks such as complex seed production processes and high costs. Among these, the level of creation of male-sterile lines directly restricts the efficiency of hybrid breeding.

[0003] Thermosensitive male sterile lines (TGMS) refer to male sterile materials whose fertility is regulated by changes in environmental temperature. They exhibit sterility at high or low temperatures but regain fertility at suitable temperatures. This type of material was first applied to the two-line hybridization breeding of rice and has gradually been extended to other crops. Its core characteristic is that propagation and seed production can be completed without a maintainer line, greatly simplifying the hybridization breeding system. The advantages of TGMS are mainly reflected in three aspects: first, it can regain fertility under suitable temperature conditions, achieving self-propagation and preservation, thereby reducing seed production costs; second, it exhibits stable sterility at specific temperatures and can be directly used as a female parent in hybridization without artificial emasculation, improving seed production efficiency; third, it provides excellent research materials for elucidating the temperature sensing and reproductive development mechanisms of crops, and also provides genetic resources for heat-resistant breeding. However, TGMS also has significant drawbacks. First, its fertility conversion is regulated by multiple genes, with a complex genetic mechanism, poor stability under different environments, and susceptibility to field climate fluctuations, leading to a decrease in hybridization purity. Secondly, the temperature critical point for fertility conversion is difficult to control precisely due to environmental and regional differences, potentially leading to sterility or incomplete recovery, thus affecting seed production efficiency. Finally, the known temperature-sensitive sterility genes are limited, the molecular mechanisms are not yet clear, and there is a lack of core targets for precise fertility regulation, restricting the application of molecular design breeding. Overall, TGMS technology has significant advantages in simplifying processes, reducing costs, and improving efficiency, but its application is still constrained by insufficient research on stability and mechanisms. With the deepening of key gene analysis and molecular regulation research, TGMS is expected to achieve stable application in more crops and become an important approach to addressing climate change and promoting crop improvement.

[0004] Rapid Alkalinization Factor (RALF), a class of small peptides with a molecular weight of approximately 5 kDa, has been studied for its function in plants since its first discovery in tobacco in 2001. Current research indicates that RALF is widely present in various plants, including rice, maize, rapeseed, and cotton. Tandem replication events play a crucial role in the amplification of the RALF gene family in Arabidopsis, rice, and cotton. Furthermore, RALF peptides participate in key signaling pathways such as double fertilization, abiotic stress response, and biotic stress response, demonstrating their importance in plant growth, development, and stress adaptation. However, current techniques for elucidating the function of the RALF gene family in upland cotton are significantly insufficient. Although a large number of genes encoding RALF peptides exist in upland cotton, the specific functions of the vast majority remain unclear, especially regarding their role in the response of cotton anthers and pollen to temperature signals, which is almost entirely unknown. This has prevented the potential of RALF peptides in both stress and reproduction from being translated into effective techniques for creating high-temperature male-sterile cotton lines, resulting in the underutilization of this promising genetic resource.

[0005] In summary, current techniques for creating high-temperature male-sterile cotton lines face dual bottlenecks: poor material stability and unclear key regulatory genes. Furthermore, the lagging research on the function of the RALF gene family in upland cotton also limits the discovery of new regulatory targets. Therefore, it is urgent to overcome the limitations of existing technologies, systematically identify key genes regulating high-temperature male sterility in cotton (such as functional genes in the RALF family), and elucidate their mechanisms of action. This is of significant practical importance for the precise creation and efficient application of high-temperature male-sterile cotton lines. Summary of the Invention

[0006] In view of this, the purpose of this invention is to provide the GhRALF4L and GhRALF30L gene clusters and their application in creating high-temperature male-sterile cotton lines. The cotton plants obtained by editing the GhRALF4L and GhRALF30L gene clusters are sensitive to temperature changes and exhibit a dose-response effect, showing the typical characteristics of being fertile at room temperature and sterile at high temperature.

[0007] To achieve the above objectives, the present invention provides the following technical solution:

[0008] In a first aspect, the present invention provides the GhRALF4L and / or GhRALF30L gene clusters, wherein,

[0009] The GhRALF4L gene cluster includes at least one of the genes GhRALF4LA1, GhRALF4LA2, GhRALF4LA3, GhRALF4LD1 and GhRALF4LD2, and their gene sequences are shown in SEQ ID NO.1 to 5, respectively.

[0010] The GhRALF30L gene cluster includes at least one of the following genes: GhRALF30LA2, GhRALF30LA3, GhRALF30LA4, GhRALF30LA5, GhRALF30LA6, GhRALF30LA7, GhRALF30LD1, GhRALF30LD2, GhRALF30LD3, GhRALF30LD4, GhRALF30LD5, GhRALF30LD6, GhRALF30LD7, GhRALF30LD8, GhRALF30LD9, GhRALF30LD10, GhRALF30LD11, GhRALF30LD12, GhRALF30LS1, GhRALF30LS2, GhRALF30LS3, and GhRALF30LS4, and their gene sequences are shown in SEQ ID NO. 6–28, respectively.

[0011] Secondly, this invention provides the application of the GhRALF4L and GhRALF30L gene clusters in the creation of high-temperature male-sterile cotton lines.

[0012] In the above applications, by inhibiting or silencing the expression of at least one gene in the GhRALF4L and GhRALF30L gene clusters, the anthers of cotton plants do not dehisce under high temperature conditions, the pollen loses its activity, and sterility occurs.

[0013] In some implementations, the high temperature is above 36°C.

[0014] Thirdly, the present invention provides an sgRNA comprising:

[0015] The nucleotide sequences of sgRNA1 and sgRNA2 targeting the GhRALF4L gene cluster are shown in SEQ ID NO.29 and SEQ ID NO.30, respectively.

[0016] and / or

[0017] The nucleotide sequences of sgRNA3 and sgRNA4, which target the GhRALF30L gene cluster, are shown in SEQ ID NO.31 and SEQ ID NO.32, respectively.

[0018] Fourthly, the present invention provides a recombinant CRISPR / Cas9 system vector for knocking out at least one gene in the GhRALF4L and GhRALF30L gene clusters, wherein the recombinant CRISPR / Cas9 system vector comprises the nucleotide sequence of the sgRNA described in the third aspect.

[0019] Fifthly, the present invention provides a method for creating a high-temperature male-sterile cotton line, comprising reducing or inhibiting the expression of at least one gene in the aforementioned GhRALF4L and GhRALF30L gene clusters in cotton plant cells.

[0020] In the embodiments of the present invention, the method of reducing or inhibiting the expression of at least one gene in the GhRALF4L and GhRALF30L gene clusters in cotton plant cells is not limited, as long as the purpose can be achieved.

[0021] In some implementations, the methods for reducing or suppressing gene expression include at least one of gene knockout (CRISPR), RNA interference (RNAi), antisense oligonucleotides (ASO), and gene silencing (VIGS).

[0022] In some implementations, the method includes the following steps:

[0023] Construct the recombinant CRISPR / Cas9 system vector described in the fourth aspect;

[0024] The recombinant CRISPR / Cas9 system vector was transformed into the target cotton plants via transgenic methods to obtain cotton high-temperature male sterile lines with genetic markers.

[0025] In some preferred embodiments, the transgenic method is Agrobacterium-mediated.

[0026] Sixthly, the application of the GhRALF4L and GhRALF30L gene clusters described in the first aspect, and / or the recombinant CRISPR / Cas9 system vector described in the fourth aspect, and / or the method described in the fifth aspect, in cotton hybridization breeding.

[0027] Compared with the prior art, the technical solution of the present invention has at least the following beneficial effects:

[0028] This invention provides two RALF gene clusters, GhRALF4L and GhRALF30L, associated with the thermosensitive male sterility trait in cotton. These two gene clusters regulate the high-temperature fertility of anthers and pollen in upland cotton through a dose-effect relationship. Mutants with higher editing efficiency are more sensitive to high-temperature stress; that is, the more severe the loss of function of the GhRALF4L and GhRALF30L gene clusters, the more severe the high-temperature male sterility. The cotton high-temperature male sterility mutant plant created based on the GhRALF4L and GhRALF30L gene clusters exhibits abnormal anther development, inability to dehisce normally, and significant loss of pollen viability, leading to male sterility. Furthermore, the sterility trait of this mutant plant has a clear high-temperature induction characteristic; that is, the mutant is fertile under normal temperature conditions, only exhibiting sterility abortion under high-temperature conditions. It possesses the typical characteristics of being fertile at normal temperature and sterile at high temperature, providing important material and technical support for cotton hybridization breeding. Attached Figure Description

[0029] Figure 1 Phylogenetic analysis of the upland cotton GhRALF4L and GhRALF30L gene clusters and the RALF gene family in Arabidopsis thaliana provided in the embodiments of the present invention; wherein, the blue background shows that the upland cotton GhRALF4L gene cluster contains 5 genes and the GhRALF30L gene cluster contains 23 genes.

[0030] Figure 2 This invention provides an analysis of the high-temperature induced expression of the GhRALF4L and GhRALF30L gene clusters provided in this embodiment. A–D represent the expression levels of the GhRALF4L gene cluster at TS, TDS, ADS, and Pollen, respectively; E–H represent the expression levels of the GhRALF30L gene cluster at TS, TDS, ADS, and Pollen, respectively. 84021 is a heat-resistant cotton variety, and H05 is a heat-sensitive cotton variety. TS represents the tetrad stage; TDS represents the tapetum degradation stage; ADS represents the anther dehiscence stage; and Pollen represents the pollen grain.

[0031] Figure 3 The gene editing results of the GhRALF4L gene cluster provided in the embodiments of the present invention are shown in Figures A through C, which represent the sequence editing status of individual plants Ghralf4l-1, Ghralf4l-2, and Ghralf4l-3, respectively. The sgRNA target site and PAM region are shown in blue and orange fonts, respectively.

[0032] Figure 4The gene editing results of the GhRALF30L gene cluster provided in the embodiments of the present invention are shown in Figures A through C, which represent the sequence editing status of individual plants Ghralf30l-1, Ghralf30l-2, and Ghralf30l-3, respectively. The sgRNA target site and PAM region are shown in blue and orange fonts, respectively.

[0033] Figure 5 The following figures illustrate the phenotypic identification results of cotton plant sterile lines provided in this embodiment of the invention: Figure A shows the anther and pollen activity phenotypic diagrams of individual plants of the mutants Ghralf4l-1, Ghralf4l-2, Ghralf4l-3, Ghralf30l-1, Ghralf30l-2, and Ghralf30l-3 under normal and high temperature conditions, Figure B shows the statistical data of anther dehiscence rate under normal and high temperature conditions, and Figure C shows the statistical data of pollen viability under normal and high temperature conditions; white arrows indicate undehiscent anthers, and red arrows indicate inactive pollen grains; scale bar: 7mm (top), 500μm (bottom). Detailed Implementation

[0034] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0035] The materials used in the following embodiments are not limited to those listed below, and other similar materials may be used instead. Unless otherwise specified, the instruments shall be used under conventional conditions or as recommended by the manufacturer. Those skilled in the art should have relevant knowledge of the use of conventional materials and instruments.

[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter pertains. Before a detailed description of the invention, the following definitions are provided to better understand it.

[0037] To better understand this teaching and without limiting its scope, all figures and other numerical values ​​used in the specification and claims to express quantities, percentages, or proportions should, in all cases, be understood to be modified by the term "about." Therefore, unless otherwise stated, the numerical parameters set forth in the following specification and appended claims are approximate values ​​that may vary depending on the desired properties sought. At a minimum, each numerical parameter should be interpreted based at least on the reported significant figures and by applying common rounding techniques.

[0038] In this invention, the term "normal temperature" refers to 30°C and below, and the term "high temperature" refers to 36°C and above.

[0039] This invention has screened two gene clusters associated with high-temperature male sterility in cotton, namely GhRALF4L and GhRALF30L. The GhRALF4L gene cluster includes at least one of the genes GhRALF4LA1, GhRALF4LA2, GhRALF4LA3, GhRALF4LD1, and GhRALF4LD2, and their gene sequences are shown in SEQ ID. As shown in NO.1 to NO.5, the GhRALF30L gene cluster includes at least one of the following genes: GhRALF30LA2, GhRALF30LA3, GhRALF30LA4, GhRALF30LA5, GhRALF30LA6, GhRALF30LA7, GhRALF30LD1, GhRALF30LD2, GhRALF30LD3, GhRALF30LD4, GhRALF30LD5, GhRALF30LD6, GhRALF30LD7, GhRALF30LD8, GhRALF30LD9, GhRALF30LD10, GhRALF30LD11, GhRALF30LD12, GhRALF30LS1, GhRALF30LS2, GhRALF30LS3, and GhRALF30LS4. Their gene sequences are shown in SEQ ID NO.6 to NO.28, respectively. The specific sequences and corresponding gene ID numbers are as follows:

[0040] GhRALF4LA1(ID:GH_A06G1412,SEQ ID NO.1):

[0041] ATGGGGTCCAAGGTCTGGCATATGTTCCTTCTCTTGGCCTTGGCAATGGTTTCTGAATGCACCAAATTTG

[0042] AGGAGGTCAATTCGGGTATTCACCATCGGGACAATATCAGTGGAGATTTGTGCATTGGCAGACACTGTGACA

[0043] TTAAAGATGATATATTCATGGATTCCGAGACAAATATTCGACTACTTGCTGCAAGAAGATACATTTCATATGAA

[0044] GCACTTAAAAAAAACAATGTCCCGTGCCTCCAACAAGGACGATCTTACTACGAATGTTCCACTGGGAAACC

[0045] GGTCAACCCTTACACTCGTGGTTGCACTTACGCAACACGTTGCAGAAGGTACACTGCTTAA

[0046] GhRALF4LA2(ID:GH_A06G1413,2SEQ ID NO.2):

[0047] ATGGGTTCCAAGGTCTGGCATATGTTCCTTCTCTTGGCCTTGGCAATGGTGGCTGAATGCACCAAATTTG

[0048] ACGAGGTCAATTCGGGTATTCACCATCGGGACAACAACAGTCGAGATTCGTGCATTGGCGAGCACTGTAACA

[0049] TTGAAGATGATATATTCATGGATTCTGAGACAAATATTCGACTACTTGCTGCAAGAAAATACATTTCATATGAA

[0050] GCACTTAAGAAAAACAATGTCCCGTGCCTCCAACAAGGACGATCTTACTACGAATGTTCCACTGGGAAACC

[0051] GGTCAACCCTTACACTCGTGGTTGCACTTACGCAACACGTTGCAGAAGGTACACTGCTTAA

[0052] GhRALF4LA3(ID:GH_A06G2408,SEQ ID NO.3):

[0053] ATGGGTTCCAAGGTCTGGCATATGTTCCTTCTCTTGGCCTTGGCAATGGTGGCTGAATGCACCAAATTTGACGAGGTCAACTCGGGTATTCACCATCGGGACAACAACAGTCGAGATTCGTGCATTGGCGAGCACTGTAACATTGAAGATGATATATTCATGGATTCTGAGACAAATATTCGACTACTTGCTGCAAGAAAATACATTTCATATGAAGCACTTAAGAAAAACAATGTCCCGTGCCTCCAACAAGGACGATCTTACTACGAATGTTCCACTGGGAAACCGGTCAACCCTTACACTCGTGGTTGCACTTACGCAACACGTTGCAGAAGGTACACTGCTTAA

[0054] GhRALF4LD1(ID:GH_D06G1494,SEQ ID NO.4):

[0055] ATGGGGTCCAAGGTCCGGCATATGTTCCTTCTCTTTGCCTTGGCAATGGTGGCTGAATGCACCAAATTTGACGAGGTCAATTCGGGTATTCACCATCGGGACAACAACAGTCGAGATTCGTGCATTGGCGAGCACTGTAACATTAAAGATGAAATATTCATGGACTCCGAGACAAATATTCGACTACTTGCTGCAAGAAGATACATTTCATATGAAGCACTTAAGAGAAACAATGTCCCGTGCTCCCACCAAGGACGATCTTACTACGAATGTTCCACTGGGAAACCGGTCAACCCTTACACTCGTGGTTGCACTTACACAACACGTTGCAGAAGGTACACTGCTTAG

[0056] GhRALF4LD2(ID:GH_D06G1496SEQ ID NO.5):

[0057] ATGGGGTCCAAGGTCTGGCATATGTTCCTTCTCTTGGCCTTGGCAATGGTGGCTGAATGCACAAAATTTGACGAGGTCAATTCGGGTATTCACCATCGCGACAACAGTCGAGATTCGTGCATTGGCGAGCACTGTAACAATAAAGATGAAATATTCATGGATTCCGAGACAAATATTCGACTACTTGCTGCAAGAAGATACATTTCATATGAAGCACTTAAGAGAAACAATGTCCCGTGCTCCCACCAAGGACGATCTTACTACGAATGTTCCACTGGGAAACCGGTCAACCCTTACACTCGTGGTTGCACTTACGCAACACGTTGCAGAAGGTACACTGCTTAA

[0058] GhRALF30LA1(ID:GH_A02G1338,SEQ ID NO.6):

[0059] ATGGGAGTCTCAAACATGAAAACATGGTTAATTTGTTTGGCTCTAATTGGCATAGTGGTGATGGAAGAGGTGATCCAAATCGATGCTGCTATGACAATCCACCATCCAGAGGTGTCCGGTCTTGCTTCCTACCGCCGCCTTCTCCAAGAAGCTGTTAATCCTTGGAATCGTGGTTGCCCAAGACTCACTAGGTGTCGAAGTTAA

[0060] GhRALF30LA2(ID:GH_A07G1733,SEQ ID NO.7):

[0061] ATGGGAGTCTCAAACATGAAAACATGGTTAATTTGTTTGGCTCTAATTGGAATAGTGGTGATAAAAGAGGTGGTCCAAATCGATGCAACTATGACAATCCACCATTTAGAGGTCTCCGGTCTTGTTTCCTATCGTCGCCTTCTCCAAGAAGCTATTAGTCGTTGGAATCATGGATGCTCAAGACTCACTAGGTGTCGAAGTTGA

[0062] GhRALF30LA3(ID:GH_A07G1734,SEQ ID NO.8):

[0063] ATGGGAGTCTCAAACATGAAAGAATGGTTAATTTGTTTGGCTCTAATTGGAATAGTAGTGATGGAAGAGGTGGTACAAATCGATGCAGCTATGACAATCCACCATCTAGAGGTCTCCGGTCTTGTTTCCTATCGTCGCCTTCTCCAAGAAACTATTAATCCTTGGAATCGTGGCTGCTCAAGACTCACTAGGTGTCGAAGTTGA

[0064] GhRALF30LA4(ID:GH_A07G1736,SEQ ID NO.9):

[0065] ATGGGAGTCTCAAACATGAAAACATGGATAATTTGTTTGGCTATAATTAGCATAGTGGTGATGGAAGAGGTGATCCAAATCGATGCAGCTATTGCAATCCACCATCCAGAGGTCTCCCGTCTTGTTTCCTATCGTCGCCTTCTCCAAGAAGCTGTTAATCCTTGGAATCGTGGCTGCTCAAAACTCACTTGGTGTCGAAGTTAA

[0066] GhRALF30LA5(ID:GH_A07G1737,SEQ ID NO.10):

[0067] ATGGGCGTCTCAAACATGAAAACATGGTTAATTTGTTTGGCTCTAATTGGCATAGTGGTGATGGAAGAGGTGATCCCAATCTATGCAGCTATTGCAATCCACCATCCAGAGGTCTCCGATCTTGTTTCCTATCGTCGCCTTCTCCAAGAAGCTGTTAATCCTTGGAATCGTGGCTGCTCAAAACTCACTAGGTGTCGAAGTTAA

[0068] GhRALF30LA6(ID:GH_A07G1738,SEQ ID NO.11):

[0069] ATGGGAGCCTCAGACATGAAAACATGGTTAATTTTTTTGGCTTTAATTGGTATAGTGGTGATGGAAGAGGTGATCCAAATTGATGCAGCTATGACAATCCACCATCCAGAGGTCTCCGGTCTTGTTTCCTATCGTTGCCTTCTCCAAGAAGCTATTAATCCTTGGAACCGTGGCTGTTCAAGACTCACTAGGTGCCGAAGTTAA

[0070] GhRALF30LA7(ID:GH_A07G1773,SEQ ID NO.12):

[0071] ATGGGAGTCTCAAATATGAAAATATGGTTAATTTGTTTGGCTTTAATCGACATAGTGGTGATGGAAGAGGTGATCCAAATTGATGCTGCTATGACAACTCACCACCCAGAGGTCCCTGGTCTTGTTTCTTACCGTCGCCTTCTCCAAGAAGATGTTAATCCCTGGCAACGTGGTTGCTTAAAACTCACTAGGTGTCGAAGTTAA

[0072] GhRALF30LD1(ID:GH_D07G1730,SEQ ID NO.13):

[0073] ATGGGAGTCTCAAACATGAAAACATGGTTAATTTGTTTGACTCTAATTGGCATAGTGCTGATGGAAGAGGTGATCCAAATTGATGCAGCAATGACAATCCACCATCCAGAGGTCTCCGGTCTTGTTTCCTACCGTCGCCTTCTCCAAGAAGCTATTAATCCTTGGAATCGTGGCTGCTCAAGACTCACTAGGTGTCGAAGTTAA

[0074] GhRALF30LD2(ID:GH_D07G1731,SEQ ID NO.14):

[0075] ATGGGAGTCTCAAACATGAAAACATGGTTAATTTGTTTGGCTTTAATTGGCATAGTGCTGATGGAAGAGGTGATCCAAATTGATGCAGCAATGACAATTCACCATCCAGAGGTCTCCGGTCTTGTTTCCTACCGTCGCCTTCTCCAAGAAACTGTTAATCCTTGGAATCGTGGCTGCTCAAGACTCACTAGGTGTCGAAGTTAA

[0076] GhRALF30LD3(ID:GH_D07G1733,SEQ ID NO.15):

[0077] ATGGGAGTCTCAAACGTGAAAACATGGTTAATTTGTTTGGCTCTAATTGGTATAGTGGTGATGGAAGAAGTGATCCGAATTGATGCAGCAATGACAATCCACCATCCAGAGGTCTCCGGTCTTGTTTCCTACCGTCGCCTTCTCCAAGAAGCTGTTAATCCTTGGAATCGTGGCTGCTCAAGACTCGCCAGGTGCCGAAGTTAA

[0078] GhRALF30LD4(ID:GH_D07G1734,SEQ ID NO.16):

[0079] ATGGGAGTCTCAAACATGAAAACATGGTTAATTTTTTTGGCTCTAATTGGCATAGTGGTGATGGAAGAGGTGGTCCAAATTGATGCAGCAATGACAATCAACCATCCAGAGGTCTCCGGTCCTGTTTCCTACCGTCGCCTTCTCCAAGAAGCTGTTAATCCTTGGAATCGTGGCTGCTCAAAACTCACTAGGTGTCGAAGTTAA

[0080] GhRALF30LD5(ID:GH_D07G1735,SEQ ID NO.17):

[0081] ATGGGAGTCTCAAACATGAAAACATGGTTAATTTGTTTGGCTCTAATTGGCATAGTGGTGATGGAAGAAGTGGTCCAAATTGATGCAGTAATGACAATCCACCATCCTGAGGTCTCCGGTCTTGTTTCCTACCGTCGCCTTCTCCAAGAAGCTGTTAATCCTTGGAATCGTGGCTGCACAAGACACACTAGGTGTCGAAATTAA

[0082] GhRALF30LD6(ID:GH_D07G1736,SEQ ID NO.18):

[0083] ATGGGAGTCTCAAACATGAAAACATGGTTAATTTGTTTGGCTCTAATTGGCATAGTGGTGATGGAAGAGGTGATCCAAATTGATGCAGCAATGACAATCCACCATCCAGAGGTCTCCGGTCTTGTTTCCTACCGTTGCCTTCTCCAAGAAGCTGTTAATCCTTGGAATCGTGGCTGCTCAAGACTCACTAGGTGTCGAAGTTAG

[0084] GhRALF30LD7(ID:GH_D07G1737,SEQ ID NO.19):

[0085] ATGGGTGTCTCAAACATGAAAACATGGTTAATTTGTTTGGCTCTAATTGGCATAGTGGTGATGGAAGAGGTGATCCAAATTGATGCAGTAATGACAATCCACGATCCTGAGGTCTCCGGTCTTGTTTCCTACCGTCGCCTTCTCCAAGAAGCGGTTAATCCTTGGAATCGTGGCTGCTCAAGACTCACTAGGTGTCGAAGTTAA

[0086] GhRALF30LD8(ID:GH_D07G1739,SEQ ID NO.20):

[0087] ATGGGAGTCTCAAACATGAAAACATGGTTAATTCGTTTGGCTCTAATTGGTATAGTGGTGATGGAAGAGGCGATCCAAATTGATGCAGCAATGACAATCAACCATCCAGAGGTCTCCGGTTTTGTTTCCTATCGTCGCCTTCTCCAAGAAGCTGTTAATCCTTGGAATCGTGGCTGGTCAAGACTCACTAGGTGTCGAAGTTAA

[0088] GhRALF30LD9(ID:GH_D07G1741,SEQ ID NO.21):

[0089] ATGGGAGTCTCAAACATGAAAACATGGTTAATTTGTTTGGCTCTAATTGGCATAGTGGTGATGGAAGAGGTGATCCAAATTGATGCAGCAATGACAATCCACCATCCAGAGGTCTCCGGTCTTGTTTCCTACCGTCGCCTTCTCCAAGAAGCTGTTAATCCTTGGAATCGTGGCTGCTCAAGACTCACTAGGTGTCGAAGTTAA

[0090] GhRALF30LD10(ID:GH_D07G1742,SEQ ID NO.22):

[0091] ATGGGAGTCTCAAACATGAAAACATGGTTAATTTGTTTGGCTCTAATTGGCATAGTGGTGATGGAAGAGGTGATCCAAATTGATGCAGCAATGACAATCCACCATCCAGAGGTCTTTGGTCTTGTTTCCTACCGTCGCCTTCTCCAAGAAGCTGTTAATCCTTGGAATCGTGGCTGCTCAAGACTCACTAGGTGTCGAAGTTAA

[0092] GhRALF30LD11(ID:GH_D07G1743,SEQ ID NO.23):

[0093] ATGGGAGTCTCAAACAGGAAAACATGGTTAATTTGTTTGGCTCTAATTAGCATAGTGGTGATGGAAGAGGTGATCCAAATTGATGCAGCAATGACAATCCACCATCCAGAGGTCTCCGGTCTTGTTTCCTACCGTCGCCTTCTCCAAGAAGCTGTTAATCCTTGGAATCGTGGCTGCTCAAGACTCACTAGGTGTCGAAGTTAA

[0094] GhRALF30LD12(ID:GH_D07G1775,SEQ ID NO.24):

[0095] ATGGGAGTCTCAAATATGAAAATATGGTTAATTTGTTTGGCTTTAATCGGCATAGTGGTGATGGAAGAGGTGATCCAAATCGATGCTGCTATGACAACTCACCATCCAGAGGTCTCCGGTCTTGTTTCCTACCGTCGCCTTTTCCAAGAAGCGGTTAATCCCTGGCAACGTGGTTGCTCAAAACTCACTAGGTGCCGAAGTTAA

[0096] GhRALF30LS1(ID:GH_scaffold31142_objG0001,SEQ ID NO.25):

[0097] ATGGGAGTCTCAAACATGAAAACATGGTTAATTTGTTTGGCTCTAATTGGCATAGTGGTGATGGAAGAGGTGATCCAAATTGATGCAACAATGACAATCCACCATCTAGAGGTCTCCGGTCTTGTTTCCTACCGTCGCCTTCTCCAAGAAGTTTTTAATCCTTGGAATCGTGGCTGTTCAAGACTCACTAGGTGTCGAAGTTAA

[0098] GhRALF30LS2(ID:GH_scaffold32063_objG0001,SEQ ID NO.26):

[0099] ATGGGTGTCTCAAACATGAAAACATGGTTAATTTGTTTGGCTCTAATTGGCATAGTGGTGATGGAAGAGGTGATCCAAATTGATGCAGTAATGACAATCCACGATCCTGAGGTCTCCGGTCTTGTTTCCTACCGTCGCCTTCTCCAAGAAGCGGTTAATCCTTGGAATCGTGGCTGCTCAAGACTCACTAGGTGTCGAAGTTAA

[0100] GhRALF30LS3(ID:GH_scaffold32064_objG0001,SEQ ID NO.27):

[0101] ATGGGTGTCTCAAACATGAAAACATGGTTAATTTGTTTGGCTCTAATTGGCATAGTGGTGATGGAAGAGGTGATCCAAATTGATGCAGTAATGACAATCCACGATCCTGAGGTCTCCGGTCTTGTTTCCTACCGTCGCCTTCTCCAAGAAGCGGTTAATCCTTGGAATCGTGGCTGCTCAAGACTCACTAGGTGTCGAAGTTAA

[0102] GhRALF30LS4(ID:GH_scaffold4176_objG0001,SEQ ID NO.28):

[0103] ATGGGAGTCTCAAACATGAAAACATGGTTAGTTTGTTTGGCTCTAATTGGCATAGTGGTGATGGAGGAAGTGGTCCAAATTGATGCAGTAATGACAATCCACCATCCTGAGGTCTCCGGTCTTGTTTCCTACCGTCGCCTTCTCCAAGAAGCTGTTAATCCTTGGAATCGTGGCTGCTCAAGACACACTAGGTGTCGAAATTAA

[0104] Based on this, embodiments of the present invention provide the application of 28 genes from the aforementioned GhRALF4L and GhRALF30L gene clusters in the creation of high-temperature male-sterile cotton lines. By inhibiting or silencing the expression of at least one gene from the GhRALF4L and GhRALF30L gene clusters, the anthers of cotton plants fail to dehisce under high-temperature conditions, pollen loses its activity, and sterility occurs, thereby achieving the goal of creating high-temperature male-sterile cotton lines.

[0105] Based on this, embodiments of the present invention provide a method for creating a high-temperature male-sterile cotton line using 28 genes from the GhRALF4L and GhRALF30L gene clusters, which can achieve the purpose by reducing or inhibiting the expression of at least one gene from the GhRALF4L and GhRALF30L gene clusters in cotton plant cells.

[0106] To reduce or suppress gene expression, gene knockout is a preferred method in this invention. In a preferred embodiment, a recombinant CRISPR / Cas9 vector is used to knock out at least one gene in the GhRALF4L and GhRALF30L gene clusters. The recombinant CRISPR / Cas9 vector includes sgRNA1 and sgRNA2 targeting the GhRALF4L gene cluster, and / or sgRNA3 and sgRNA4 targeting the GhRALF30L gene cluster, the nucleotide sequences of which are shown in Table 1 below.

[0107] Table 1

[0108] name sequence Serial Number sgRNA1 5'-CTTACTACGAATGTTCCACT-3' SEQ ID NO.29 sgRNA2 5'-TTACACTCGTGGTTGCACTT-3' SEQ ID NO.30 sgRNA3 5'-GTCTTGTTTCCTACCGTCGC-3' SEQ ID NO.31 sgRNA4 5'-AATGACAATCCACCATCCAG-3' SEQ ID NO.32

[0109] The specific steps are as follows: The above-mentioned sgRNA is ligated into a CRISPR / Cas9 vector via polycistronic tRNA-gRNA to obtain a recombinant expression vector (GhU6.7::sgRNA); the recombinant expression vector is transformed into target cotton plants via transgenic methods to obtain six cotton high-temperature male sterile lines with genetic markers, namely cotton high-temperature male sterile mutant lines, including Ghralf4l-1, Ghralf4l-2, and Ghralf4l-3 mutants that are edited against the GhRALF4L gene cluster, and Ghralf30l-1, Ghralf30l-2, and Ghralf30l-3 mutants that are edited against the GhRALF30L gene cluster.

[0110] The transgenic method used in the embodiments of the present invention is not particularly limited in terms of specific steps; conventional transgenic steps in the art can be used. In a preferred embodiment, the transgenic method is Agrobacterium-mediated transformation.

[0111] The above six mutants exhibit male infertility due to malformed microspore development and failure of anther dehiscence under high temperature conditions (such as above 36°C).

[0112] The technical solution of this application and the technical effects achieved will be described in detail below through more specific embodiments.

[0113] Example 1: Phylogenetic analysis of the GhRALF4L and GhRALF30L gene clusters in upland cotton and the RALF gene family in Arabidopsis thaliana.

[0114] The research methodology is as follows:

[0115] The phylogenetic tree was constructed using MEGAX software with a bootstrap value set to 1000, and the nearest neighbor combination method was used for its construction. Gene sequences from the GhRALF4L and GhRALF30L gene clusters were obtained from the CottonMD website: https: / / yanglab.hzau.edu.cn / CottonMD; sequences from the Arabidopsis RALF gene family were obtained from the TAIR website: https: / / www.arabidopsis.org / .

[0116] Figure 1 The results show the phylogenetic analysis of the GhRALF4L and GhRALF30L gene clusters in upland cotton and the RALF gene family in Arabidopsis thaliana. Figure 1 The blue background shows that the GhRALF4L gene cluster in upland cotton contains 5 genes: GhRALF4LA1, GhRALF4LA2, GhRALF4LA3, GhRALF4LD1, and GhRALF4LD2. The green background shows that the GhRALF30L gene cluster contains 23 genes: GhRALF30LA2, GhRALF30LA3, GhRALF30LA4, GhRALF30LA5, GhRALF30LA6, and GhRALF30LA7. Genes GhRALF30LD1, GhRALF30LD2, GhRALF30LD3, GhRALF30LD4, GhRALF30LD5, GhRALF30LD6, GhRALF30LD7, GhRALF30LD8, GhRALF30LD9, GhRALF30LD10, GhRALF30LD11, GhRALF30LD12, GhRALF30LS1, GhRALF30LS2, GhRALF30LS3, and GhRALF30LS4.

[0117] Example 2: Analysis of High-Temperature Induced Expression of GhRALF4L and GhRALF30L Gene Clusters

[0118] Research Methods:

[0119] The high-temperature induced expression analysis was validated using qRT-PCR. The main steps are briefly described below: RNA was extracted from samples obtained at room temperature and high temperature, and then reverse transcribed to obtain cDNA. Genes in the GhRALF4L and GhRALF30L gene clusters were amplified by PCR to obtain the relevant expression levels. The data analysis was performed using the t-test.

[0120] Figure 2 The results show the high-temperature induced expression analysis of the GhRALF4L and GhRALF30L gene clusters; among them, 84021 is a heat-resistant cotton line, and H05 is a heat-sensitive cotton line. Figure 2 As can be seen, the expression of the GhRALF4L and GhRALF30L gene clusters was downregulated by high temperature, and the downregulation was significantly greater in the heat-sensitive strain than in the heat-resistant strain.

[0121] Example 3: Construction of cotton mutant plants with gene deletions in the GhRALF4L and GhRALF30L gene clusters.

[0122] 1. Design and synthesis of sgRNA

[0123] Target sites sgRNAs (SEQ ID NO.29~SEQ ID NO.32) were designed from the coding region of upland cotton. Table 2 shows the sgRNA and PAM sites of genes in the GhRALF4L and GhRALF30L gene clusters. Among them, sgRNA1 and sgRNA2 target the GhRALF4L gene cluster, and sgRNA3 and sgRNA4 target the GhRALF30L gene cluster.

[0124] Table 2

[0125]

[0126] Note: The underlined motifs in Table 2 are PAM (protospacer adjacent motifs).

[0127] 2. Construction of CRISPR / Cas9 recombination vectors

[0128] The above-mentioned sg RNAs were amplified using PCR and then constructed into a CRISPR / Cas9 vector using a one-step cloning method. The CRISPR / Cas9 vector was "pRGEB32-GhU6.7-NPTⅡ (provided by the Cotton Genetic Improvement Team of Huazhong Agricultural University)". The specific steps are as follows:

[0129] (1) The PCR amplification reaction system is shown in Table 3 below.

[0130] Table 3

[0131] reactants volume Buffer 2μL dNTP (10mM) 0.3μL Forward primer (10 μM) 0.2μL Reverse primer (10 μM) 0.2μL TaqEnzyme 0.2μL PGTR 1μL Double distilled water 16.1μL Total volume 20μL

[0132] The PCR conditions were as follows: 95℃ for 5 min; 95℃ for 30 sec, 53℃ for 30 sec, 72℃ for 20 sec for a total of 3 cycles; then 95℃ for 30 sec, 59℃ for 30 sec, 72℃ for 20 sec for a total of 27 cycles; 72℃ for 5 min; and 15℃ to store the obtained PCR product.

[0133] (2) Vector digestion (BsaI enzyme was purchased from Beijing NEB Company, catalog number: R3733L). The digestion system is shown in Table 4 below:

[0134] Table 4

[0135] reactants Volume / mass plasmid 10μg 10XcutsmartBuffer 10μL BsaI enzyme (10 U / μL) 4.0μL Double distilled water Make up to 100 μL

[0136] The enzyme-digested vector was obtained by incubation at 37°C for 5 hours.

[0137] (3) Cloning (ClonExpress Entry Step Cloning Kit purchased from Nanjing Novizan Biotechnology Co., Ltd.), the cloning system is shown in Table 5 below:

[0138] Table 5

[0139] reactants Volume / mass PCR products 100ng Enzyme digestion vector 100ng Exnase enzyme 0.5μL CE buffer 1.0μL

[0140] Incubate at 37°C for 30 minutes, then let stand on ice for 5 minutes to obtain the ligation vector.

[0141] (4) The ligation vector was transformed into GV3101 Agrobacterium competent cells (purchased from Beijing Qingke Biotechnology).

[0142] 3. Using the CRISPR-Cas9 system to convert cotton

[0143] The constructed vector was introduced into cotton host cells using Agrobacterium-mediated transformation. The specific transformation steps are as follows:

[0144] (1) Select plump and healthy upland cotton J668 (the present invention is not limited to this variety), peel off the seed coat, soak in 0.1% HgCl2 for 10 min, then wash with sterile water 3 times, inoculate the sterilized cotton seeds onto sterile seedling germination medium, and incubate in a 28℃ constant temperature incubator for 6-7 days in the dark.

[0145] (2) Take a sterile hypocotyl, cut it into 0.6-0.7 cm segments and inoculate it into Agrobacterium bacterial suspension in Agrobacterium activation medium with an OD value of 0.5. After 10 min of infection, use sterile filter paper to absorb the bacterial suspension on the surface of the hypocotyl.

[0146] (3) Inoculate the hypocotyl into co-culture medium and co-culture at 21°C for 48 h; transfer to selective medium and subculture once a month until embryogenic callus is obtained; transfer the embryogenic callus to differentiation medium to obtain a large number of embryoids;

[0147] (4) After the embryoids were transformed into transgenic plant seedlings, they were transferred into rooting medium, thereby obtaining Ghralf4l-1, Ghralf4l-2 and Ghralf4l-3 mutants with the GhRALF4L gene cluster knocked out, and Ghralf30l-1, Ghralf30l-2 and Ghralf30l-3 mutants with the GhRALF30L gene cluster knocked out.

[0148] The components and preparation methods of the culture medium used for the above transformation applications are as follows:

[0149] Aseptic seedling germination medium: 1 / 2 MS medium, 15 g / L glucose, 2.5 g / L Phytagel; pH 6.1–6.2;

[0150] Agrobacterium-mediated activation medium: tryptone 5 g / L, NaCl 5 g / L, MgSO4·7H2O 0.1 g / L, KH2PO4 0.25 g / L, mannitol 5 g / L, glycine 1.0 g / L; pH 5.85–5.95.

[0151] Co-culture medium: MSB medium, 0.1 mg / L 2,4-D (2,4-dichlorophenoxyacetic acid), 0.1 mg / L KT (kinin), 50 mg / L sodium acetate (AS), 3% glucose, 0.25% Phytagel, pH 5.8.

[0152] Selective medium: MSB medium, 2,4-D 0.1 mg / L, KT 0.1 mg / L, 3% Glucose, 0.3% Phytagel, kanamycin 50 mg / L, cephalosporin 400 mg / L; pH 5.85–5.95.

[0153] Differentiation medium: Remove NH4NO3 from MSB medium, double the amount of KNO3, add Gln 1.0 g / L, Asn 0.5 g / L, IBA 0.5 mg / L, KT 0.15 mg / L, 3% Glucose, and 0.25% Phytagel; pH 6.1–6.2.

[0154] Rooting medium: 1 / 2 MS medium, B5 organic matter, 15 g / L glucose, 2.5 g / L Phytagel; pH 5.90–5.95.

[0155] CRISPR-Cas9 gene editing effects on related genes in the GhRALF4L and GhRALF30L gene clusters

[0156] In this embodiment, gene editing detection was performed on the regenerated plants obtained by next-generation sequencing (Hi-TOM). The reference method is from "Liu Q, Wang C, Jiao X, Zhang H, Song L, Li Y, Gao C, Wang K. Hi-TOM: a platform for high-throughput tracking of mutations induced by CRISPR / Cassystems. Sci China Life Sci. 2019 Jan;62(1):1-7. doi:10.1007 / s11427-018-9402-9. Epub 2018Nov 13.PMID:30446870." The main steps are briefly described as follows: primers were designed for approximately 100-140 bases upstream and downstream of the target gene fragment to amplify the target gene sequence, and the amplified target gene sequence was obtained by next-generation sequencing to obtain the gene editing status.

[0157] Figure 3 The specific editing details of the five homologous genes in the GhRALF4L gene cluster corresponding to the Ghralf4l-1, Ghralf4l-2, and Ghralf4l-3 mutants are shown. Figure 3 This indicates that their main editing type is base deletion, and their sgRNA target sites and PAM regions are shown in blue and orange fonts, respectively.

[0158] Figure 4 This describes the specific editing details of the 23 homologous genes in the GhRALF30L gene cluster corresponding to the Ghralf30l-1, Ghralf30l-2, and Ghralf30l-3 mutants in Example 6; Figure 4 This indicates that their main editing type is base deletion, and their sgRNA target sites and PAM regions are shown in blue and orange fonts, respectively.

[0159] Ghralf4l-1, Ghralf4l-2, Ghralf4l-3, Ghralf30l-1, Ghralf30l-2 and Ghralf30l-3 Mutant phenotypic verification

[0160] The main steps of phenotypic investigation are as follows: Anthers and pollen from WT (wild type), Ghralf4l-1, Ghralf4l-2, Ghralf4l-3, Ghralf30l-1, Ghralf30l-2, and Ghralf30l-3 mutant plants were collected under both normal temperature (NT) and high temperature (HT) conditions for dehiscence and pollen viability testing. Dehiscence images were obtained using a camera, and pollen viability was detected by TTC staining. The normal temperature culture conditions were set at 28-29℃, and the high temperature culture conditions were set at 36-37℃ for 3 days. The specific steps for TTC pollen viability staining observation are as follows:

[0161] The specific steps for observing TTC pollen viability staining are as follows: Dissolve 8 g of TTC (2,3,5-triphenyltetrazolium chloride, molecular weight 334.8) in 1 L of phosphate buffer (26.6 g dipotassium hydrogen phosphate trihydrate and 10.2 g dipotassium hydrogen phosphate) to prepare a 2% working solution, and store at 4℃ protected from light. When needed, aliquot the solution into 1.5 mL centrifuge tubes, insert the anthers, incubate at 28℃ for 2 hours, and then observe under a microscope.

[0162] Figure 5 The results of phenotypic identification of cotton plant sterile lines are shown. Figure A shows the anther and pollen viability phenotypes of individual plants of the Ghralf4l-1, Ghralf4l-2, Ghralf4l-3, Ghralf30l-1, Ghralf30l-2, and Ghralf30l-3 mutants under normal and high temperature conditions, respectively. Figure B shows the statistical data of anther dehiscence rate under normal and high temperature conditions, and Figure C shows the statistical data of pollen viability under normal and high temperature conditions. White arrows indicate indehiscent anthers, and red arrows indicate inactive pollen grains. As can be seen from the figures... Figure 5 This indicates that the GhRALF4L and GhRALF30L gene clusters exhibit a dose-response effect in regulating high-temperature fertility; that is, the higher the gene editing efficiency of the GhRALF4L and GhRALF30L gene clusters, the more severe the loss of function of GhRALF4L and GhRALF30L, and the more easily the corresponding cotton mutant plants are induced to have reduced fertility at high temperatures. Furthermore, the related mutants exhibit the typical characteristics of being fertile at room temperature and sterile at high temperatures, meeting the requirements of thermosensitive male-sterile lines. In addition, the wild-type control showed normal dehiscence at both room temperature and high temperatures, and pollen viability was close to 100%.

[0163] Based on the results of the above examples, it can be concluded that by knocking out gene fragments of the GhRALF4L and GhRALF30L gene clusters in cotton, high-temperature male sterile cotton lines can be created.

[0164] The present invention has been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the invention. The descriptions of the embodiments above are only for the purpose of helping to understand the invention and its core ideas. It should be noted that those skilled in the art can make various improvements and modifications to the invention without departing from its principles, and these improvements and modifications also fall within the protection scope of the claims of the present invention.

Claims

1. The GhRALF4L and / or GhRALF30L gene clusters, among which, The GhRALF4L gene cluster includes at least one of the genes GhRALF4LA1, GhRALF4LA2, GhRALF4LA3, GhRALF4LD1 and GhRALF4LD2, and their gene sequences are shown in SEQ ID NO.1 to 5, respectively. The GhRALF30L gene cluster includes at least one of the following genes: GhRALF30LA2, GhRALF30LA3, GhRALF30LA4, GhRALF30LA5, GhRALF30LA6, GhRALF30LA7, GhRALF30LD1, GhRALF30LD2, GhRALF30LD3, GhRALF30LD4, GhRALF30LD5, GhRALF30LD6, GhRALF30LD7, GhRALF30LD8, GhRALF30LD9, GhRALF30LD10, GhRALF30LD11, GhRALF30LD12, GhRALF30LS1, GhRALF30LS2, GhRALF30LS3, and GhRALF30LS4, and their gene sequences are shown in SEQ ID NO. 6–28, respectively.

2. The application of the GhRALF4L and / or GhRALF30L gene clusters as described in claim 1 in the creation of high-temperature male-sterile cotton lines.

3. The application according to claim 1, wherein the high temperature is above 36°C.

4. sgRNA, which includes: The nucleotide sequences of sgRNA1 and sgRNA2 targeting the GhRALF4L gene cluster are shown in SEQ ID NO.29 and SEQ ID NO.30, respectively. and / or The nucleotide sequences of sgRNA3 and sgRNA4, which target the GhRALF30L gene cluster, are shown in SEQ ID NO.31 and SEQ ID NO.32, respectively.

5. A recombinant CRISPR / Cas9 system vector for knocking out at least one gene in the GhRALF4L and GhRALF30L gene clusters, wherein the recombinant CRISPR / Cas9 system vector comprises the nucleotide sequence of the sgRNA of claim 4.

6. A method for creating a high-temperature male-sterile cotton line, comprising reducing or inhibiting the expression of at least one gene in the GhRALF4L and GhRALF30L gene clusters in cotton plant cells.

7. The method of claim 6, wherein the manner of reducing or inhibiting gene expression includes at least one of gene knockout, RNA interference, antisense oligonucleotides, and gene silencing.

8. The method according to claim 6, comprising the following steps: Construct the recombinant CRISPR / Cas9 system vector as described in claim 5; The recombinant CRISPR / Cas9 system vector was transformed into the target cotton plants via transgenic methods to obtain cotton high-temperature male sterile lines with genetic markers.

9. The method according to claim 8, wherein the transgenic method is Agrobacterium-mediated.

10. The application of the GhRALF4L and / or GhRALF30L gene clusters of claim 1, and / or the recombinant CRISPR / Cas9 system vector of claim 5, and / or the method of any one of claims 7 to 9 in cotton hybridization breeding.

Images