Nanometer material for specifically promoting endocytosis of PIN1

Abstract

The invention discloses a nano material for specifically promoting PIN1 endocytosis. The nano material can specifically promote PIN1 protein to enter a cytoplasm region from a cytoplasmic membrane region. The invention specifically discloses a structure (formula (I)) of SPc and application of SPc or pharmaceutically acceptable salt thereof in promoting membrane protein internalization of PIN1 protein of a tested plant. The PIN1 protein at the root of arabidopsis thaliana can be promoted to enter a cytoplasm region from a cytoplasm membrane region by applying SPc to arabidopsis thaliana. The PIN1 protein can be used as a positive inducer for researching a PIN1 protein endocytosis related metabolic pathway, and can be used for industrial production.

Description

TECHNICAL FIELD

[0001] The present application relates to a kind of nano materials specifically promoting PIN1 endocytosis. BACKGROUND

[0002] Hormones coordinate the initiation of plant organs, and cell-to-cell transport plays a central role in the formation of local auxin maxima and gradients. Auxin is a key plant hormone that regulates root growth and architecture through localized synthesis and directional intercellular transport. PINs proteins contain 10 transmembrane helices and a large (320-360 amino acid) cytoplasmic loop with multiple phosphorylation sites that are required for activity, polar auxin transport through the cytoplasmic TIR 1 / AFB pathway rapidly activates H + Endocytosis mediates root growth inhibition.

[0003] PIN proteins are recycled through endocytosis and resecretion, changing their polar localization at the plasma membrane, and thus regulating directional auxin transport. Endocytosis dynamically responds to environmental signals (e.g. light, gravity, hormones) and affects the morphogenesis of tissues such as root tips and shoot tips. PIN proteins are recycled through endocytosis and resecretion, changing their polar localization at the plasma membrane, and thus regulating directional auxin transport. Endocytosis dynamically responds to environmental signals (e.g. light, gravity, hormones) and affects the morphogenesis of tissues such as root tips and shoot tips. The balance of PIN protein abundance at the plasma membrane is prevented by endocytosis-recycling. The molecular mechanisms of PIN protein endocytosis include clathrin-mediated endocytosis, membrane microdomains (Lipid Rafts) dependent pathway, and non-clathrin pathway. Detection methods include live cell imaging, etc., but the fluorescence intensity inside and outside the cytoplasmic membrane is usually used as a reference. If a substance that can specifically promote PIN1 protein endocytosis can be provided, it can not only study the mechanism of PIN1 protein endocytosis in different plants, but also provide a basis for the cross study of PIN1 protein endocytosis and other pathways, and provide a positive control for PIN1 protein endocytosis. It has important significance for the research of PIN1 protein endocytosis for those skilled in the art. SUMMARY

[0004] The purpose of the present application is to provide a method that can specifically promote PIN1 protein into the cytoplasm.

[0005] In a first aspect, the present application provides the use of SPc or a pharmaceutically acceptable salt thereof or a nanomaterial comprising SPc or a pharmaceutically acceptable salt thereof in promoting the membrane protein internalization of PIN1 protein in a subject plant;

[0006] The SPc is as formula (I);

[0007]

[0008] The PIN1 protein is any one of the following:

[0009] B1) the protein with an amino acid sequence as shown in SEQ ID NO: 7;

[0010] B2) a protein having 80% or more identity to the protein of B1) and having the same function obtained by substitution and / or deletion and / or addition of amino acid residues of the protein of B1);

[0011] B3) a fusion protein obtained by connecting the N-terminal or / and C-terminal of B1) or B2) with a protein tag;

[0012] The nanomaterial is formed by self-assembly of SPc and / or pharmaceutically acceptable salts thereof in a solution.

[0013] In certain embodiments, the content of SPc is 20 mg L -1 to 30 mg L -1 .

[0014] In certain embodiments, the content of SPc is 20 mg L -1 , 21 mg L -1 , 22 mg L -1 , 23 mg L -1 , 24 mg L -1 , 25 mg L -1 , 26 mg L -1 , 27 mg L -1 , 28 mg L -1 , 29 mg L -1 , or 30 mg L -1 .

[0015] In certain embodiments, the nanomaterial is formed by self-assembly of SPc and / or pharmaceutically acceptable salts thereof in a solution, high-temperature treatment.

[0016] In certain embodiments, the temperature of the high-temperature treatment is 121 °C.

[0017] In certain embodiments, the time of the high-temperature treatment is 20 min.

[0018] In certain embodiments, the solvent comprises water or a culture medium.

[0019] In certain embodiments, the culture medium comprises a plant culture medium.

[0020] In certain embodiments, the plant culture medium comprises MS medium, 1 / 2MS medium, White medium, B5 medium, N6 medium, SH medium, LS medium, Knop medium, or Heller medium.

[0021] In certain embodiments, the plant culture medium further comprises agarose.

[0022] In certain embodiments, the agarose content is 0.5-5 / 100 ml.

[0023] In certain embodiments, the agarose content is 0.5 / 100 ml, 0.6 / 100 ml, 0.7 / 100 ml, 0.8 / 100 ml, 0.9 / 100 ml, 1.0 / 100 ml, 1.5 / 100 ml, 2.0 / 100 ml, 2.5 / 100 ml, 3.0 / 100 ml, 3.5 / 100 ml, 4.0 / 100 ml, 4.5 / 100 ml, 5.0 / 100 ml. In certain embodiments, the membrane protein internalization is PIN1 protein transition from a plasma membrane region to a cytoplasmic region.

[0024] In certain embodiments, the plasma membrane region is selected from the group consisting of an integral membrane, an embedded membrane, a surface attached membrane, or any combination thereof.

[0025] In certain embodiments, the use comprises specifically promoting the membrane protein internalization of PIN1 protein;

[0026] In certain embodiments, the use comprises promoting the membrane protein internalization of PIN1 protein, and not promoting the membrane protein internalization of PIN2 protein and / or PIN3 protein.

[0027] In certain embodiments, the membrane protein internalization of PIN1 protein comprises increasing the ratio of PIN1 protein content in a cytoplasmic region to PIN1 protein content in a plasma membrane region.

[0028] In certain embodiments, the PIN1 protein is an integral membrane protein;

[0029] In certain embodiments, the integral membrane protein is embedded in a lipid bilayer by a transmembrane a-helix structure.

[0030] In certain embodiments, the lipid bilayer is a cytoplasmic membrane lipid bilayer.

[0031] In certain embodiments, the integral membrane protein has 8-12 transmembrane a-helices.

[0032] In certain embodiments, the integral membrane protein has 10 transmembrane a-helices.

[0033] In certain embodiments, the subject plant is selected from the group consisting of a plant root.

[0034] In certain embodiments, the root is selected from the group consisting of a root tip meristem.

[0035] In certain embodiments, the root tip meristem is selected from the group consisting of a procambium cell, a vascular cylinder cell, or any combination thereof.

[0036] In another aspect the present invention provides a product for facilitating membrane protein internalization of PIN1 protein in a subject plant, said product comprising the SPc described above or a pharmaceutically acceptable salt thereof or the nanomaterial described above.

[0037] In certain embodiments, the product further comprises any one of the following biological materials:

[0038] A1) a nucleic acid molecule encoding the protein described above;

[0039] A2) a coding gene expressing the nucleic acid molecule of A1);

[0040] A3) an expression cassette comprising the gene of A2);

[0041] A4) a recombinant vector comprising the gene of A2) or a recombinant vector comprising the expression cassette of A3);

[0042] A5) a recombinant microorganism comprising the gene of A2) or a recombinant microorganism comprising the expression cassette of A3) or a recombinant microorganism comprising the recombinant vector of A4);

[0043] A5) a recombinant microorganism comprising the gene of A2) or a recombinant microorganism comprising the expression cassette of A3) or a recombinant microorganism comprising the recombinant vector of A4);

[0044] A6) a plant cell, tissue or organ comprising the gene of A2) or a plant cell, tissue or organ comprising the expression cassette of A3) or a plant cell, tissue or organ comprising the recombinant vector of A4);

[0045] In certain embodiments, the product further comprises a cell membrane dye.

[0046] In certain embodiments, the cell membrane dye is selected from FM4-64.

[0047] In certain embodiments, the nucleic acid molecule is as set forth in SEQ ID NO: 2.

[0048] In certain embodiments, the backbone vector of the recombinant vector is a plant expression vector. The plant expression vector is pGREEN II-0229 vector.

[0049] In another aspect the present invention provides a method for facilitating membrane protein internalization of PIN1 protein in a subject plant, said method comprising the step of administering the SPc described above or a pharmaceutically acceptable salt thereof or the nanomaterial to the subject plant.

[0050] In certain embodiments, the subject plant is selected from a plant root.

[0051] In certain embodiments, the root is selected from a root tip meristem.

[0052] In certain embodiments, the root apical meristem is selected from procambium cells, vascular column cells, or any combination thereof.

[0053] In another aspect, the present application provides a method for determining the membrane protein internalization of membrane protein PIN1 in a subject plant, comprising the steps of:

[0054] 1) selecting a subject plant;

[0055] 2) applying the SPc or pharmaceutically acceptable salt or nanomaterial thereof of claim 1 to a wild type variety of the same species as the subject plant;

[0056] 3) at a specified time point, evaluating the membrane protein internalization of membrane protein PIN1 in the subject plant by comparing with a wild type variety of the same species as the subject plant treated with the SPc or pharmaceutically acceptable salt or nanomaterial thereof as a positive control.

[0057] In certain embodiments, the method further comprises evaluating the membrane protein internalization of membrane protein PIN1 by detecting the ratio of PIN1 protein content in cytoplasmic region to PIN1 protein content in cytoplasmic membrane region, and if the ratio of PIN1 protein content in cytoplasmic region to PIN1 protein content in cytoplasmic membrane region in the subject plant is close to or exceeds the ratio of PIN1 protein content in cytoplasmic region to PIN1 protein content in cytoplasmic membrane region in the wild type variety, the membrane protein internalization of membrane protein PIN1 in the subject plant is positive.

[0058] In certain embodiments, the subject plant and the wild type variety of the same species as the subject plant express PIN1 protein linked to a fluorescent protein.

[0059] In certain embodiments, the fluorescent protein is selected from yellow fluorescent protein, green fluorescent protein, red fluorescent protein, or any combination thereof.

[0060] In certain embodiments, the step 1) and step 2) are achieved by independent steps as described above, and the execution of the two steps does not require time-dependent relationship.

[0061] In another aspect, the present application provides a method for screening a membrane protein internalization agent of membrane protein PIN1, comprising the steps of:

[0062] 1) applying a candidate agent to a subject plant;

[0063] 2) repeating the operation of step 1) using the SPc or pharmaceutically acceptable salt or nanomaterial thereof as described above;

[0064] 3) at a designated time point, evaluate whether the candidate agent can serve as a membrane protein PIN1 membrane protein internalization agent by comparing with the positive control group in terms of membrane protein internalization of membrane protein PIN1 using the test plant treated with the SPc or its pharmaceutically acceptable salt or nanomaterial as the positive control group.

[0065] In certain embodiments, the method further comprises evaluating the membrane protein internalization effect of membrane protein PIN1 by detecting the ratio of PIN1 protein content in the cytoplasmic region to that in the cytomembrane region, and if the membrane protein internalization effect of membrane protein PIN1 by the candidate agent is close to or exceeds that by the above-mentioned SPc, the candidate agent can be used as a membrane protein internalization agent for membrane protein PIN1.

[0066] In certain embodiments, the step 1) and step 2) are achieved by independent steps in the above-mentioned, and the execution of the two does not require time-dependent relationship.

[0067] In certain embodiments, the administration mode is seed soaking, seed drenching, root soaking, foliar spraying, spraying, composting, coating, field flooding, drip irrigation of plant or plant organ, smearing of plant or plant organ, dripping of plant or plant organ, or any combination thereof.

[0068] In certain embodiments, the administration concentration of the SPc or its pharmaceutically acceptable salt is 5-100 mg / L -1 .

[0069] In certain embodiments, the administration concentration of the SPc is 25 mg / L -1

[0070] In certain embodiments, the test plant is selected from roots.

[0071] In certain embodiments, the plant is selected from seedling stage. In certain embodiments, the use as described in any one of the above, the product as described above, the method as described above, the test plant is selected from any one of the following;

[0072] (1) Brassicaceae plants;

[0073] (2) Arabidopsis plants;

[0074] (3) Arabidopsis, Brassica, radish, cabbage, or any combination thereof.

[0075] (4) (1)-(3).

[0076] Beneficial effects

[0077] Nanoparticles (NPs) have been shown to affect auxin synthesis, transport and metabolism. Here, we found that star poly cation (SPc) (as shown in formula 1) reduced auxin efflux to the root tip by blocking PIN-FORMED 1 (PIN1) transport, which exhibited obvious PIN1 endocytosis. Auxin coordinates the initiation of plant organs, and cell-to-cell transport plays a central role in forming local auxin maxima and gradients. Auxin is a key plant hormone that regulates root growth and architecture through localized synthesis and directional intercellular transport. PINs proteins contain 10 transmembrane helices and a large (320-360 amino acid) cytoplasmic loop with multiple phosphorylation sites, which are essential for activity, polar auxin transport through the cytoplasmic TIR 1 / AFB pathway rapidly activates H+influx-mediated root growth inhibition. In contrast, TMK 1 directly binds and activates the plasma membrane H+-ATPase on the cell surface, antagonizes the apoplast alkalinization, regulates root system growth, according to the core premise of the acid growth theory that auxin stimulates the plasma membrane H+-ATPase, leading to proton efflux, enhanced proton efflux reduces the apoplast pH, activates the cell wall loosening enzymes. Nanoparticles (NPs) have been shown to affect auxin synthesis, transport and metabolism. Here, we found that star poly cation (SPc) (as shown in formula 1) reduced auxin efflux to the root tip by blocking PIN-FORMED 1 (PIN1) transport, which exhibited obvious PIN1 endocytosis.

[0078] The application discloses a kind of nano materials specially promoting PIN1 endocytosis, can specially promote PIN1 protein from cytoplasmic membrane region into cytoplasm region. Specifically disclosed the structure (formula (I)) of SPc and the use of SPc or its pharmaceutically acceptable salt in promoting the membrane protein internalization of PIN1 protein of subject plant, apply SPc to arabidopsis thaliana can promote PIN1 protein in arabidopsis thaliana root from cytoplasmic membrane region into cytoplasm region. It can be used as the positive inducer of PIN1 protein endocytosis related metabolic pathway research, it can be used for industrial production. BRIEF DESCRIPTION OF DRAWINGS

[0079] Figure 1 Green fluorescent protein distribution chart for arabidopsis thaliana root. DETAILED DESCRIPTION

[0080] The application will be further described in detail below in conjunction with specific embodiments, and the examples given are only for illustrating the application, not for limiting the scope of the application. The examples provided below can be used as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the application.

[0081] The experimental methods in the following examples are routine methods, and are performed according to the techniques or conditions described in the literature in the art or according to the instructions of the products, unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available, unless otherwise specified.

[0082] In the present application, the scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art, unless otherwise indicated. Also, the terms and experimental procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology used herein are terms and procedures widely used in the corresponding fields. Meanwhile, for better understanding of the present application, the definitions and explanations of the related terms are provided as follows.

[0083] The terms "comprising", "comprises" and "comprised of" as used herein are synonymous with "including", "includes" or "containing", "contains", and are inclusive or open-ended and do not exclude additional, unrecited members, elements or method steps. The terms "comprising", "comprises" and "comprised of" also include the term "consisting of".

[0084] The terms "optionally", "optional" or "optional" as used herein generally mean that the recited event or circumstance can or can not occur, and that the description includes situations where the event or circumstance occurs, and situations where it does not.

[0085] The terms "first", "second" as used herein are only for the purpose of description, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined with "first", "second" can explicitly or implicitly include one or more of the features. Further, in the description of the present application, the meaning of "a plurality of" is two or more, unless otherwise specified.

[0086] As used herein, the term "expression cassette" refers to DNA capable of expressing a protein or nucleic acid of interest in a host cell. The expression cassette can also include single or double stranded nucleic acid molecules of all the regulatory sequences necessary for expression of any of the above-mentioned proteins from the nucleic acid molecule. The regulatory sequences direct the expression of the coding sequence in a suitable host cell under compatible conditions. The regulatory sequences include, but are not limited to, a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal sequence, and a transcription terminator. At a minimum, the regulatory sequences include a promoter and transcriptional and translational stop signals. The regulatory sequences can be provided with linkers for the purpose of attachment to the coding region of the nucleic acid sequence encoding the protein. The regulatory sequences can be a suitable promoter sequence, i.e., a nucleic acid sequence that controls the transcription of the nucleic acid sequences, which are being expressed. The promoter sequence contains transcriptional control sequences that mediate the transcription of the protein. The promoter can be any nucleic acid sequence that shows transcriptional activity in the host cell of choice including mutated, truncated, and hybrid promoters, and can be derived from genes encoding proteins either homologous or heterologous to the host cell. The regulatory sequences can also be a suitable transcriptional terminator sequence, i.e., a sequence at the end of the nucleic acid sequence encoding the protein that signals the termination of transcription. The terminator sequence is operably linked to the 3' terminus of the nucleic acid sequence encoding the protein. Any terminator that is functional in the host cell of choice can be used in the present application. The regulatory sequences can also be a suitable leader sequence, i.e., an mRNA in the untranslated region that is vital for translation of the host cell. The leader sequence is operably linked to the 5' terminus of the nucleic acid sequence encoding the protein. Any leader sequence that is functional in the host cell of choice can be used in the present application. The regulatory sequences can also be a signal peptide coding region, a region encoding an amino acid sequence that can be linked to the amino terminus of the protein and direct it into the secretory pathway of the cell. Any signal peptide coding region that is functional in the host cell of choice can be used in the present application. It can also be desirable to add regulatory sequences that allow the regulation of the expression of the protein relative to the growth of the host cell. Examples of regulatory systems are those that allow for expression of the protein only under certain forms of stress or chemical or physical stimuli, including in the presence of a regulatory compound. Other examples of regulatory sequences are those that allow for amplification of the gene. In these cases, the nucleic acid sequence encoding the protein is operably linked to the regulatory sequence.

[0087] The term "vector" as used herein generally refers to a vehicle capable of carrying foreign DNA or a gene of interest into a host cell for amplification and / or expression, which can be a cloning vector or an expression vector. The vector can be introduced into a host cell by transformation, transduction or transfection, so that the genetic material elements carried by the vector are amplified and / or expressed in the host cell. A person skilled in the art can select a suitable vector according to the purpose of genetic engineering and the nature of the recipient cell. The vector includes but is not limited to: plasmid, phage (such as lambda phage or M13 phage), cosmid (i.e. cos plasmid), phagemid, shuttle vector (such as yeast expression vector), Ti plasmid, artificial chromosome (such as yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC), P1 artificial chromosome (PAC) or Ti plasmid artificial chromosome (TAC)), viral vector (such as baculovirus vector, retrovirus (including lentivirus), adenovirus, adeno-associated virus, poxvirus, papillomavirus, papovavirus (such as SV40), herpesvirus (such as herpes simplex virus)). A vector can contain multiple elements for controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements and reporter genes. In addition, the vector can also contain a replication initiation site.

[0088] The term "microorganism" generally includes bacteria, viruses, fungi, actinomycetes, rickettsia, mycoplasma, chlamydia, spirochetes, algae, and the like. For example, the bacteria can be from Escherichia sp. (e.g., E. coli), Erwinia sp., Agrobacterium sp. (e.g., A. tumefaciens), Flavobacterium sp., Alcaligenes sp., Pseudomonas sp., and Bacillus sp. (e.g., B. subtilis), and the like. The viruses can include rotavirus, baculovirus, retrovirus (e.g., lentivirus), adenovirus, adeno-associated virus, poxvirus, papillomavirus, influenza virus, papovavirus (e.g., SV40), and herpesvirus (e.g., herpes simplex virus), and the like. The fungi can be from Saccharomyces sp. (e.g., S. cerevisiae, S. pombe, Pichia), Fusarium sp., Rhizoctonia sp., Verticillium sp., Penicillium sp., Aspergillus sp., and Cephalosporium sp., and the like. The actinomycetes can be from Streptomyces sp. (e.g., S. coelicolor). The algae can be from Cyanophyta (e.g., Cyanobacteria), Fucus sp., Achnanthes sp., Amphiprora sp., Amphora sp., Ankistrodesmus sp., Asteromonas sp., and Boekelovia sp., and the like.

[0089] The term "recombinant vector" as used herein generally refers to a recombinant DNA molecule constructed by in vitro joining of a foreign gene of interest to a vector, which can be constructed in any suitable manner, as long as the constructed recombinant vector can carry the foreign gene of interest into a recipient cell and provide the foreign gene of interest with the ability to replicate, integrate, amplify, and / or express in the recipient cell.

[0090] The term "recombinant microorganism" as used herein generally refers to a recombinant microorganism obtained by manipulating and modifying the genes of a microorganism of interest, so that the function of the recombinant microorganism is changed. For example, a foreign gene of interest or a recombinant vector is introduced into a microorganism of interest, or the endogenous genes of a microorganism of interest are directly genetically edited.

[0091] The term "recombinant host cell" as used herein generally refers to a host cell whose genome has been manipulated and modified so that the recombinant host cell has a changed function. For example, a foreign gene of interest or a recombinant vector is introduced into the host cell, or the endogenous gene of the host cell is directly genetically edited.

[0092] The following examples use SPSS 11.5 statistical software to process data, and the experimental results are expressed as mean ± standard deviation. One-way ANOVA test is used, P<0.05 (*) indicates significant difference, P<0.01 (**) indicates extremely significant difference, and P<0.001 (***) indicates extremely significant difference.

[0093] The PIN1: : PIN1-GFP vector, PIN2: : PIN2-GFP vector and PIN3: : PIN3-GFP vector in the present application can be obtained from the laboratory of Professor Zhou Yiyi of China Agricultural University for repeating the experiment, and cannot be used for other purposes.

[0094] Example 1 Preparation and synthesis of SPc

[0095] The homozygous powder of SPc was obtained from the research group of Professor Shen Jie of China Agricultural University. SPc is a star initiator Pt-Br synthesized from pentaerythritol, and then the star initiator is polymerized with DMAEMA to obtain the homozygous powder of SPc. Subsequently, the homozygous powder of SPc is dissolved in ddH2O, and the structure of SPc is confirmed by 1H nuclear magnetic resonance (1H NMR), and the molecular weight thereof is analyzed by gel permeation chromatography (GPC). The specific preparation method of the homozygous powder of SPc is shown in the following patent: "Patent name: Star polymer and its preparation method and application, application number: 2018103505627, application date: 2018-11-13", application publication number: CN108794710A.

[0096] The structure of SPc is shown in formula 1, and formula 1 is as follows:

[0097]

[0098] The present application provides a preparation method of a nano material: adding the homozygous powder of SPc into water to form a nano material by self-assembly of SPc in water.

[0099] The present application also provides a preparation method of a nano material: adding the homozygous powder of SPc into water to form a nano material by self-assembly of SPc in water. -1 , so that SPc self-assembles in water to form a nano material.

[0100] The application also provides a preparation method of the nanomaterial: adding the SPc pure powder into the 1 / 2MS medium to make the concentration of the SPc reach 25 mg / L -1 and making the SPc self-assemble into the nanomaterial in the 1 / 2MS medium.

[0101] The application also provides a preparation method of the nanomaterial: adding the SPc pure powder into the 1 / 2MS medium to make the concentration of the SPc reach 25 mg / L -1 and making the SPc self-assemble into the nanomaterial in the 1 / 2MS medium, and then performing high-temperature treatment at 121 ℃ for 20 min to obtain the nanomaterial.

[0102] The application also provides a preparation method of the nanomaterial: adding the SPc pure powder into the 1 / 2MS medium containing 2 g / 100 ml agarose to make the concentration of the SPc reach 25 mg / L -1 and making the SPc self-assemble into the nanomaterial in the 1 / 2MS medium, and then performing high-temperature treatment at 121 ℃ for 20 min to obtain the nanomaterial.

[0103] Example 2: Effect of SPc on PIN1 protein endocytosis

[0104] Plant material and growth:

[0105] The Arabidopsis thaliana transgenic lines PIN1::PIN1-GFP, PIN2::PIN2-GFP and PIN3::PIN3-GFP provided by Professor J. Zhang (China Agricultural University, China) were used to examine auxin and PIN accumulation.

[0106] Construction of the PIN1::PIN1-GFP vector:

[0107] The PIN1::PIN1-GFP vector was constructed by inserting the PIN1::PIN1:GFP nucleic acid sequence between the promoter and the NOS terminator in the pGREENII-0229 vector (SEQ ID NO: 3) so that the PIN1::PIN1:GFP nucleic acid sequence can be correctly initiated by the PIN1 promoter and terminated by the NOS terminator. https: / / doi.org / 10.1016 / S0092-8674(03)00924-3

[0108] The PIN1::PIN1:GFP nucleic acid sequence is a nucleic acid sequence obtained by inserting the GFP gene (SEQ ID NO: 2) into the PIN1 gene through the PflMI enzyme cutting site at position 1510-1520 of the PIN1 gene, and ensuring that the GFP gene can be correctly expressed.

[0109] SEQ ID NO: 1:

[0110]

[0111] SEQ ID NO: 2:

[0112] ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCAAGATACCCAGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAG.

[0113] SEQ ID NO: 3:

[0114]

[0115] Construction of PIN2::PIN2-GFP vector:

[0116] The PIN2::PIN2-GFP vector is constructed by inserting the PIN2::PIN2:GFP nucleic acid sequence into the pGREENII-0229 vector (SEQ ID NO: 3) between the promoter fragment and the NOS terminator, so that the PIN2::PIN2:GFP nucleic acid sequence can be correctly initiated by the PIN2 promoter and terminated by the NOS terminator.

[0117] The PIN2::PIN2:GFP nucleic acid sequence is a nucleic acid sequence obtained by inserting a GFP gene (SEQ ID NO: 2) into a PIN2 gene through a BciV I enzyme cutting site at position 2312-2317 of the PIN2 gene (SEQ ID NO: 4), and ensuring that the GFP gene can be correctly expressed.

[0118] SEQ ID NO: 4:

[0119]

[0120] PIN3::PIN3-GFP vector construction:

[0121] PIN3::PIN3-GFP vector was constructed by inserting PIN3::PIN3:GFP nucleic acid sequence between the promoter and NOS terminator in pGREENII-0229 vector (SEQ ID NO: 3) to enable the PIN13::PIN3:GFP nucleic acid sequence to be properly initiated by the PIN3 promoter and terminated by the NOS terminator. https: / / doi.org / 10.1242 / dev.041277.

[0122] PIN3::PIN3:GFP nucleic acid sequence is a nucleic acid sequence obtained by inserting a GFP gene (SEQ ID NO: 2) into a PIN3 gene through an XmaI enzyme cutting site of the PIN3 gene (SEQ ID NO: 5) to ensure that the GFP gene can be properly expressed. The GFP gene is inserted into the end of the first exon of the PIN3 gene. https: / / doi.org / 10.1242 / dev.041277.

[0123] SEQ ID NO: 5:

[0124]

[0125] The PIN1: : PIN1-GFP vector, PIN2: : PIN2-GFP vector, and PIN3: : PIN3-GFP vector were respectively transformed into Arabidopsis (Col-0), and self-crossed to obtain pure stable expression lines, namely Col-0 / PIN1: : PIN1-GFP, Col-0 / PIN2: : PIN2-GFP, and Col-0 / PIN3: : PIN3-GFP, Col-0. Col-0 / PIN1: : PIN1-GFP is Col-0 containing PIN1: : PIN1-GFP and stably expressing PIN1-GFP. Col-0 / PIN2: : PIN2-GFP is Col-0 containing PIN2: : PIN2-GFP and stably expressing PIN2-GFP. Col-0 / PIN3: : PIN3-GFP is Col-0 containing PIN3: : PIN3-GFP and stably expressing PIN3-GFP.

[0126] Preparation of culture medium:

[0127] 1 / 2MS solid medium containing 25 mg L -1 Spc: in 1L ddH2O, add Spc to make its content 25 mg L -1 , add agarose to make its content 2 g / 100 ml, add MS salt to make its content 1 ×, sterilize at 121 ℃ for 20 min. After cooling, 1 / 2MS solid medium containing 25 mg L -1 Spc is obtained.

[0128] 1 / 2MS solid medium: in 1L ddH2O, add MS salt to make its content 1 ×, sterilize at 121 ℃ for 20 min. After cooling, 1 / 2MS solid medium is obtained.

[0129] The experiment was divided into two groups, namely the control group and the experimental group. Each group contained 25 Arabidopsis seeds. The control group and the experimental group of Arabidopsis seeds (Col-0 / PIN1: : PIN1-GFP, Col-0 / PIN2: : PIN2-GFP, and Col-0 / PIN3: : PIN3-GFP) were surface sterilized and vertically grown in 1 / 2MS solid medium and 1 / 2MS solid medium containing 25 mg L -1 Spc under the conditions of 16 hours of light / 8 hours of darkness, 22 ℃, and 60% humidity for 6 days. Fluorescence detection (including intracellular signal and plasma membrane signal) was performed, and photographs were taken for record. The intracellular / plasma membrane signal ratio was detected and calculated.

[0130] Intracellular / plasma membrane signal ratio = intracellular fluorescence signal intensity / plasma membrane fluorescence signal intensity.

[0131] Microscopy imaging:

[0132] The above cultured Arabidopsis were observed by fluorescence microscopy. Before imaging by confocal microscopy (Zeiss LSM 900, Germany), seedlings were stained with 10 mg / L FM4-64 for 1 min. GFP was excited at 488 nm (detected at 505-560 nm), and FM4-64 was observed with a 40x oil lens (excited at 505 nm, emitted at 725 nm). Fluorescence intensity was quantified in ImageJ.

[0133] Statistical analysis

[0134] Data were analyzed using SPSS Statistics 22.0 (SPSS Inc., USA) and plotted in GraphPad Prism 8.0 (GraphPad Software). Statistical significance was analyzed using one-way ANOVA and Dunnett’s multiple range test or independent t-test, with p < 0.05 considered significant. Data are presented as mean ± SE.

[0135] The results showed that we tracked PIN1, PIN2, and PIN3 fused with GFP. In control roots, PIN1 localized to the basal plasma membrane of vascular cells, pointing toward the root tip. However, under SPc treatment, PIN1-GFP showed reduced signals in the basal membrane and obvious intracellular accumulation, resulting in a significantly higher intracellular / plasma membrane (PM) signal ratio, indicating PIN1 endocytosis Figure 1 a, b are the results of Col-0 / PIN1: :PIN1-GFP experiment, control is the control group, SPc is the experimental group, and b is the intracellular / PM signal ratio. This endocytosis prevents the flow of auxin from the upper root region to the tip, thereby reducing the tip auxin level. Under SPc treatment, the intracellular / PM ratio of PIN2 and PIN3 did not show significant changes Figure 1 c-f, Figure 1 c, d are the results of Col-0 / PIN2: :PIN2-GFP experiment, Figure 1e, f are the results of Col-0 / PIN3: :PIN3-GFP experiment; wherein, control is the control group, SPc is the experimental group, the bar graphs d, f are intracellular / PM signal ratio, which indicates that only PIN1 is specifically targeted by SPc. In summary, SPc induces a massive endocytosis and PIN1 is specifically enhanced among the PIN family. The results of the present application show that SPc limits the transport of auxin to the root tip by specifically triggering PIN1 endocytosis. PIN1 is expressed in the vascular bundle, directing the flow of auxin to the root tip; PIN2 is expressed at the root tip, directing the flow of auxin to the stem; PIN3 is mainly located in the stele and the distal elongation zone, adjusting the flow of auxin in response to gravity.

[0136] The present application has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wide range of equivalent parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that the present application can be further improved. In summary, according to the principle of the present application, the present application intends to include any change, use or improvement of the present application, including the change made by the conventional technology known in the art, which is out of the range disclosed in the present application. Some basic features can be applied according to the scope of the following attached claims.

Claims

1. Use of SPc or a pharmaceutically acceptable salt thereof, or nanomaterials containing SPc or a pharmaceutically acceptable salt thereof, in promoting the internalization of membrane protein PIN1 in a test plant; The SPc is as shown in formula (I); The membrane protein PIN1 is any one of the following: B1) The amino acid sequence is that of the protein shown in SEQ ID NO:7; B2) A protein having more than 80% identity and the same function as the protein shown in B1) obtained by substituting and / or deleting and / or adding amino acid residues. B3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of B1) or B2); The nanomaterials are formed by the self-assembly of SPc and / or its pharmaceutically acceptable salts in solution.

2. The use as described in claim 1, characterized in that, The membrane protein is internalized as membrane protein PIN1 and transferred from the cytoplasmic membrane region to the cytoplasmic region.

3. A method for promoting the internalization of membrane protein PIN1 in test plants, characterized in that, The method includes the step of applying the SPc of claim 1 or a pharmaceutically acceptable salt or nanomaterial thereof to the test plant.

4. A method for determining the internalization of membrane protein PIN1 in a test plant, comprising the following steps: 1) Select the test plants; 2) Applying the SPc described in claim 1 or its pharmaceutically acceptable salt or nanomaterial to a wild-type variety of the same species as the test plant; 3) At specified time points, wild-type varieties treated with the SPc or its pharmaceutically acceptable salts or nanomaterials were used as positive controls to assess the membrane protein internalization of the test plant membrane protein PIN1 by comparison with the positive control.

5. The method according to claim 4, characterized in that, The method further includes assessing the membrane protein internalization effect of membrane protein PIN1 by detecting the ratio of PIN1 protein content in the cytoplasm region to PIN1 protein content in the cytoplasm membrane region. If the ratio of PIN1 protein content in the cytoplasm region to PIN1 protein content in the cytoplasm membrane region of the test plant is close to or the ratio of PIN1 protein content in the cytoplasm region to PIN1 protein content in the cytoplasm membrane region of the wild-type variety is close to, then the membrane protein internalization of membrane protein PIN1 in the test plant is positive.

6. The method according to any one of claims 3-5, characterized in that, The application methods are seed soaking, root soaking, foliar spraying, spraying, coating, drip irrigation of plants or plant organs, application to plants or plant organs, drip application to plants or plant organs, or any combination thereof.

7. The method according to any one of claims 4-6, characterized in that, The application concentration of the SPc or its pharmaceutically acceptable salt or nanomaterial is 5-100 mg / L. -1 .

8. The use as described in claim 1 or 2, or the method as described in any one of claims 3-7, characterized in that, The tested plants were selected from the roots.

9. The use as described in claim 1 or 2, or the method as described in any one of claims 3-8, characterized in that, The plants were selected from the seedling stage.

10. The use as described in claim 1 or 2, or the method as described in any one of claims 3-9, characterized in that... The test plant was selected from any of the following: (1) Brassicaceae plants; (2) Plants of the genus Arabidopsis; (3) Arabidopsis thaliana, rapeseed, radish, cabbage, or any combination thereof.

Images