A kind of LAMP primer set, kit and detection method for detecting oat smut pathogen

By designing LAMP-specific primer sets and combining multiple detection methods, the problems of speed and accuracy in detecting oat smut pathogens were solved, achieving efficient detection of pathogens in oat seeds, suitable for general laboratory and field applications.

CN121137253BActive Publication Date: 2026-05-05INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511677803.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-17
Publication Date
2026-05-05
Estimated Expiration
2045-11-17

AI Technical Summary

Technical Problem

Currently, there is a lack of rapid and accurate methods for detecting the pathogen of oat smut (Ustilago hordei), making it difficult to determine whether seeds carry the pathogen before sowing and thus take effective control measures.

Method used

Based on LAMP technology, a specific primer set (F3, B3, FIP, BIP, LF, LB) was designed and combined with fluorescent dye colorimetric method, real-time fluorescence quantitative method and agarose gel electrophoresis method to achieve rapid detection of oat smut pathogen in oat seeds.

Benefits of technology

It achieves highly specific, sensitive, rapid, and convenient detection of oat smut pathogens, at a low cost, and is suitable for large-scale testing in ordinary laboratories and fields.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention belongs to the field of molecular biology detection technology for plant fungi, and discloses a LAMP primer set, reagent kit, and detection method for detecting the pathogen of oat smut. Based on the pathogen of oat smut... Ustilago hordei A set of LAMP-specific primers was designed based on specific sequences from the whole genome. The results were determined using real-time quantitative PCR, agarose gel electrophoresis, and SYBR Green I fluorescent dye assay to detect the oat smut pathogen carried on oat seeds. The LAMP detection method for oat smut pathogen established in this invention is highly specific, sensitive, fast, and low-cost, providing a new technical means for detecting oat smut pathogen carried on oat seeds and possessing high practical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology detection technology for plant fungi, specifically, it relates to a LAMP primer set, reagent kit and detection method for detecting oat smut pathogen. Background Technology

[0002] Loop-mediated isothermal amplification (LAMP) is a novel isothermal nucleic acid amplification technique developed by Notomi et al. in 2000. This technique uses two pairs of specific primers (inner and outer) targeting six specific regions of a target gene. It utilizes DNA polymerase with strand displacement activity to specifically amplify the target sequence under isothermal conditions, offering high specificity, high sensitivity, economy, and simplicity. The isothermal nature of LAMP makes it suitable for complex scenarios (such as fieldwork and grassroots environments) and provides high sensitivity and rapid response. Currently, LAMP technology is widely used in clinical pathogen detection, food safety, drug quality control, customs quarantine, animal and plant disease diagnosis, and agricultural and forestry environmental monitoring. In 2003, Fukuta et al. first combined LAMP technology with reverse transcription technology for plant disease detection, successfully detecting yam mosaic virus (JYMV). Ma Jun et al. screened for fruit anthracnose based on comparative genomics. Colletotrichum fructicola Based on the specific molecular markers of *Hydrocotyle spp.*, a rapid LAMP detection system for *Hydrocotyle spp.* anthracnose of pecans was successfully established. Barley sheath rot is caused by *Stenosporium gracilis* (…). Dactylobotrys gramincola Diseases of the ears caused by *I. coli* severely affect the yield and quality of highland barley. Zhang Haiqing et al., based on ITS sequences, designed and screened specific primers, establishing a highly sensitive and rapid method for detecting *St. coli* on highland barley. These studies demonstrate the broad applicability and reliability of LAMP technology in pathogen detection. In recent years, the combination of LAMP technology with microfluidics, CRISPR, and other technologies has made detection equipment more portable and intelligent, reducing detection costs and the technical requirements for testing personnel, and making the acquisition of detection results simpler and more efficient. However, to date, there are no research reports on the application of related technologies in the detection of oat pathogens.

[0003] Oat smut pathogen ( Ustilago hordei Oat smut, also known as oat smut fungus, is mainly spread through seeds. Therefore, testing seeds for pathogens before sowing to determine if control measures are needed is the most economical and effective method for controlling the disease. However, because the spores of the oat smut pathogen are small (approximately 5-9 μm in diameter) and difficult to observe with the naked eye, there is currently no rapid detection method for the oat smut pathogen. Summary of the Invention

[0004] Based on LAMP technology, this invention develops LAMP-specific primers for detecting oat smut pathogens and establishes a detection method for these pathogens. This method allows for rapid detection of oat smut pathogens from oat seeds, and its establishment is beneficial for controlling the occurrence of oat smut.

[0005] To achieve the objectives of this invention, in a first aspect, this invention provides a group of oat smut pathogens (barley smut fungi). Ustilago hordei LAMP-specific primers were designed according to the LAMP primer design principles. Based on the specific genome sequence of oat smut pathogen in the Genbank database, multiple sequence alignment was performed to identify a highly conserved region as the amplification target. Then, a set of specific primers was designed using the online software Primer Explore V5 (http: / / primerexplorer.jp / lampv5e / index.html), including: outer forward primer F3 and outer reverse primer B3 (SEQ ID NO:1-2), inner forward primer FIP and inner reverse primer BIP (SEQ ID NO:3-4), and loop primers LF and LB (SEQ ID NO:5-6).

[0006] F3: 5′-GCAGAGGAGGAAGCTCGA-3′;

[0007] B3: 5′-TGGTCCGTCGCATGGTTA-3′;

[0008] FIP: 5′-GGATGCAGAAAAGTTGCGGTCACCTGCTTTGGCTCCGAT-3′;

[0009] BIP: 5′-AACCCAACTTGCCGCTGCAGGACGATCCAGCAATGACACT-3′;

[0010] LF: 5′-AACAGGGCCGAAATGGGC-3′;

[0011] LB: 5′-CGCATGCTTCTCTGGCATCTG-3′.

[0012] Secondly, the present invention provides detection reagents or kits containing the primers.

[0013] Thirdly, the present invention provides a pathogen of oat smut ( Ustilago hordei The detection kit contains the primers and at least one of dNTPs, Bst DNA polymerase, betaine, and reaction buffer.

[0014] Fourthly, the present invention provides the primers, the detection reagents or kits, or the detection kits for detecting oat smut pathogens (… Ustilago hordei Applications in ).

[0015] Fifthly, the present invention provides a pathogen of oat smut ( Ustilago hordei The detection method includes the following steps:

[0016] 1) Extract DNA from the sample to be tested;

[0017] 2) Using the DNA extracted in step 1) as a template, LAMP amplification reaction was performed using the primers shown in SEQ ID NO:1-6;

[0018] 3) Determination of amplification results.

[0019] Further, the reaction system used in step 2) is as follows: 2.0 μL of DNA template (100 fg / μL-10 ng / μL), 3.5 μL of 10 mM dNTPs, 0.2 μL each of 10 μM primers F3 and B3, 1.6 μL each of 10 μM primers FIP and BIP, 0.4 μL each of 10 μM primers LF and LB, 4.0 μL of 0.8 M betaine, 0.8 μL of 8 U / μL Bst DNA polymerase, 2.5 μL of 10× isothermal amplification reaction buffer, 1.5 μL of 100 mM MgSO4, and 6.3 μL of sterile distilled water. The LAMP system for real-time quantitative PCR requires the addition of 2.0 μL of SYBR Green I (10×) and 0.5 μL of ROX reference dye at a concentration of 25 μM, with a corresponding reduction of 2.5 μL of sterile distilled water.

[0020] Furthermore, the reaction conditions used in step 2) are: reacting at 60-65℃ for 40-60 min (preferably reacting at 65℃ for 40 min).

[0021] Further, step 3) can be performed using a fluorescent dye colorimetric method to determine the amplification results: Add SYBR Green I dye to the LAMP amplification product solution to initiate a colorimetric reaction. If the amplification product solution changes from orange to green, it indicates that the sample contains oat smut pathogen (Smut smut). Ustilago hordei ).

[0022] Further, in step 3), the amplification results can be determined using agarose gel electrophoresis: if the amplification products show characteristic ladder-like bands on the agarose gel, it indicates that the sample contains oat smut pathogen (…). Ustilago hordei ).

[0023] Further, in step 3), the amplification products are determined using the real-time fluorescence quantitative amplification curve method: the fluorescence detection interval is 1 min, and the amplification is determined based on the change in fluorescence signal. If the amplification curve shows an exponential change in amplification, it indicates that the amplification is normal. The sample DNA binds correctly to the designed primers and undergoes exponential amplification under the catalysis of Bst DNA polymerase. After adding SYBR GREEN I fluorescent dye, detectable fluorescence is generated, indicating that the sample contains oat smut pathogen.

[0024] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0025] (i) High specificity: The test results showed that no positive results were detected for the other five common pathogens on oat seeds, only the oat smut pathogen produced a positive result.

[0026] (ii) High sensitivity: The test results showed that the DNA of seed washing precipitates after treatment with smut fungal suspensions of different concentration gradients was detected by LAMP amplification, and the lowest detectable concentration of oat smut pathogen DNA was 100 fg / μL.

[0027] (III) Rapid and Convenient: Test results show that LAMP amplification within a temperature range of 55-70℃ for 30-60 minutes under various equipment conditions, including water bath, oven, and conventional PCR instruments, can all be detected normally. Furthermore, three result interpretation methods accurately reflect the results after the reaction. Among these, amplification using a 65℃ water bath for 40 minutes, followed by direct observation of the reaction results by adding SYBR Green I fluorescent dye, takes less than 1 hour, significantly shortening the detection time while ensuring both convenience and accuracy.

[0028] (iv) Low cost: Since LAMP technology does not require expensive instruments such as PCR instruments, gel electrophoresis and gel electrophoresis imaging systems, the reaction can be completed using a water bath, making it suitable for large-scale testing in ordinary laboratories and fields. Attached Figure Description

[0029] Figures 1A to 1G This is a graph showing the detection results of primer screening experiments in an embodiment of the present invention; wherein... Figure 1A-1B 1C-1D represents the results of primer set T1, 1E-1G represents the results of primer set T2, and 1E-1G represents the results of primer set T3. Figure 1E The results are the fluorescence quantitative amplification curves. Figure 1A , 1C 1F represents the electrophoresis detection results. Figure 1B , 1D1G represents the detection result of SYBR Green I fluorescent dye; in the figure: M is DL5000 DNA Marker, 1 is the negative control, 2 is the pathogen of oat smut, and 3 is Rhizopus oligosporus. Rhizopus arrhizus ), 4 is Fusarium oxysporum ( Fusarium oxysporum ), 5 is Aspergillus tabinei ( Aspergillus tubingensis ), 6 is pink trichophyton ( Trichothecium roseum ), 7 is a type of mycospora. Cladosporium rectoides ).

[0030] Figures 2A-2C This is a graph showing the LAMP template sensitivity detection results in a preferred embodiment of the present invention; wherein... Figure 2A The results are the fluorescence quantitative amplification curves. Figure 2B For electrophoresis detection results, Figure 2C The results are from SYBR GreenI fluorescent dye detection. In the figure: M is DL5000 DNA Marker, 1 is negative control, and 2-9 are genomic DNA of oat smut pathogen extracted or diluted to 100ng / μL, 10ng / μL, 1ng / μL, 100pg / μL, 10pg / μL, 1pg / μL, 100fg / μL, and 10fg / μL, respectively, representing a total of 8 different concentration gradients.

[0031] Figures 3A-3C This is a graph showing the LAMP bacterial load sensitivity detection results in a preferred embodiment of the present invention; wherein... Figure 3A The results are the fluorescence quantitative amplification curves. Figure 3B For electrophoresis detection results, Figure 3C The results are shown in the figure. M is the DL5000 DNA Marker, 1 is the negative control, and 2-5 are the genomic DNA of oat smut pathogens after treatment with oat smut suspension at four different concentration gradients (from highest to lowest concentration).

[0032] Figures 4A-4F These are detection results under different amplification conditions in a preferred embodiment of the present invention; wherein... Figure 4A , Figure 4C , Figure 4E For electrophoresis detection results, Figure 4B , Figure 4D , Figure 4F The results are from the detection of SYBR Green I fluorescent dye. Figure 4A , Figure 4BThe graph shows the detection results of different amplification instruments. In the graph: M is DL5000 DNA Marker, 1-5 are water baths, 6-10 are ovens, 11-15 are ordinary PCR instruments, 1, 5, and 11 are negative controls, and 2-5, 6-10, and 12-15 are DNA samples of seed washing precipitate after treatment with smut fungus suspension at 10-fold concentration gradients, where the smaller the number, the higher the concentration. Figure 4C , Figure 4D The graph shows the detection results at different amplification times. In the graph, M is the DL5000 DNA Marker, 1-5 are 60 min, 6-10 are 50 min, 11-15 are 40 min, 16-20 are 30 min, 1, 5, 11, and 16 are negative controls, and 2-5, 6-10, 12-15, and 17-20 are DNA samples of seed washing precipitate after treatment with smut fungal suspension at 10-fold concentration gradients, with smaller numbers indicating higher concentrations. Figure 4E , Figure 4F The graph shows the detection results at different amplification temperatures. In the graph, M is the DL5000 DNA Marker, 1-5 are 70℃, 6-10 are 65℃, 11-15 are 60℃, 16-20 are 55℃, 1, 5, 11, and 16 are negative controls, and 2-5, 6-10, 12-15, and 17-20 are DNA samples of seed washing precipitate after treatment with smut fungus suspension at 10-fold concentration gradients, with smaller numbers indicating higher concentrations. Detailed Implementation

[0033] To address the current lack of rapid detection technology for oat smut pathogens, this invention utilizes LAMP technology. Based on the specific sequences of the oat smut pathogen's whole genome, a set of LAMP-specific primers was independently designed and screened. Under isothermal conditions, the DNA of the smut pathogen is specifically amplified, enabling rapid detection of whether oat seeds carry the pathogen. Real-time quantitative PCR, agarose gel electrophoresis, and SYBR Green I fluorescent dye assays verified the reliability of this method. The LAMP detection method for oat smut pathogen established in this invention is highly specific, sensitive, fast, and cost-effective, providing a new technical means for detecting oat smut pathogen in oat seeds and possessing high practical application value.

[0034] This invention establishes a rapid LAMP detection method for oat smut pathogens based on whole-genome specific sequences.

[0035] The present invention adopts the following technical solution:

[0036] 1. LAMP-specific primer design

[0037] Following LAMP primer design principles, and based on the specific genome sequence of the oat smut pathogen, multiple sequence alignment was performed to identify a highly conserved region for amplification. A set of specific primers was then designed using the online software Primer Explore V5 (http: / / primerexplorer.jp / lampv5e / index.html). The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the synthesized primers were diluted with ultrapure water to a 10 μM solution and stored at -20℃ for later use. The primer sequences are as follows (5′-3′):

[0038] F3: GCAGAGGAGGAAGCTCGA;

[0039] B3: TGGTCCGTCGCATGGTTA;

[0040] FIP: GGATGCAGCAAAAGTTGCGGTCACCTGCTTTGGCTCCGAT;

[0041] BIP: AACCCAACTTGCCGCTGCAGGACGATCCAGCAATGACACT;

[0042] LF: AACAGGGCCGAAATGGGC;

[0043] LB: CGCATGCTTCTCTGGCATCTG.

[0044] 2. Artificial simulation of seed-borne pathogen treatment

[0045] One mycelium of *Ustilago maydis* (approximately 150 mg) was mixed with 5 mL of sterile distilled water and filtered through 150-mesh gauze. 1 / 10, 1 / 100, and 1 / 1000 of the mycelium suspension were then mixed into 4.500, 4.950, and 4.995 mL of sterile distilled water, respectively. Other control pathogens were cultured in indoor culture medium until the plates were full, and then sterile distilled water was added to prepare mycelium suspensions. Finally, each suspension was added to 10 g of oat seeds, along with 200 mL of sterile distilled water and 1 mL of Tween-20. The mixture was shaken for 5 min, and the washings were centrifuged at 3000 r / min for 10 min. The supernatant was discarded and the suspensions were used for further processing.

[0046] 3. Rapid extraction of DNA from seed washing precipitate using microbial rapid lysis buffer

[0047] Dip a portion of the seed washing precipitate into 20 μL of microbial lysis buffer using a pipette tip and mix well. Add the lysis buffer to a final volume of 50 μL and mix well. Incubate at 80°C for 15 min to lyse. After centrifuging at low speed for 3-5 minutes, use the supernatant as a template for LAMP amplification.

[0048] 4. LAMP amplification experimental procedure

[0049] The LAMP reaction system is 25.0 μL, including 2.0 μL of DNA template (100 fg / μL-10 ng / μL), 3.5 μL of 10 mM dNTPs, 0.2 μL each of 10 μM primers F3 and B3, 1.6 μL each of 10 μM primers FIP and BIP, 0.4 μL each of 10 μM primers LF and LB, 4.0 μL of 0.8 M betaine, 0.8 μL of 8 U / μL Bst DNA polymerase, 2.5 μL of 10× isothermal amplification reaction buffer, 1.5 μL of 100 mM MgSO4, and 6.3 μL of sterile distilled water. For real-time quantitative PCR (qPCR), the LAMP amplification system requires the addition of 2.0 μL of SYBR Green I (10×) and 0.5 μL of 25 μM ROX reference dye, with a corresponding reduction of 2.5 μL in the amount of sterile distilled water. The amplification conditions were: PCR reaction at 65℃ for 60 min.

[0050] After the reaction, the specificity of the primers was determined using quantitative real-time amplification (qPCR), gel electrophoresis, and SYBR Green I fluorescent dye colorimetric method. For qPCR: the program was set to detect fluorescence once every 1 minute. After amplification, the generated amplification curve was observed. A clear exponential growth phase with reasonable CT values ​​and a normal curve morphology indicated exponential amplification, which was positive; otherwise, it was negative. For agarose gel electrophoresis: 8 μL of LAMP amplification product was detected by 1% agarose gel electrophoresis and stained with EB. Observation in a gel imaging system showed characteristic ladder-like bands, indicating a positive result; otherwise, it was negative. For SYBR Green I fluorescent dye colorimetric method: 0.3 μL of 5000×SYBR Green I was added to the LAMP amplification product solution, mixed, and the color change was observed visually. Green indicated a positive reaction, and orange indicated a negative reaction.

[0051] 5. LAMP detection sensitivity analysis

[0052] Sensitivity testing included two aspects: template concentration sensitivity and bacterial load sensitivity. The template concentration sensitivity experimental group consisted of eight different concentration gradients of *Ustilago maydis* genomic DNA extracted or diluted to 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, and 10 fg / μL. The bacterial load sensitivity experimental group consisted of four different concentration gradients of *Ustilago maydis* suspension, as shown in step 2. The LAMP reaction system, amplification conditions, and result verification methods were the same as in step 4.

[0053] 6. Optimization of LAMP amplification conditions (instrument, time, temperature)

[0054] The templates for optimizing LAMP amplification conditions, from left to right, are: seed wash precipitate DNA after treatment with sterile distilled water as a control; and seed wash precipitate DNA after treatment with four different concentration gradients of *Ustilago maydis* suspension (from largest to smallest) as replicates. All five templates were detected in each treatment.

[0055] The amplification instruments were set up with three treatments: a water bath, an oven, and a regular PCR instrument, all at 65°C for 60 minutes. The amplification times were set with four treatments: 60 minutes, 50 minutes, 40 minutes, and 30 minutes, all at a water bath incubation at 65°C. The amplification temperatures were set with four treatments: 55°C, 60°C, 65°C, and 70°C, all at a water bath incubation for 40 minutes.

[0056] The LAMP reaction system consisted of: 2.0 μL of DNA template (100 fg / μL - 10 ng / μL), 3.5 μL of 10 mM dNTPs, 0.2 μL each of 10 μM primers F3 and B3, 1.6 μL each of 10 μM primers FIP and BIP, 0.4 μL each of 10 μM primers LF and LB, 4.0 μL of 0.8 M betaine, 0.8 μL of 8 U / μL Bst DNA polymerase, 2.5 μL of 10× isothermal amplification reaction buffer, 1.5 μL of 100 mM MgSO4, and 6.3 μL of sterile distilled water. Since this amplification step does not use quantitative real-time amplification (qPCR) to verify the results, the system no longer included SYBR Green (10×) or ROX reference dyes.

[0057] After the reaction was completed, the results were determined by gel electrophoresis and SYBR Green I fluorescent dye colorimetric method, respectively. The determination method was the same as in step 4, and the optimal LAMP amplification conditions were screened.

[0058] This invention utilizes the specific sequence of the oat smut pathogen as the target gene and, through a series of experiments, establishes a highly efficient and rapid LAMP detection method for detecting the oat smut pathogen in oat seeds. The establishment of this detection method is of great significance for the monitoring of oat smut pathogens and the control of oat smut.

[0059] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0060] Example 1: Establishment of a rapid LAMP detection method for oat smut pathogen.

[0061] This embodiment aims to provide a rapid LAMP detection method for oat smut pathogens, and designs three sets of LAMP detection primers (T1, T2, T3 sets), with the following sequences (5′-3′):

[0062] Group T1 (SEQ ID NO:7-12):

[0063] T1-F3: CCCACACCCATCCTTCCT

[0064] T1-B3: CGCACCTGAGAATACTCC

[0065] T1-FIP: CGCTCAACTGTGGCATTCGTTGTTTCACACCAGCCACAACAG

[0066] T1-BIP: CTACAGTCAAGCTGCCTACGCAGGTAACGAAGCCATCCTTGC

[0067] T1-LF:TGTTGATCCATGCTGATGCTC

[0068] T1-LB:CTTGCTAGTCCTCCACCTCC

[0069] Group T2 (SEQ ID NO:13-17):

[0070] T2-F3: CATCCCTTGCACGTTCTCG

[0071] T2-B3: GTTGCGTGTCCTTCCGAG

[0072] T2-FIP: GTTGGGTTGTCTCGAAGGGTCATCCTCCTTACGACGTTGGT

[0073] T2-BIP:GCTACGGCAGCTCCACTAACAGGAAGCTTGGGTTCTCGC

[0074] T2-LB:CCGGAGAACCCCTTCTATGCAG

[0075] Group T3 (SEQ ID NO:1-6):

[0076] T3-F3: GCAGAGGAGGAAGCTCGA

[0077] T3-B3: TGGTCCGTCGCATGGTTA

[0078] T3-FIP: GGATGCAGCAAAAGTTGCGGTCACCTGCTTTGGCTCCGAT

[0079] T3-BIP:AACCCAACTTGCCGCTGCAGGACGATCCAGCAATGACACT

[0080] T3-LF:AACAGGGCCGAAATGGGC

[0081] T3-LB: CGCATGCTTCTCTGGCATCTG

[0082] The established LAMP amplification system consisted of 2.0 μL of DNA template (100 fg / μL - 10 ng / μL), 3.5 μL of 10 mM dNTPs, 0.2 μL each of 10 μM primers F3 and B3, 1.6 μL each of 10 μL primers FIP and BIP, 0.4 μL each of 10 μM primers LF and LB, 4.0 μL of 0.8 M betaine, 0.8 μL of 8 U / μL Bst DNA polymerase, 2.5 μL of 10× isothermal amplification reaction buffer, 1.5 μL of 100 mM MgSO4, and 6.3 μL of sterile distilled water. For real-time quantitative PCR (qPCR), 2.0 μL of SYBR Green I (10×) and 0.5 μL of 25 μM ROX reference dye were added to the LAMP amplification system, with a corresponding reduction of 2.5 μL in the amount of sterile distilled water. The initial amplification conditions were established as a PCR reaction at 65°C for 60 minutes.

[0083] The detection methods for LAMP amplification products are real-time quantitative amplification curve method, agarose gel electrophoresis method, and SYBR Green I fluorescent dye colorimetric method. The real-time quantitative amplification curve method involves setting the program to detect fluorescence once every 1 minute. After amplification, the generated amplification curve is observed. A clear exponential growth phase with reasonable CT values ​​and a normal curve morphology indicates exponential amplification, which is positive; otherwise, it is negative. The agarose gel electrophoresis method involves taking 8 μL of LAMP amplification product, detecting it with 1% agarose gel electrophoresis, staining with EB, and observing it in a gel imaging system. The appearance of characteristic ladder-like bands indicates a positive result; otherwise, it is negative. The SYBR Green I fluorescent dye colorimetric method involves adding 0.3 μL of 5000×SYBR Green I to the LAMP amplification product solution, mixing, and observing the color change visually. Green indicates a positive result, while orange indicates a negative result.

[0084] Example 2: LAMP detection primer set screening experiment

[0085] The LAMP primer set for detecting oat smut pathogens needs to have the following characteristics: it should be able to amplify the genomic DNA of the oat smut pathogen, generate a recognizable specific product, and not produce non-specific amplification or false positives. Specific detection involves using pre-designed primer sets (T1, T2, T3 sets) to extract genomic DNA from artificially simulated samples of oat seeds carrying oat smut pathogens and other fungi commonly found on oat seeds, namely Rhizopus oligosporus, Fusarium oxysporum, Aspergillus tabineum, Trichophyton mentagrophytes, and Cladosporium, and then performing LAMP amplification.

[0086] The LAMP reaction system for primer sets T1 and T2 was 25.0 μL, containing 0.2 μL each of 10 μM outer primers F3 and B3, 1.6 μL each of 10 μM inner primers FIP and BIP, 0.4 μL each of 10 μM loop primers LF and LB, 3.5 μL of 10 mM dNTPs, 4.0 μL of 0.8 M betaine, 0.8 μL of 8 U / μL Bst DNA polymerase, 2.5 μL of 10× isothermal amplification reaction buffer, 1.5 μL of 100 mM MgSO4, 2.0 μL of DNA template, and 6.3 μL of sterile distilled water. Amplification was performed at 65℃ for 60 min using a PCR instrument. After the reaction, the specificity of the primers was determined by gel electrophoresis and SYBR Green I fluorescent dye assay.

[0087] The LAMP reaction system for primer set T3 was 25.0 μL, including 0.2 μL each of 10 μM outer primers F3 and B3, 1.6 μL each of 10 μM inner primers FIP and BIP, 0.4 μL each of 10 μM loop primers LF and LB, 3.5 μL of 10 mM dNTPs, 4.0 μL of 0.8 M betaine, 0.8 μL of 8 U / μL Bst DNA polymerase, 2.5 μL of 10× isothermal amplification reaction buffer, 1.5 μL of 100 mM MgSO4, 2.0 μL of DNA template, 2.0 μL of SYBR Green I (10×), 0.5 μL of 25 μM ROX reference dye, and 3.8 μL of sterile distilled water. Amplification was performed at 65℃ for 60 min using a PCR instrument. After the reaction, the specificity of the primers was determined by quantitative fluorescence amplification curve method, gel electrophoresis method and SYBR Green I fluorescent dye colorimetric method, respectively.

[0088] The results of the T1 primer set are as follows: Figure 1A , Figure 1B As shown: Figure 1A Characteristic ladder-like bands were observed in the LAMP amplification products of DNA from suspensions of oat smut pathogen, suspensions of five other fungi, and seed washing precipitate samples treated with sterile distilled water. Figure 1B In the study, the LAMP amplification products of DNA from oat smut pathogen suspension, suspensions of five other fungi, and seed wash precipitate samples treated with sterile distilled water all turned green after the addition of SYBR Green I. These results indicate that the T1 primer set produces non-specific amplification, resulting in false positives and making it unsuitable for detecting oat smut pathogen.

[0089] The results of the T2 primer set are as follows: Figure 1C , Figure 1D As shown: Figure 1C The LAMP amplification products of DNA from the suspension of the pathogen of oat smut, the suspensions of five other fungi, and the seed washing precipitate sample treated with sterile distilled water did not show characteristic ladder-like bands. Figure 1D In the study, the LAMP amplification products of DNA from oat smut pathogen suspension, suspensions of five other fungi, and seed washing precipitate samples treated with sterile distilled water all turned orange after the addition of SYBR Green I. These results indicate that the T2 primer set cannot amplify the genomic DNA of oat smut pathogen, resulting in all negative results and rendering it unsuitable for the detection of oat smut pathogen.

[0090] The results of the T3 primer set are as follows: Figure 1E , 1F As shown in 1G: Figure 1E The LAMP fluorescence quantitative amplification curve of DNA in seed washing precipitate samples treated with suspension of oat smut pathogen showed a typical "S"-shaped amplification curve, while the DNA in seed washing precipitate samples treated with suspension of the other 5 fungi and the DNA in seed washing precipitate samples treated with sterile distilled water (negative control) were all smooth straight lines. Figure 1F The LAMP amplification products of the DNA of seed washing precipitate samples treated with suspension of the pathogen of oat smut showed characteristic ladder-like bands, while the DNA of seed washing precipitate samples treated with suspensions of the other 5 fungi and the DNA of seed washing precipitate samples treated with sterile distilled water (negative control) did not show bands. Figure 1G In the study, the LAMP amplification product solution of the DNA from seed wash precipitate samples treated with suspensions of the oat smut pathogen showed a green color reaction, while the DNA from seed wash precipitate samples treated with suspensions of the other five fungi and the DNA from seed wash precipitate samples treated with sterile distilled water (negative control) all showed an orange color reaction. These results indicate that the T3 primer set can amplify the genomic DNA of the oat smut pathogen without producing false positives or nonspecific amplification, and can be used for the detection of the oat smut pathogen.

[0091] In summary, the T3 primer set meets the detection requirements, and all subsequent experiments were conducted based on the T3 primer set.

[0092] Example 3: Sensitivity Analysis of LAMP Detection Template Concentration

[0093] First, templates were prepared by serially diluting the extracted genomic DNA of oat smut pathogen to eight concentration gradients: 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, and 10 fg / μL. Then, the diluted DNA was used as a template for a LAMP reaction, with a negative control included.

[0094] The LAMP reaction system consisted of 25.0 μL, including 0.2 μL each of 10 μM outer primers F3 and B3, 1.6 μL each of 10 μM inner primers FIP and BIP, 0.4 μL each of 10 μM loop primers LF and LB, 3.5 μL of 10 mM dNTPs, 4.0 μL of 0.8 M betaine, 0.8 μL of 8 U / μL Bst DNA polymerase, 2.5 μL of 10× isothermal amplification reaction buffer, 1.5 μL of 100 mM MgSO4, 2.0 μL of DNA template, and 6.3 μL of sterile distilled water. Amplification was performed at 65℃ for 60 min using a PCR instrument. After the reaction, the specificity of the primers was determined by quantitative real-time amplification curve, gel electrophoresis, and SYBR Green I fluorescent dye staining.

[0095] The results showed that, Figure 2A LAMP fluorescence quantitative amplification curves of oat smut pathogen samples with DNA concentrations of 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, and 100 fg / μL showed typical "S"-shaped amplification curves, while the oat smut pathogen sample with a DNA concentration of 10 fg / μL and the negative control showed smooth straight lines; Figure 2B The LAMP amplification products of oat smut pathogen samples with DNA concentrations of 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, and 100 fg / μL showed characteristic ladder-like bands, while no bands were observed in the oat smut pathogen sample with a DNA concentration of 10 fg / μL and the negative control. Figure 2C In the study, the LAMP amplification product solutions of oat smut pathogen samples with DNA concentrations of 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, and 100 fg / μL showed a green color reaction, while the oat smut pathogen sample with a DNA concentration of 10 fg / μL and the negative control both showed an orange color reaction. These results indicate that the lowest detectable oat smut pathogen DNA concentration using LAMP technology is 100 fg / μL.

[0096] Example 4: Sensitivity analysis of LAMP detection of bacterial load

[0097] Genomic DNA was extracted from artificially simulated samples of oat seeds carrying different amounts of oat smut pathogen using primers and then amplified using LAMP. A negative control was also included. The reaction system and amplification conditions were the same as in Example 3. After the reaction, the specificity of the primers was determined by quantitative real-time amplification curves, gel electrophoresis, and SYBR Green I fluorescent dye staining.

[0098] The results showed that, Figure 3A LAMP fluorescence quantitative amplification curves of DNA from seed wash precipitate samples treated with oat smut pathogen suspensions at different concentration gradients showed typical "S"-shaped amplification curves, while DNA from seed wash precipitate samples treated with sterile distilled water (negative control) showed a smooth straight line; Figure 3B The LAMP amplification products of DNA from seed washing precipitate samples treated with oat smut pathogen suspensions at different concentration gradients showed characteristic ladder-like bands, while the DNA from seed washing precipitate samples treated with sterile distilled water (negative control) did not show any bands. Figure 3C In the study, the LAMP amplification product solution of DNA from seed wash precipitate samples treated with suspensions of oat smut pathogen at different concentration gradients showed a green color reaction, while the DNA from seed wash precipitate samples treated with sterile distilled water (negative control) showed an orange color reaction. These results indicate that the established LAMP detection technique has excellent sensitivity for bacterial load and can be used for the detection of oat smut pathogen.

[0099] Example 5 Optimization of Amplification Conditions

[0100] Genomic DNA was extracted from artificially simulated oat seeds carrying different amounts of oat smut pathogen using specific primers, and LAMP amplification was performed under different controlled conditions. The LAMP reaction system was 25.0 μL, containing: 0.2 μL each of 10 μM outer primers F3 and B3; 1.6 μL each of 10 μM inner primers FIP and BIP; 0.4 μL each of 10 μM loop primers LF and LB; 3.5 μL of 10 mM dNTPs; 4.0 μL of 0.8 M betaine; 0.8 μL of 8 U / μL Bst DNA polymerase; 2.5 μL of 10× isothermal amplification reaction buffer; 1.5 μL of 100 mM MgSO4; 2.0 μL of DNA template; and 6.3 μL of sterile distilled water. After the reaction, the amplification results were determined by gel electrophoresis and SYBR Green I fluorescent dye assay.

[0101] In the optimization experiments of the amplification instruments, the amplification conditions were: 60 min in a water bath, 60 min in an oven, and 60 min in a conventional PCR instrument. The results showed that... Figure 4A The LAMP amplification products of DNA from seed washing precipitate samples treated with oat smut pathogen suspensions at different concentration gradients showed characteristic ladder-like bands, while the DNA from seed washing precipitate samples treated with sterile distilled water (negative control) did not show any bands. Figure 4B In the study, the LAMP amplification products of DNA from seed wash precipitate samples treated with suspensions of oat smut pathogens at different concentration gradients showed a green color reaction, while the DNA from seed wash precipitate samples treated with sterile distilled water (negative control) showed an orange color reaction. These results indicate that oat smut pathogens can be detected positively using different instruments, with the water bath showing the best performance.

[0102] In the optimization experiment of amplification time, the amplification conditions were 30 min, 40 min, 50 min, and 60 min in a water bath at 65℃. The results showed that... Figure 4C The LAMP amplification products of DNA from seed washing precipitate samples treated with oat smut pathogen suspensions at different concentration gradients showed characteristic ladder-like bands, while the DNA from seed washing precipitate samples treated with sterile distilled water (negative control) did not show any bands. Figure 4D In the study, the LAMP amplification products of DNA from seed wash precipitate samples treated with suspensions of oat smut pathogen at different concentration gradients showed a green color reaction, while the DNA from seed wash precipitate samples treated with sterile distilled water (negative control) showed an orange color reaction. The results indicate that oat smut pathogen can be detected positively at amplification times of 30, 40, 50, and 60 minutes. Longer amplification times within the 30-60 minute range yield the best results, but 30 minutes is also sufficient for detection. 40 minutes shows clearer bands and is considered more suitable.

[0103] In the optimization experiment of amplification temperature, the amplification conditions were: 55℃ for 40 min, 60℃ for 40 min, 65℃ for 40 min, and 70℃ for 40 min. The results showed that... Figure 4E The LAMP amplification products of DNA from seed washing precipitate samples treated with oat smut pathogen suspensions at different concentration gradients showed characteristic ladder-like bands, while the DNA from seed washing precipitate samples treated with sterile distilled water (negative control) did not show any bands. Figure 4FIn the study, the LAMP amplification products of DNA from seed wash precipitate samples treated with suspensions of oat smut pathogen at different concentration gradients showed a green color reaction, while the DNA from seed wash precipitate samples treated with sterile distilled water (negative control) showed an orange color reaction. The results indicate that amplification temperatures between 55-70℃ were sufficient to detect oat smut pathogens positively, with approximately 65℃ showing the best results.

[0104] In conclusion, the optimal LAMP amplification conditions were determined to be: 65℃ for 40 min in a water bath.

[0105] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. Oat smut pathogen *Ustilago maydis* (barley smut fungus) Ustilago hordei The detection method is characterized by, Includes the following steps: 1) Extract DNA from the sample to be tested; 2) Using the DNA extracted in step 1) as a template, LAMP amplification reaction was carried out using LAMP-specific primers for oat smut pathogen; 3) Determination of amplification results; The LAMP-specific primers include an outer forward primer F3 and an outer reverse primer B3, an inner forward primer FIP and an inner reverse primer BIP, and loop primers LF and LB. F3: 5′-GCAGAGGAGGAAGCTCGA-3′; B3: 5′-TGGTCCGTCGCATGGTTA-3′; FIP: 5′-GGATGCAGAAAAGTTGCGGTCACCTGCTTTGGCTCCGAT-3′; BIP: 5′-AACCCAACTTGCCGCTGCAGGACGATCCAGCAATGACACT-3′; LF: 5′-AACAGGGCCGAAATGGGC-3′; LB: 5′-CGCATGCTTCTCTGGCATCTG-3′.

2. The method according to claim 1, characterized in that, Step 2) The reaction system used is as follows: 2.0 μL of DNA template (100 fg / μL-10 ng / μL), 3.5 μL of 10 mM dNTPs, 0.2 μL each of 10 μM primers F3 and B3, 1.6 μL each of 10 μM primers FIP and BIP, 0.4 μL each of 10 μM primers LF and LB, 4.0 μL of 0.8 M betaine, 0.8 μL of 8 U / μL Bst DNA polymerase, 2.5 μL of 10× isothermal amplification reaction buffer, 1.5 μL of 100 mM MgSO4, and 6.3 μL of sterile distilled water.

3. The method according to claim 1, characterized in that, Step 2) The reaction conditions used are: 60-65℃ for 40-60 min.

4. The method according to any one of claims 1-3, characterized in that, Step 3) Determine the amplification results using a fluorescent dye colorimetric method: Add SYBR Green I dye to the LAMP amplification product solution to perform a colorimetric reaction. If the amplification product solution changes from orange to green, it indicates that the sample contains the oat smut pathogen *Ustilago maydis* (barley smut fungus). Ustilago hordei ).

5. The method according to any one of claims 1-3, characterized in that, Step 3) Determine the amplification results using agarose gel electrophoresis: If the amplification products show characteristic ladder-like bands on the agarose gel, it indicates that the sample contains the oat smut pathogen *Ustilago maydis* (barley smut fungus). Ustilago hordei ).

6. The method according to any one of claims 1-3, characterized in that, Step 3) Use real-time fluorescence quantitative amplification curve method to determine the amplification products: The fluorescence detection interval is 1 minute. Determine whether the amplification is normal based on the change in fluorescence signal. If the amplification curve shows an exponential change in amplification, it indicates that the amplification is normal. The addition of SYBR GREEN I fluorescent dye produces detectable fluorescence, indicating that the sample contains the oat smut pathogen *Ustilago maydis*. Ustilago hordei ).

Citation Information

Patent Citations

  • A LAMP primer for detecting highland barley smut, a kit and application thereof

    CN112501336B