Application of ginsenoside Ro in preparation of medicine for preventing and treating kidney stone

Abstract

The invention relates to application of ginsenoside Ro in preparation of a medicine for preventing and treating kidney stone, and belongs to the technical field of biological medicine. The invention discloses application of ginsenoside in preparation of a medicine for preventing and treating kidney stone. The invention discovers that the ginsenoside Ro has an improvement effect on calcium oxalate (CaOx) crystal deposition, adhesion, renal tubular cell injury and inflammation caused by an ethylene glycol-induced mouse urolithiasis model, and meanwhile, the effect of ZnT1 in renal tubular epithelial cell copper death caused by crystal injury and the copper death resisting effect and mechanism of the ginsenoside Ro are clarified. And a road is laid for novel medicines for treating urolithiasis.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, and particularly relates to application of ginsenoside Ro in preparation of medicine for preventing and treating kidney stones. BACKGROUND

[0002] Kidney stones are mineral deposits caused by urine supersaturation, which is a kidney disease with a global incidence of 14.8%. Although there are regional differences, the incidence is still rising in many countries. The recurrence rate within five years can reach 50%. Factors such as aging, obesity, diabetes, hypertension and metabolic syndrome can promote the formation of stones. In addition, patients with kidney stones also face the risk of hypertension, chronic kidney disease (CKD) and end-stage renal disease (ESRD). Therefore, prevention of stone formation and early intervention are crucial.

[0003] Calcium-based stones, mainly composed of calcium oxalate monohydrate (COM), account for more than 80% of kidney stones. Damage to uroepithelial cells, especially renal tubular epithelial cells, plays a key role in the formation of kidney stones. Excessive reactive oxygen species (ROS) and oxidative stress can induce inflammation of the renal tubule. Macrophages release ROS after phagocytosis of calcium oxalate crystals in urine, thereby promoting the formation of stones. In summary, oxidative stress is a key pathological mechanism of acute and chronic kidney disease caused by urolithiasis. In fact, antioxidants not only help to reduce crystal-induced toxicity, inflammation and subsequent cell death, but also inhibit the adhesion and deposition of crystals.

[0004] In kidney stone disease, oxidative stress and cell death, including apoptosis and necroptosis, occur in renal tubular epithelial cells. In recent years, copper death, a unique type of cell death, has received increasing attention. It involves the accumulation of copper leading to mitochondrial protein aggregation and Fe-S cluster protein instability, thereby triggering regulated cell death. Copper death exacerbates oxidative stress, damages cell defense, and is associated with diseases such as breast cancer and lung cancer. However, the mechanism of copper death in kidney stones has not been revealed.

[0005] In view of the role of oxidative stress, antioxidant therapy is crucial in prevention and treatment, but existing drugs lack specificity. Therefore, the development of effective and safe antioxidant drugs is essential to improve therapeutic efficacy. At present, natural antioxidants are attracting much attention due to their strong clinical efficacy and minimal or no side effects. Among them, the representative oleanane-type saponin ginsenoside Ro in Panax ginseng C. A. Mey. has various pharmacological activities, such as anti-inflammatory, hepatoprotective, anti-tumor, anti-platelet and neuroprotective effects. Ginsenoside Ro regulates cell death processes through anti-apoptotic and autophagy-inducing mechanisms, thereby exerting antioxidant, neuroprotective and anticancer effects. Ginsenoside Ro is a new type of autophagy inhibitor and is expected to become a potent anticancer drug when used in combination with chemotherapy to address the problem of chemotherapy resistance. However, further research and verification are still needed to elucidate the specific mechanisms and effects of ginsenoside Ro in the prevention and treatment of kidney stones. SUMMARY

[0006] The present application aims to overcome the deficiencies of the prior art and provide the use of ginsenoside Ro in the preparation of a drug for preventing and treating kidney stones.

[0007] To achieve the above-mentioned object, the technical scheme adopted by the present application is as follows: In a first aspect, the present application provides the use of ginsenoside in the preparation of a drug for preventing and treating kidney stones.

[0008] The present application found that ginsenoside can improve kidney stone-related symptoms by inhibiting the expression of zinc transporter ZnT1, thereby preventing and treating kidney stones.

[0009] Further, the ginsenoside includes ginsenoside Ro.

[0010] Further, the ginsenoside inhibits the expression of zinc transporter ZnT1.

[0011] Further, the drug reduces kidney crystal accumulation.

[0012] Further, the drug reduces kidney inflammatory infiltration.

[0013] Further, the drug reduces kidney cell oxidative damage.

[0014] Further, the kidney cell oxidative damage is caused by cellular copper death.

[0015] Further, the drug reduces kidney crystal adhesion.

[0016] Further, the drug reduces the expression of kidney cell adhesion-related proteins.

[0017] Further, the adhesion-related protein includes CD44 protein and / or osteopontin OPN.

[0018] Compared with the prior art, the present application has the following beneficial effects: The present application finds that ginsenoside Ro has an improving effect on the calcium oxalate (CaOx) crystal deposition, adhesion, renal tubular cell damage and inflammation caused by the ethylene glycol-induced mouse urolithiasis model, clarifies the role of ZnT1 in the renal tubular epithelial cell copper death caused by crystal damage, and the anti-copper death effect and mechanism of ginsenoside Ro, paving the way for a new type of therapeutic drug for urolithiasis. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Glyoxylic acid significantly reduced the damage to the kidney of ginsenoside Ro. Among them, A is the chemical structure of ginsenoside Ro; B is a schematic diagram of mouse experiment design; C is a representative micrograph of HE-stained kidney tissue; scale 100 μm; D is the concentration level of mouse serum urea nitrogen and serum creatinine, n=4, p<0.05, p<0.01, p<0.005, p<0.001; E is a representative micrograph of PAS-stained kidney tissue, scale, 50 μm; F is the renal tubular damage index score, which is evaluated according to the renal tubular dilation, loss of brush border and expansion of renal interstitial matrix, n=4; G is a photograph of kidney crystal deposition; H is kidney crystal deposition data; I is a photograph of immunohistochemistry of crystal adhesion marker protein OPN; J is a photograph of F4 / 80 immunofluorescence staining of kidney tissue, scale, 50 μm.

[0020] Figure 2To prove that ZnT1 is the target of ginsenoside Ro. Among them, A is the mRNA fold change of differentially expressed genes of RNA extracted from HK2 cells, two biological replicates in each group; B is the KEGG pathway enrichment analysis of differentially expressed genes (log2 FC>1, p value<0.05) according to the results of RNA-seq; C is the statistical results of differential gene analysis; D is the expression level of ZnT1 and HMOX1 in HK-2 cells treated with NaOx, ginsenoside Ro and NaOx co-treatment, GAPDH as the internal reference protein; E is the immunohistochemical staining image of ZnT1 in the kidney tissue, scale: 100 μm (top), scale: 20 μm (bottom); F is the electrophoretogram of ZnT1 in HK-2 cells treated with NaOx; G is the electrophoretogram of ZnT1 in HK-2 cells co-treated with ginsenoside Ro and NaOx; H is the immunofluorescence (IF) staining image of HK-2 cells treated with NaOx, ginsenoside Ro and NaOx co-treatment.

[0021] Figure 3 To prove that ZnT1 is the target of ginsenoside Ro. Among them, A is the mRNA fold change of differentially expressed genes of RNA extracted from HK2 cells, two biological replicates in each group; B is the KEGG pathway enrichment analysis of differentially expressed genes (log2 FC>1, p value<0.05) according to the results of RNA-seq; C is the statistical results of differential gene analysis; D is the expression level of ZnT1 and HMOX1 in HK-2 cells treated with NaOx, ginsenoside Ro and NaOx co-treatment, GAPDH as the internal reference protein; E is the immunohistochemical staining image of ZnT1 in the kidney tissue, scale: 100 μm (top), scale: 20 μm (bottom); F is the electrophoretogram of ZnT1 in HK-2 cells treated with NaOx; G is the electrophoretogram of ZnT1 in HK-2 cells co-treated with ginsenoside Ro and NaOx; H is the immunofluorescence (IF) staining image of HK-2 cells treated with NaOx, ginsenoside Ro and NaOx co-treatment.

[0022] Figure 4Figure 1 shows the interaction of ginsenoside Ro with ZnT1. A, ZnT1 protein map (PDB code: 8J2G); B, map of specific binding functional groups when ginsenoside Ro docks with ZnT1; C, interaction diagram of ginsenoside Ro with ZnT1 in three dimensions, ginsenoside Ro is red; D, three-dimensional diagram of specific binding positions when ginsenoside Ro docks with ZnT1, ginsenoside Ro is colored by atom type: carbon (blue), oxygen (red), for clarity, only the residues involved in the interaction are labeled, hydrogen bond interactions are indicated by dashed lines, the figure was created by PyMOL software; E, root mean square deviation (RMSD) of ZnT1 interacting with ginsenoside Ro; F, root mean square fluctuation (RMSF) of ZnT1 interacting with ginsenoside Ro; G, the interaction of ginsenoside Ro with recombinant ZnT1 protein in HK2 cells was evaluated by BLI; H, the binding affinity (Kd) of ginsenoside Ro with ZnT1 was determined by increasing the concentration of ginsenoside Ro; I, the results of ZnT1 cell thermal shift analysis (CETSA) detection under different temperature gradients in HK2 cells.

[0023] Figure 5 Figure 2 shows that ZnT1 mediates the protective effect of ginsenoside Ro on oxidative damage caused by high oxalate. A, the knockdown efficiency of ZnT1 in ZnT1 sg01 cells, GAPDH as the internal reference protein; B, the expression of ZnT1 in OE-ZnT1 cells; C, the survival rate of ZnT1 sg01 cells after NaOx treatment; D, the survival rate of OE-ZnT1 cells after NaOx treatment; E, Calcein / PI staining image of OE-ZnT1 cells co-treated with ginsenoside Ro and NaOx, scale bar: 150 μm; F, the survival rate of OE-ZnT1 cells co-treated with ginsenoside Ro and NaOx, n = 7; G, the expression levels of ZnT1, CD44 and OPN proteins in OE-ZnT1 cells co-treated with ginsenoside Ro and NaOx, GAPDH as the internal reference protein; H, the ROS detection results of OE-ZnT1 cells co-treated with ginsenoside Ro and NaOx, scale bar: 275 μm.

[0024] Figure 6To inhibit the expression of ZnT1 in the process of copper death, thereby delaying the oxidative stress injury of NaOx-induced copper death. Among them, A is to observe the expression of DLAT using a laser scanning confocal microscope, and the nucleus is labeled with DAPI, the scale bar: 10 μm; B is the expression of copper death-related proteins FDX1 and HSP70 after NaOx stimulation, GAPDH as the internal reference protein; C is the level of mtROS in HK2 cells treated with NaOx; D is the copper concentration (μmol / g protein) in HK2 cells treated with NaOx; E is the level of mtROS in HK2 cells treated with NaOx and TTM; F is the copper concentration (μmol / g protein) in HK2 cells treated with NaOx and TTM; G is the cell viability of HK2 cells treated with NaOx and TTM, n=6; H is the immunohistochemical staining result of FDX1 in mouse kidney, scale bar: 50 μm; I is the expression of copper death-related proteins FDX1 and HSP70 after NaOx and ginsenoside Ro treatment, GAPDH as the internal reference protein; J is the mitochondrial membrane potential detected by JC-1, scale bar: 75 μm; K is the copper concentration (μmol / g prot) in OE-ZnT1 cells, n=3; L is the expression of DLAT1 in OE-ZnT1 cells detected by immunofluorescence, scale bar: 50 μm; M is to detect the expression of copper death-related proteins FDX1 and HSP70, and CD44 and OPN in OE-ZnT1 cells co-treated with ginsenoside Ro, NaOx and TTM, GAPDH as the internal reference protein; N is the relative glutathione expression level (%) of OE-ZnT1 cells, n=3; O is the cell viability of OE-ZnT1 cells co-treated with ginsenoside Ro, NaOx and TTM for 12 h, n=6. DETAILED DESCRIPTION

[0025] To better illustrate the purpose, technical scheme and advantages of the present application, the present application will be further described below in conjunction with specific examples. Unless otherwise specified, other materials, reagents, etc. used in the examples can be obtained from commercial channels.

[0026] Example 1 Ginsenoside Ro significantly reduces the accumulation of kidney crystals and inflammatory infiltration in oxalate mice I. Experimental methods The chemical structure of ginsenoside Ro is shown in Figure 1 A. In order to evaluate the effect of ginsenoside Ro on crystalline kidney injury, mouse experiments were performed ( Figure 1B). 8-week-old male C57BL / 6 mice were divided into 6 groups (4 mice in each group), which were control group (Control), ginsenoside Ro group (50 mg / kg / day) (Ro-H), Gly-induced kidney stone group (Gly), Gly + sodium citrate group (50 mg / kg / day) (Gly + CA group), Gly + ginsenoside Ro group (25 mg / kg / day) (Gly + Ro-L group) and Gly + ginsenoside Ro group (50 mg / kg / day) (Gly + Ro-H group). The experimental mice were intraperitoneally injected with different doses of ginsenoside Ro (25 mg / kg or 50 mg / kg) for 2 days, and the mice were intraperitoneally injected with 70 mg / kg of glyoxylic acid (Gly) for 7 days, with an injection volume of 100 μL, to establish a mouse model of glyoxylic acid-induced kidney calcium oxalate (CaOx) crystal deposition; at the same time, ginsenoside Ro (25 mg / kg or 50 mg / kg) was given for treatment, with an injection volume of 200 μL. An equal volume of 50 mg / kg sodium citrate (CA) was used as a positive control, and normal saline was used as a negative control.

[0027] The kidneys of the mice after the experiment were collected, paraffin sections of the kidneys were prepared, and hematoxylin-eosin (HE) staining, periodic acid-schiff (PAS) staining and TUNEL detection were performed, and the levels of serum urea nitrogen (UREA) and serum creatinine (SCr) of the mice were detected.

[0028] After the paraffin sections of the kidneys were deparaffinized, deparaffinized kidney sections were obtained, and hematoxylin staining was performed: the deparaffinized kidney sections were immersed in hematoxylin staining solution for 10 min, and the nucleic acid components were blue. Then differentiation (1% v / v hydrochloric acid alcohol) and re-blue (water rinse) treatments were performed to obtain hematoxylin-stained sections. Eosin staining was then performed: the hematoxylin-stained sections were immersed in eosin solution for 3 min, and the protein components were red, to obtain sections immersed in eosin solution. The sections immersed in eosin solution were sequentially immersed in 75% (v / v) and anhydrous alcohol for 3 min each time, dehydrated, to obtain dehydrated sections. The dehydrated sections were xylene transparent (2 times of xylene, each time for 5 min) and mounted with neutral resin to obtain hematoxylin-eosin-stained sections.

[0029] Fresh and dried kidney sections were fixed with 5% (v / v) ethanol for 10 min, rinsed with distilled water, and dried to obtain ethanol-fixed sections. The ethanol-fixed sections were oxidized with 10 g / L periodic acid for 15-20 min, rinsed with distilled water, and dried to obtain periodic acid-oxidized sections. The periodic acid-oxidized sections were stained with Schiff's reagent at room temperature for 60 min to obtain sections treated with Schiff's reagent. The sections treated with Schiff's reagent were rinsed with sulfurous acid solution for 3 times, and then rinsed with tap water for 3 min, and dried to obtain sections treated with sulfurous acid solution. The sections treated with sulfurous acid solution were counterstained with 20 g / L methyl green for 20 min, washed with water, and dried for microscopic examination.

[0030] Polarized light microscopy was used to observe the crystal deposition in the kidney of mice after the experiment of Example 1.

[0031] Immunohistochemistry (IHC) analysis of the crystal adhesion marker protein OPN (osteopontin) in the kidney tissue of mice was performed.

[0032] Immunofluorescence staining of macrophages F4 / 80 in the kidney tissue of mice was performed.

[0033] II. Experimental results HE staining results and UREA and SCr level analysis showed that glyoxylic acid induced kidney dysfunction and tubular injury (A and B). Figure 1 C and Figure 1 D). However, ginsenoside Ro significantly reduced these structural damages and improved the decline of kidney function (C and D). PAS staining showed that ginsenoside Ro reduced the inflammatory damage of the kidney induced by glyoxylic acid in a dose-dependent manner (E and F). Figure 1 Figure 1 E and Figure 1 F). Figure 1

[0034] Excessive reactive oxygen species (ROS) production induced oxidative stress damage is involved in the initiation and progression of kidney stone disease. Ginsenoside Ro has good antioxidant activity and may have a therapeutic effect on kidney stone disease. Polarized light microscopy observation results showed that with the increase of the concentration of ginsenoside Ro, the crystal deposition was significantly reduced (G and H). Figure 1 Figure 1 H).

[0035] Immunohistochemistry (IHC) analysis of the crystal adhesion marker protein OPN showed that ginsenoside Ro significantly inhibited the increase of crystal adhesion induced by glyoxylic acid (I). Figure 1

[0036] In addition, kidney stones are often accompanied by inflammation, and inhibiting the release of inflammatory mediators and the infiltration of inflammatory cells can reduce kidney inflammation and thus protect the kidney from further damage. Therefore, the inflammatory infiltration was evaluated. The results of immunofluorescence staining of kidney tissue macrophages after F4 / 80 labeling showed that the inflammatory infiltration of mice in the glyoxylic acid group was significantly enhanced, and ginsenoside Ro inhibited the inflammatory infiltration of the kidney induced by glyoxylic acid in a dose-dependent manner (J). Figure 1

[0037] Example 2 Ginsenoside Ro reduces calcium oxalate monohydrate (COM) induced oxidative damage and crystal adhesion in HK2 I. Experimental methods ​​​​​To further understand the protective mechanism of ginsenoside Ro in the crystal-induced kidney injury, the immortalized human proximal tubular epithelial cell line HK-2 was used as an in vitro model to observe the crystal adhesion and oxidative damage of HK-2 cells stimulated by COM.

[0038] Preparation of COM: 21.81 g of tris(hydroxymethyl)aminomethane (Tris) and 1.168 g of NaCl were dissolved in 2 L of ddH2O to prepare a Tris buffer solution (pH 7.40). 0.5 mM of Na2C2O4 (0.067 g) was dissolved in 1 L of Tris buffer to obtain a Na2C2O4 solution; 5 mM of CaCl2 (0.277 g) was dissolved in 1 L of buffer to obtain a CaCl2 solution; the Na2C2O4 solution and the CaCl2 solution were mixed at a volume ratio of 1:1, and left to stand at room temperature for 24 h to precipitate crystals, centrifuged at 2000 g for 10 min to collect the COM crystals, washed with methanol for 3 times, dried under ultraviolet light, suspended in sterile PBS to obtain a COM crystal suspension of 1 mg / mL, which was stored as a stock solution at 4°C, and the working concentration of COM for the crystal adhesion experiment was 100 μg / mL.

[0039] Crystal adhesion experiment: HK-2 cells were plated in a 12-well plate, and after 12 h, the cell confluence rate reached 80% the next day. The HK-2 cells were washed with sterile PBS buffer, and COM crystal suspension (prepared with 1640 basal medium) was evenly added to the surface of the HK-2 cells to make the final concentration 100 μg / mL, and then incubated in a 5% CO2 incubator at 37°C for 30 min to obtain COM-incubated HK-2 cells. The COM-incubated HK-2 cells were washed with PBS 5 times to remove the unattached COM crystals, and the COM crystals attached to the cells were photographed and counted under a microscope to obtain COM-stimulated HK-2 cells.

[0040] COM-stimulated HK-2 cells were seeded in a 12-well plate, and after 12 h, they were treated with ginsenoside Ro (0, 10, 20, and 40 μM) for 24 h, and then treated with MTS (5-[3-(carboxymethoxy)phenyl]-3-(4,5-dimethyl-2-thiazolyl)-2-(4-sulfophenyl)-2H-tetrazolium inner salt) for 2 h, and the OD value of the cells was detected at 490 nm.

[0041] COM-stimulated HK-2 cells were seeded in a 12-well plate, and after 12 h, they were pretreated with ginsenoside Ro (0, 10, 20, and 40 μM) for 2 h, and then treated with sodium oxalate (NaOx, 1 mM) for 24 h to obtain COM-stimulated HK-2 cells co-treated with ginsenoside Ro and NaOx. MTS experiment was performed to detect the OD value of the cells.

[0042] Calcein / PI staining: COM-stimulated HK-2 cells were seeded in 12-well plates, and 12 h later, they were pretreated with ginsenoside Ro (0, 10, 20, and 40 μΜ) for 2 h, followed by treatment with NaOx (1 mM) for 24 h to obtain COM-stimulated HK-2 cells co-treated with ginsenoside Ro and NaOx. Calcein and PI were added to the wells containing COM-stimulated HK-2 cells co-treated with ginsenoside Ro and NaOx to a final concentration of 0.1% (v / v) for each. After incubation at 37 °C in the dark for 1 h in a cell incubator, the cells were observed and recorded under a fluorescence microscope.

[0043] DCFH-DA fluorescence staining: DCFH-DA probe was added to the wells containing COM-stimulated HK-2 cells co-treated with ginsenoside Ro and NaOx to a final concentration of 0.1% (v / v). After incubation at 37 °C in the dark for 1 h in a cell incubator, the cells were observed and recorded under a fluorescence microscope.

[0044] According to the guidelines provided by the manufacturer of Mitochondrial Superoxide Fluorometric, the cell mitochondrial reactive oxygen species (mtROS) in COM-stimulated HK-2 cells co-treated with ginsenoside Ro and NaOx was detected using a CytoFLEX S flow cytometer. After RIPA lysis of the cells, the BCA protein concentration was detected according to the instructions of the Biyun Tian Superoxide Dismutase (SOD) Assay Kit (S0101S) and the Malondialdehyde (MDA) Assay Kit (S0131S). The contents of SOD and MDA were detected at OD450 nm and OD 553 nm, respectively.

[0045] HK-2 cells treated with ginsenoside Ro and NaOx were collected, and the cells were lysed with RIPA lysis buffer. The protein samples were quantified by BCA, and each group of protein samples was quantified to 20 μg / 20 μl. After denaturation, 10% SDS-PAGE electrophoresis was performed, 10 μl was loaded into each well, and electrophoresis was performed at 80 v for 30 min. After separation, 120 v electrophoresis was performed for 50 min, and then 350 mA was transferred to 0.22 μm PVDF membrane for 55 min. After 5% (v / v) BSA was blocked at room temperature for 1 h, the adhesion-related proteins CD44 (15675-1-AP, Proteintech) and OPN (22952-1-AP, Proteintech) were diluted by 1:1000 dilution ratio, and incubated at 4°C overnight. The next day, the membrane was washed with TBST for 3 times, 10 min each time, and then the secondary antibody (rabbit anti, dilution ratio 1:10000) was incubated at room temperature for 2 h. The membrane was washed with TBST for 3 times, 10 min each time, and finally ECL chemiluminescence was observed and recorded under the exposure instrument to observe and record the expression of CD44 and OPN.

[0046] II. Experimental results In the concentration range of 0-40 μM, ginsenoside Ro had no significant cytotoxic effect on HK-2 cells Figure 2 A).

[0047] Ginsenoside Ro (20, 40 μM) significantly reversed the inhibitory effect of NaOx (1 mM) on the proliferation of HK-2 cells Figure 2 B).

[0048] Calcein / PI staining results confirmed that NaOx (1 mM) induced HK-2 cell death, and ginsenoside Ro treatment significantly reduced NaOx-induced cell death Figure 2 C and Figure 2 D).

[0049] Further study of the effect of ginsenoside Ro on oxidative stress in HK-2 cells exposed to NaOx (1 mM). As shown in Figure 2 E and Figure 2 F, dichlorofluorescein diacetate (DCFH-DA) fluorescence staining showed that ginsenoside Ro (20, 40 μM) significantly inhibited the increase in reactive oxygen species (ROS) induced by NaOx (1 mM), while enhancing superoxide dismutase (SOD) activity and reducing malondialdehyde (MDA) levels Figure 2 G and Figure 2 H).

[0050] Consistent with the results of in vivo experiments, ginsenoside Ro treatment significantly reduced the crystal adhesion of HK-2 cells after COM stimulation Figure 2 I and Figure 2J) and expression of adhesion-related proteins (CD44, OPN) Figure 2 K).

[0051] The above results show that ginsenoside Ro significantly inhibits high oxalate-induced oxidative damage and crystal adhesion in HK-2 cells in vitro.

[0052] Example 3 Zinc transporter ZnT1 is increased in expression in the kidneys of glyoxylic acid-treated mice and interacts with ginsenoside Ro I. Experimental Methods ZnT1 (zinc transporter 1), also known as SLC30A1, is a membrane protein responsible for transporting zinc ions from the inside of the cell to the outside. It plays an important role in maintaining the balance of zinc ions inside and outside the cell, and is involved in various physiological and pathological processes. In the formation of kidney stones, the transport and metabolism of zinc ions may play a key role.

[0053] To determine the target of ginsenoside Ro in the oxidative damage induced by NaOx in HK-2 cells, HK-2 cells were seeded in 12-well plates, and after 12 h, HK-2 cells were treated with NaOx (1 mM) for 24 h to obtain NaOx-treated HK-2 cells; after 12 h, HK-2 cells were pretreated with ginsenoside Ro (40 mM) for 2 h, and then treated with NaOx (1 mM) for 24 h to obtain ginsenoside Ro and NaOx co-treated HK-2 cells. RNA sequencing was performed on the above cells. The library was constructed using the ALFA-SEORNA library preparation kit of lllumina v2. The sample library was detected using Oubit 4.0 and Nanodrop One. Genes with log2 (fold change) > 1 and p-value less than 0.05 were identified as differentially expressed genes, and GO (Gene Ontology) terms and KEGG (Gene and Genome Encyclopedia) pathways with FDR ≤ 0.05 were selected for significant enrichment.

[0054] qPCR: RNA was extracted from ginsenoside Ro and NaOx co-treated HK-2 cells and reverse transcribed into cDNA, and qPCR was performed using 2xTSINGKE® Master qPCR Mix kit, with GAPDH / β-Actin as the internal reference gene, to detect the differential genes ZnT1 and Heme Oxygenase 1 (HMOX1). The qPCR reaction system (Table 1), reaction program (Table 2) and primers (Table 3) were configured for amplification, and the melting curve and other parameters were recorded. Finally, the relative expression fold was calculated using the 2 -ΔΔCt method. Each experiment was set up with 3 replicate wells, and the experiment was repeated three times independently.

[0055] Table 1 qPCR reaction system Table 2 qPCR procedure (ABI Stepone plus) Table 3 Primer sequences used for qPCR NaOx treatment HK2 cells to observe the expression of ZnT1 protein: HK-2 cells were seeded in 12-well plates, 12h after treatment with NaOx (1 mM) HK-2 cells, and at 0, 6, 9, 12 and 24h after treatment, the cells were collected, and the cells were lysed with RIPA lysis buffer, and then quantified with BCA, denatured and subjected to SDS-PAGE electrophoresis, and the expression of ZnT1 protein was detected.

[0056] To further clarify whether the protective effect of ginsenoside Ro on HK2 cells against NaOx-induced oxidative damage is achieved by regulating ZnT1 expression, HK-2 cells were seeded in 12-well plates, 12h after treatment with ginsenoside Ro (20 and 40μM) HK-2 pre-treatment for 2h, then add NaOx (1mM) treatment HK-2 cells for 24h, collect cells, use RIPA lysis buffer to lyse cells, then quantified with BCA, denatured and subjected to 10% SDS-PAGE electrophoresis, 10μL per well, electrophoresis 80v 30min, to the separation gel, 120V electrophoresis for 50min, then 350mA transfer membrane 55min to 0.22μm PVDF membrane, 5% BSA room temperature blocking 1h, using the primary antibody diluent ZnT1 (DF4632, Affinity) is diluted at a dilution ratio of 1:1000, and incubated at 4°C overnight, the next day, wash the membrane with TBST 3 times for 10min each time, then incubate with secondary antibody (rabbit anti, dilution ratio 1:10000) at room temperature for 2h, wash the membrane with TBST 3 times for 10min each time, finally ECL chemiluminescence is observed and recorded under the exposure instrument and the expression of ZnT1.

[0057] ZnT1 immunofluorescence (IF): The cells to be tested were fixed with 4% (w / v) paraformaldehyde (PFA) at room temperature for 15min, and then blocked with 2% (v / v) BSA for 30min. The ZnT1 antibody was diluted with 2% BSA (DF4632, Affinity, China; dilution ratio 1:200) and incubated at 4°C overnight. After 12h, the cells were washed with PBS 3 times for 5min each time, then stained with diluted anti-rabbit Alexa Fluor594 antibody (dilution ratio 1:1000), and mounted with DAPI. Finally, the observation was carried out under a laser scanning confocal microscope (LSM880, ZEISS, Germany).

[0058] II. Experimental results KEGG enrichment analysis showed that the Mineral absorption pathway was enriched in both groups (Control vs. NaOx treatment, and NaOx treatment vs. Ginsenoside Ro + NaOx co-treatment) Figure 3 A and Figure 3 B).

[0059] Differential gene analysis showed that SLC30A1 (ZnT1) changed most significantly, which was significantly up-regulated in the NaOx treatment group, and significantly down-regulated after ginsenoside Ro treatment Figure 3 C). This indicates that ZnT1 may serve as a predictive target for kidney stone disease.

[0060] qPCR results showed that ZnT1 was significantly up-regulated after NaOx treatment, and significantly down-regulated after ginsenoside Ro treatment, while HMOX1 was not reversed by ginsenoside Ro Figure 3 D).

[0061] Immunohistochemistry (IHC) of ZnT1 on kidney sections of mice in Example 1 showed that ZnT1 expression in the renal epithelial cells of the Gly group (glyoxylic acid treatment group) was significantly increased Figure 3 E), especially on the cell membrane, which is consistent with its characteristic of being mainly distributed in the cell membrane and vesicles. In contrast, ZnT1 expression was significantly reduced after ginsenoside Ro treatment.

[0062] ZnT1 was significantly up-regulated after 6h of NaOx treatment in HK2 cells Figure 3 F), while ginsenoside Ro significantly inhibited the expression of ZnT1 Figure 3 G).

[0063] Immunofluorescence staining results of ZnT1 showed that the overall expression of ZnT1 was significantly up-regulated after NaOx stimulation, especially on the cell membrane. However, the membrane expression of ZnT1 was significantly down-regulated after ginsenoside Ro treatment Figure 3 H).

[0064] Example 4 Interaction between ginsenoside Ro and ZnT1 I. Experimental Methods Molecular docking: The 3D structure of ZnT1 (PDB: 8j2g) was obtained from the PDB database, while the MOL2 format of ginsenoside Ro was obtained from the TCMSP database, which was then converted to PDB format using Autodock. The protein and ligand structures were prepared by adding hydrogen atoms and calculating charges.

[0065] Molecular dynamics simulation: Molecular dynamics simulations were performed using the Amber24 force field and the TIP3P water model. The system was subjected to an energy minimization process, heated to 310.15 K, then subjected to constraints, equilibration, followed by 100 ns isothermal-isobaric ensemble simulation under periodic boundary conditions. SHAKE constraints hydrogen bonds. Trajectory analysis used AmberTools23.

[0066] Bio-layer interferometry (BLI): BLI experiments were performed with the Octet system, which was immersed in running buffer containing PBS (pH 7.4) and 0.02% (v / v) Tween-20, maintaining a constant temperature of 30°C. Freshly prepared SLC30A1 (ZnT1) protein solution (50 μg / mL) was coupled to the tips of the Forte Bio Octet H1zlK apparatus. Different concentrations of ginsenoside Ro (6.25, 12.5, 25, and 50 μM) were used to evaluate the dose-response kinetics of binding and dissociation, with a separation phase set to last 300 s.

[0067] Cellular thermal shift assay (CETSA): HK-2 cells were collected and resuspended in protein lysis buffer, incubated with dimethyl sulfoxide (DMSO) and ginsenoside Ro (100 μM) at room temperature for 30 min, respectively, then divided into 6 aliquots and placed in PCR tubes. Each sample was heated at 5 temperature points from 42°C to 67°C for 3 min, cooled at room temperature for 3 min, centrifuged at 12000 r / min for 20 min, and the supernatant was collected for quantification and denaturation and western blot (WB) analysis.

[0068] II. Experimental results Molecular docking results showed that ginsenoside Ro could form a favorable docking pocket with ZnT1, with a docking energy of -8.36 kJ / mol, indicating the possibility of spontaneous binding between ginsenoside Ro and ZnT1. Figure 4 A, 4B, Figure 4 C and Figure 4 D).

[0069] Molecular dynamics simulation results showed that ginsenoside Ro enhanced the domain of ZnT1 and changed its conformation Figure 4 E and Figure 4 F).

[0070] BLI experiments confirmed that ginsenoside Ro could interact with ZnT1 protein Figure 4 G and Figure 4 H).

[0071] Cell thermal shift assay (CETSA) experiments showed that ginsenoside Ro could enhance the stability of ZnT1 protein in cells under temperature gradient Figure 4 I}.

[0072] The above findings show that ZnT1 is a possible cellular target of ginsenoside Ro, and ginsenoside Ro significantly enhances the stability of ZnT1 in HK2 cells. In summary, the expression of ZnT1 is related to crystal deposition in Gly-treated mice, and there is an interaction with ginsenoside Ro.

[0073] Example 5 Ginsenoside Ro inhibits NaOx-induced oxidative damage by down-regulating ZnT1 I. Experimental methods CRISPR / SgRNA plasmid construction and lentivirus infection: In order to clarify the role of ZnT1 in NaOx-induced oxidative stress in HK2 cells, ZnT1 in HK2 cells was overexpressed and knocked out, respectively.

[0074] pLentiCrisprV2 (14,877 bp) and pCMV-MCS-3xFlag (4045 bp) plasmids were obtained from Mailgene (Beijing, China). The sgRNA sequence was designed against ZnT1, ZnT1 sg01 sgRNA (GAACTGGAAGAAGATAGGGC, PAM: TGG), and the pLentiCrisprV2 vector expressing the sgRNA was constructed to target and interfere with ZnT1. The target gene (ZnT1, NM_021194.3) was cloned into the Nhel and BamHl sites of the vector (pCMV-MCS-3xFlag) to obtain the pCMV-MCS-3xFlag plasmid containing ZnT1.

[0075] Lentivirus packaging: Take the logarithmic growth phase 293T cells, 4×10 6 cells, and inoculate in a 100 mm dish with DMEM (containing 10% FBS+1% P.S. double antibody); the next day, when the 293T cells grow to 60~70% confluence, 2h before starting to package the virus, the culture medium is replaced with 9ml DMEM (containing 10% FBS). The virus packaging system is shown in Table 4.

[0076] Table 4 Lentivirus packaging system table The virus packaging system was dropped into the dish, and 9ml DMEM (containing 10% FBS+1% P.S.) was replaced after 12~16h, and the virus packaging was completed after 48h.

[0077] Collection of virus liquid: sterilized 1.5ml EP tube was prepared in advance, centrifuge was pre-cooled, 9ml virus liquid in the dish was transferred to 15ml centrifuge tube after virus packaging was completed, 3000g centrifugation was carried out in 4℃ centrifuge for 15min, the supernatant was collected in 10ml syringe, 0.45μm filter membrane was used for filtration, the filtrate was collected and mixed with 1ml FBS, 1ml virus liquid was divided into EP tube, which was used immediately or frozen at-80℃.

[0078] Virus infection of target cells: HK-2 cells were inoculated in 6-well plates one night in advance, the next day, HK-2 cells were grown to 60% confluence, the culture medium of 6-well plates was replaced with 1ml complete culture medium (containing 10% FBS+1% P.S.) +1ml virus liquid +2μl p olybrene (8mg / ml), 8~10h later, the culture medium was replaced with 2ml 1640 complete culture medium (containing 10% FBS+1% P.S.), on the third day, HK-2 cells were grown to 90% confluence, each well was transferred to 1 dish, and 1.5μg / ml puromycin was added for screening for 3 days, after the uninfected cells were all dead, normal culture medium was replaced, and the target infected cells were amplified and cultured to obtain HK-2 cells overexpressing ZnT1 (OE-ZnT1) and HK-2 cells knocking out ZnT1 (ZnT1sg01).

[0079] OE-ZnT1 cells and ZnT1sg01 cells were plated in 96-well plates, respectively, and pre-treated with or without ginsenoside Ro (40μM) for 2h, then treated with NaOx (1mM) for 24h; MTS experiment was carried out according to the method of Example 2 to detect the OD value of the cells.

[0080] OE-ZnT1 cells were co-treated with ginsenoside Ro and NaOx according to the method of Example 2, Calcein / PI staining was carried out, and observation and recording were carried out under a fluorescence microscope.

[0081] OE-ZnT1 cells were co-treated with ginsenoside Ro and NaOx according to the method of Example 3, cells were collected, RIPA was used to lyse the cells and BCA was used for quantification, denaturation was carried out, SDS-PAGE electrophoresis was carried out, and the expression of ZnT1, OPN and CD44 proteins was detected.

[0082] OE-ZnT1 cells were co-treated with ginsenoside Ro and NaOx according to the method of Example 2, and the content of ROS in the cells was detected.

[0083] II. Experimental results As Figure 5 A and Figure 5As shown in FIG. B, HK-2 cells with knock-out of ZnT1 (ZnT1 sg01) and HK-2 cells with overexpression of ZnT1 (OE-ZnT1) were successfully constructed.

[0084] After knocking out ZnT1, it was found that the damaging effect of NaOx on the survival rate of HK2 cells was significantly reduced Figure 5 C). While overexpression of ZnT1 counteracted the protective effect of ginsenoside Ro Figure 5 D); Calcein / PI staining results showed that ginsenoside Ro reduced the increase in cell death induced by NaOx, which was consistent with the results of cell survival rate evaluation Figure 5 E and Figure 5 F).

[0085] WB results of adhesion-related proteins showed that ginsenoside Ro significantly reduced the increase in CD44 and OPN expression caused by NaOx, while overexpression of ZnT1 reversed the inhibitory effect of ginsenoside Ro on CD44 and OPN Figure 5 G). In addition, overexpression of ZnT1 significantly eliminated the protective effect of ginsenoside Ro in reducing the increase in ROS production induced by NaOx in HK2 cells Figure 5 H). These findings suggest that ginsenoside Ro inhibits NaOx-induced oxidative damage by down-regulating ZnT1 expression.

[0086] Example 6 Copper death is involved in the process of NaOx-induced HK-2 cell damage, and ginsenoside Ro inhibits NaOx-induced copper death of HK-2 cells by down-regulating ZnT1 I. Experimental methods Cellular oxidative stress can be induced by various mechanisms, including copper death and iron death. ZnT1 is a novel and key ion channel involved in the process of copper death, which is mainly due to mitochondrial oxidative stress caused by copper metabolism disorder, and eventually leads to cell death. Oxidative stress damage plays a role in the initiation and progression of kidney stone disease, so it is necessary to study the role of copper death in the pathogenesis of kidney stones and whether ZnT1 mediates this process.

[0087] Copper death marker protein DLAT immunofluorescence: HK-2 cells were seeded on cell climbing sheets in 12-well plates, and the HK-2 cells were treated with NaOx (1 mM) for 24 h, and then the cells were fixed with 4% (w / v) paraformaldehyde (PFA) at room temperature for 15 min, and then blocked with 2% (v / v) BSA for 30 min, and then the DLAT antibody was diluted with 2% BSA (13426-1-AP, Proteintech, dilution ratio 1:200) for 4°C staining overnight, and then the climbing sheets were washed with PBST for 3 times, 5 min each time, and then the anti-rabbit Alexa Fluor 594 antibody diluted with PBST (dilution ratio 1:1000) was used for staining at room temperature for 1 h in the dark, and then DAPI was used for mounting, and finally the expression and distribution of DLAT were observed under a confocal microscope.

[0088] Detection of copper death-related proteins FDX1 and HSP70: HK-2 cells were plated in 12-well plates, and after 12 h, the cells were treated with NaOx (1 mM) for 24 h; or the cells were pretreated with ginsenoside Ro (20 or 40 μM) for 2 h, and then NaOx (1 mM) was added for co-treatment of the cells for 24 h; the cells were collected, and after lysis of the cells with RIPA lysis buffer, the BCA was used for quantification, and after denaturation, SDS-PAGE electrophoresis was performed to detect the expression of copper death-related proteins FDX1 and HSP70.

[0089] Mitochondrial reactive oxygen species (mtROS): HK-2 cells were plated in 12-well plates, and after 12 h, the cells were treated with NaOx (1 mM) for 12 h; or the cells were co-treated with NaOx (2 mM) and tetrathiomolybdate (TTM, 40 μM) for 12 h; and the mtROS of the cells was detected.

[0090] Copper ion detection: HK-2 cells were plated in 12-well plates, and after 12 h, the cells were treated with NaOx (1 mM) for 12 h; or the cells were co-treated with NaOx (2 mM) and tetrathiomolybdate (TTM, 40 μM) for 12 h; or the OE-ZnT1 cells were co-treated with ginsenoside Ro, NaOx (2 mM) and tetrathiomolybdate (TTM, 40 μM) for 12 h by the method of Example 3; the cells were collected, and after lysis of the cells with RIPA lysis buffer, the BCA was used for quantification, and the copper (Cu 2+ ) colorimetric assay kit (E-BCK775-M, Elabscience, China) was used to detect the copper concentration (μmol / g protein) of the cells at OD580 nm.

[0091] MTS assay: HK-2 cells were plated in 96-well plates, and after 12 h, cells were treated with NaOx (1 mM) for 12 h; or co-treated with NaOx (1 mM) and TTM (40 mM) for 12 h; cell OD value was detected by MTS assay to detect cell viability.

[0092] JC-1 staining: HK-2 cells were plated on the crawl sheet in 12-well plates, and after 12 h, cells were treated with NaOx (1 mM) / PBS for 24 h, or pretreated with ginsenoside Ro (40 mM) for 2 h, and then combined with NaOx (1 mM) for 24 h, finally, cells were incubated with JC-1 (10 pg / mL) for 30 min, and the mitochondrial membrane potential was detected by the mitochondrial membrane potential detection kit (JC-1) (E-CK-A301, elabscience, China).

[0093] Vector cells and OE-ZnT1 cells were plated respectively, and then pretreated with ginsenoside Ro (40 mM) for 2 h, and then treated with NaOx (1 mM) and TTM (40 mM) for 24 h, cells were collected, RIPA lysed cells and quantified by BCA, the expression level of glutathione (GSH) in cells was detected, the copper concentration of cells was detected at OD580 nm, the expression of FDX1, HSP70, CD44 and OPN was detected by SDS-PAGE electrophoresis, the expression of DLAT was detected by immunofluorescence, and the cell viability was detected by MTS assay.

[0094] Immunohistochemical (IHC) staining of FDX1 in mouse kidney in Example 1.

[0095] II. Experimental results After NaOx stimulation, DLAT aggregated ( Figure 6 A) and HSP70 protein level increased significantly, while FDX1 decreased significantly ( Figure 6 B), mitochondrial reactive oxygen species (mtROS) level ( Figure 6 C) and copper ion concentration increased significantly ( Figure 6 D). However, compared with the higher copper ion concentration in the NaOx group, tetrathiomolybdate (TTM) reduced the enhancement of mtROS ( Figure 6 E) and the increase of copper ion concentration ( Figure 6 F) in HK2 cells induced by NaOx, TTM significantly alleviated the damage of NaOx to cell viability ( Figure 6 G). In addition, in vivo, the expression of FDX1 in the kidney of the Gly group was significantly higher than that of the control group ( Figure 6 H). These results showed that NaOx induced copper death in HK-2 cells.

[0096] To further explore whether ginsenoside Ro can improve NaOx-induced copper death, ginsenoside Ro significantly reduced the expression of HSP70 and up-regulated the expression of FDX1 (Fig. 1). Since mitochondrial dysfunction is a hallmark of copper death, JC-1 dye (which can selectively enter mitochondria and reversibly change from green to red with the increase of membrane potential) was used to analyze the effect of NaOx on mitochondrial membrane potential. The results of JC-1 staining showed that ginsenoside Ro significantly reversed the decrease of mitochondrial membrane potential induced by NaOx (Fig. 1). Figure 6 I). Since mitochondrial dysfunction is a hallmark of copper death, JC-1 dye (which can selectively enter mitochondria and reversibly change from green to red with the increase of membrane potential) was used to analyze the effect of NaOx on mitochondrial membrane potential. The results of JC-1 staining showed that ginsenoside Ro significantly reversed the decrease of mitochondrial membrane potential induced by NaOx (Fig. 1). Figure 6 J).

[0097] After significantly inhibiting the up-regulation of copper ion concentration in OE-ZnT1 cells, TTM significantly inhibited the oligomerization of DLAT (Fig. 3). Figure 6 K and Figure 6 L). At the same time, the expression of copper death-related proteins HSP70 and FDX1 also confirmed that TTM blocked the increase of copper death induced by OE-ZnT1 (Fig. 3). Figure 6 M). On this basis, the inhibitory effect of ginsenoside Ro on the decrease of glutathione (GSH) caused by NaOx in OE-ZnT1 was significantly reversed, while TTM alleviated the enhancing effect of OE-ZnT1 on GSH (Fig. 3). Figure 6 N). In addition, overexpression of ZnT1 eliminated the protective effect of ginsenoside Ro on the decrease of cell viability induced by NaOx, while copper death inhibitor TTM reversed the effect of ZnT1 overexpression (Fig. 3). ​ O). These findings suggest that copper death is involved in the process of NaOx-induced HK2 cell damage, and ginsenoside Ro inhibits NaOx-induced copper death by down-regulating ZnT1.

[0098] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application and do not limit the scope of protection of the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present application.

Claims

1. Use of ginsenoside in the preparation of a medicament for preventing and treating kidney stones.

2. Use according to claim 1, wherein The ginsenoside includes ginsenoside Ro.

3. The use according to claim 1, wherein The ginsenoside inhibits the expression of zinc transporter ZnT1.

4. The use according to claim 1, wherein The medicament reduces the accumulation of kidney crystals.

5. The use according to claim 1, wherein the compound is ###0002### The medicament reduces kidney inflammatory infiltration.

6. The use according to claim 1, wherein The medicament reduces kidney cell oxidative damage.

7. Use according to claim 6, wherein The kidney cell oxidative damage is caused by cellular copper death.

8. The use according to claim 1, wherein The medicament reduces kidney crystal adhesion.

9. The use according to claim 1, wherein The medicament reduces the expression of kidney cell adhesion-related proteins.

10. Use according to claim 9, wherein The adhesion-related proteins include CD44 protein and / or osteopontin OPN.

Images