Gene therapy vector for Parkinson's disease

Abstract

Disclosed herein are recombinant gene therapy vectors comprising a PTEN-induced kinase 1 (PINK1) encoding gene operably linked to a promoter, and methods of inhibiting, reducing, or delaying degeneration or death of neurons in a subject using the recombinant therapy vectors.

Description

[0001] Cross-referencing

[0002] This application claims the benefit of U.S. Provisional Application 63 / 443289, filed February 3, 2023, the full text of which is incorporated herein by reference. Technical Field

[0003] This invention relates to gene therapy for inhibiting, reducing, or delaying neuronal degeneration or death in subjects. Background Technology

[0004] Parkinson's disease (PD) is a progressive neurodegenerative disorder in which symptoms slowly progress from minor motor impairments to severe physical disability, which in some patients is accompanied by cognitive decline or dementia. Despite the urgent need for treatment, there are currently no clinically approved therapies that can slow or cure PD. In most patients, the cause of the disease is unknown, but a combination of factors, including mitochondrial stress, may play a role. Mitochondrial stress has been shown to induce a variety of cellular dysregulations that can cause both neurodegeneration and neuroinflammation, and are particularly associated with PD.

[0005] Mutations in the PTEN-induced kinase 1 (PINK1) and the PARKIN gene (RBR E3 ubiquitin-protein ligase) are the first mutations associated with familial forms of PD. Homozygous and compound heterozygous loss-of-function mutations in the PINK1 gene cause autosomal recessive early-onset PD. PINK1 signaling is crucial for maintaining mitochondrial homeostasis due to its important roles in mitochondrial degradation, mobility, size, and network maintenance. Among these, the best-characterized function of PINK1 is PARKIN-dependent mitophagy. In healthy mitochondria, PINK1, located upstream of PARKIN, is constitutively introduced into the mitochondria, cleaved by proteases, and subsequently further degraded via the ubiquitin / proteasome system. PARKIN remains inactive in the cytosol. In cases of damage or mitochondrial dysfunction (primarily due to mitochondrial depolarization), PINK1 accumulates at the outer mitochondrial membrane (OMM), leading to the recruitment of PARKIN from the cytosol to the OMM. At the OMM, its E3 ligase activity ubiquitinates mitochondrial proteins, resulting in mitochondrial degradation. In addition to its fundamental function in mitophagy, PINK1 is also involved in the regulation of mitochondrial bioenergetics (complex 1 activation), calcium homeostasis, and mitochondrial quality control (mitochondrial-derived vesicle pathway). Currently, only a few small molecule therapies targeting mitochondria are underway, likely due to off-target systemic side effects associated with the regulation of ubiquitous mitochondrial proteins. Furthermore, according to CiteLine, there are currently 3,153 ongoing or completed PD clinical trials worldwide. However, none of these target PINK1.

[0006] There remains a need to develop a therapeutic that can be delivered directly to the striatum or substantia nigra without systemic side effects and side effects on non-targeted CNS resident cells. SUMMARY

[0007] Provided herein is a recombinant gene therapy vector comprising a polynucleotide operatively linked to a promoter, wherein the vector is an adeno-associated virus (AAV), and the polynucleotide encodes PTEN-induced kinase 1 (PINK1) and has at least about 90% identity to SEQ ID NO: 2 or SEQ ID NO: 3.

[0008] In one embodiment of the recombinant gene therapy vector, the polynucleotide encoding PINK1 has at least 95% identity to SEQ ID NO: 2 or SEQ ID NO: 3.

[0009] In another embodiment of the recombinant gene therapy vector, the polynucleotide encoding PINK1 has at least 98% identity to SEQ ID NO: 2 or SEQ ID NO: 3.

[0010] In yet another embodiment of the recombinant gene therapy vector, the polynucleotide encoding PINK1 has at least 99% identity to SEQ ID NO: 2 or SEQ ID NO: 3.

[0011] In yet another embodiment of the recombinant gene therapy vector, the polynucleotide encoding PINK1 has the sequence of SEQ ID NO: 2 or SEQ ID NO: 3.

[0012] In yet another embodiment of the gene therapy vector, the vector is a serotype 1 adeno-associated virus (AAV1).

[0013] In yet another embodiment of the gene therapy vector, the promoter is selected from the group consisting of hSYNI (human synapsin), INA (alpha-fodrin), NES (nestin), hTH (human tyrosine hydroxylase), FOXA2 (forkhead box protein A2), CaMKII (calmodulin-dependent protein kinase II), NSE (neuron-specific enolase), CMV, CAG, UBC, PGK, EF1-alpha, GAPDH, SV40, HBV, chicken beta-actin, and human beta-actin promoters.

[0014] In yet another embodiment of the gene therapy vector, the vector further comprises one or more regulatory elements. In certain embodiments, the one or more regulatory elements are selected from the group consisting of an enhancer, an intron, a poly-A signal sequence, and a transcript stabilization element. In certain embodiments, the enhancer is selected from the group consisting of a CMV enhancer, a GAPDH enhancer, a beta-actin enhancer, and an EF1-alpha enhancer. In certain embodiments, the transcript stabilization element is selected from the group consisting of a WPRE (Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element) sequence, a HPRE (Hepatitis Posttranscriptional Regulatory Element) sequence, a scaffold attachment region, a 3' UTR, and a 5' UTR.

[0015] In yet another embodiment of the gene therapy vector, the vector comprises an expression cassette comprising, in 5' to 3' order: a) a CAG promoter and a polynucleotide encoding PINK1; b) a CAG promoter, a polynucleotide encoding PINK1, and a WPRE; c) a hTH promoter and a polynucleotide encoding PINK1; d) an EF1a promoter and a polynucleotide encoding PINK1; e) an EF1a promoter, a polynucleotide encoding PINK1, and a WPRE; f) a CBA promoter and a polynucleotide encoding PINK1; or g) a CBA promoter, a polynucleotide encoding PINK1, and a WPRE.

[0016] Also provided herein are host cells comprising the gene therapy vector as provided above.

[0017] In one embodiment of the host cell, the host cell is selected from the group consisting of a HEK293, 293T, HeLa, Vero, and Sf9 cell.

[0018] Also provided herein are methods for increasing expression of PINK1 in cells of a subject by contacting the cells with the recombinant gene therapy vector as provided above.

[0019] In one embodiment of the method, the cells are neurons. In certain embodiments, the neurons are primary tyrosine hydroxylase positive neurons.

[0020] In another embodiment of the method, the subject is a human subject. In certain embodiments, the human subject comprises a mutation in the PINK1 gene. In certain embodiments, the human subject has Parkinson's Disease (PD) or is at risk of developing Parkinson's Disease. In certain embodiments, the PD is early onset PD. In certain embodiments, the PD is early onset autosomal recessive PD.

[0021] Also provided herein are methods for inhibiting, reducing, or delaying degeneration or death of neurons in a subject by contacting the neurons with a gene therapy vector according to any one of claims 1-12, thereby increasing the expression level of PINK1 in the neurons and inhibiting, reducing, or delaying dysfunction / degeneration or death of the neurons. In certain embodiments, the subject is a human subject. In certain embodiments, the neurons are primary tyrosine hydroxylase positive neurons.

[0022] In one embodiment of the methods, MPP+ (1 -methyl-4-phenylpyridinium) induced neurodegeneration is attenuated in the subject.

[0023] In another embodiment of the methods, MPTP (1 -methyl-4-phenyl- 1,2,3,6- tetrahydropyridine) induced neuronal loss is prevented in the subject.

[0024] In yet another embodiment of the methods, the human subject comprises a mutation in the PINK1 gene.

[0025] In yet another embodiment of the methods, the human subject has Parkinson's disease (PD) or is at risk of developing Parkinson's disease. In certain embodiments, the PD is early onset PD. In certain embodiments, the PD is early onset autosomal recessive PD.

[0026] Also provided herein are polynucleotides that encode PINK1 and have at least about 90% identity to SEQ ID NO: 2 or SEQ ID NO: 3.

[0027] In one embodiment, the polynucleotide has at least 95% identity to SEQ ID NO: 2 or SEQ ID NO: 3.

[0028] In another embodiment, the polynucleotide has at least 98% identity to SEQ ID NO: 2 or SEQ ID NO: 3.

[0029] In yet another embodiment of the polynucleotide, the polynucleotide that encodes PINK1 has at least 99% identity to SEQ ID NO: 2 or SEQ ID NO: 3.

[0030] In yet another embodiment of the polynucleotide, the polynucleotide that encodes PINK1 has the sequence of SEQ ID NO: 2 or SEQ ID NO: 3.

[0031] Also provided herein are plasmids comprising the polynucleotide according to any one of claims 32-36.

[0032] Also provided herein are recombinant gene therapy vectors comprising a variant polynucleotide encoding PINK1, wherein cells transduced with the vector express PINK1 at a higher level compared to the level of PINK1 expressed in the same type of cells transduced with the same type of vector comprising a wild-type polynucleotide encoding PINK1.

[0033] Also provided herein are methods for increasing expression of PINK1 in cells of a subject, the method comprising contacting the cells with a recombinant gene therapy vector comprising a variant polynucleotide encoding PINK1, wherein expression of PINK1 in the cells is increased relative to expression of PINK1 in the same type of cells contacted under the same conditions with the same amount of the same type of vector comprising a wild-type polynucleotide encoding PINK1.

[0034] Also provided herein are methods for inhibiting, reducing, or delaying dysfunction / degeneration or death of neurons in a subject, the method comprising contacting the neurons with a recombinant gene therapy vector comprising a variant polynucleotide encoding PINK1, wherein expression of PINK1 in the neurons is increased relative to expression of PINK1 in the same type of neurons contacted under the same conditions with the same amount of the same type of vector comprising a wild-type polynucleotide encoding PINK1.

[0035] In one embodiment of the vectors or methods provided above, the variant polynucleotide is operably linked to a promoter.

[0036] In another embodiment of the vectors or methods provided above, each of the variant polynucleotide and the wild-type polynucleotide is operably linked to the same type of promoter.

[0037] In yet another embodiment of the vectors or methods provided above, the vector is an adeno-associated virus (AAV).

[0038] In yet another embodiment of the vectors or methods provided above, the PINK1 expressed by the cells or neurons contacted with or transduced by the vector comprising the variant polynucleotide encoding PINK1 is at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, or 2-fold compared to the PINK1 expressed by the cells or neurons contacted with or transduced by a vector comprising a wild-type polynucleotide encoding PINK1.

[0039] In yet another embodiment of the vectors or methods provided above, the variant polynucleotide encoding PINK1 is at least about 70%, at least about 80%, at least about 85%, or at least about 90% identical to SEQ ID NO: 2 or SEQ ID NO: 3.

[0040] In yet another embodiment of the vector or method provided above, the cell is a neuron.

[0041] In yet another embodiment of the vector or method provided above, the neuron is selected from the group consisting of: a cortical neuron, an ependymal cell, a glutamatergic neuron, a gamma-aminobutyric acidergic neuron, a dopaminergic neuron, an oligodendrocyte, an astrocyte, and a microglial cell.

[0042] Also provided herein is a method for inhibiting, reducing, or delaying degeneration or death of a neuron in a subject, the method comprising contacting the neuron with an amount of a recombinant gene therapy vector comprising a polynucleotide encoding PINK1, wherein the amount of the vector is an amount effective to inhibit, reduce, or delay degeneration or death of the neuron in the subject.

[0043] In one embodiment of the method, the neuron is contacted with the vector in an amount corresponding to a multiplicity of infection (MOI) of between about 1 and about 10^5.

[0044] In another embodiment of the method, the neuron is contacted with the vector in an amount corresponding to a MOI of between about 10 and about 10^4.

[0045] In yet another embodiment of the method, the neuron is contacted with the vector in an amount corresponding to a MOI of about 1, about 10, about 10^1, about 10^2, about 10^3, about 10^4, or about 10^5.

[0046] In yet another embodiment of the method, the polynucleotide is operably linked to a promoter.

[0047] In yet another embodiment of the method, the polynucleotide is a variant polynucleotide.

[0048] In yet another embodiment of the method, the vector is an adeno-associated virus (AAV).

[0049] In yet another embodiment of the method, the variant polynucleotide encoding PINK1 is at least about 70%, at least about 80%, at least about 85%, or at least about 90% identical to SEQ ID NO: 2 or SEQ ID NO: 3.

[0050] In yet another embodiment of the method, the neuron is selected from the group consisting of: a cortical neuron, an ependymal cell, a glutamatergic neuron, a gamma-aminobutyric acidergic neuron, a dopaminergic neuron, an oligodendrocyte, an astrocyte, and a microglial cell. BRIEF DESCRIPTION OF DRAWINGS

[0051] Figure 1Ais a Western blot showing PINK1 mRNA expression levels in PINK1 KO HEK293T cells transduced with AAV1 CIS plasmids containing WT PINK1 (GT65) or PINK1 variants (GT66, TG69, GT72, GT73, GT74, or GT75).

[0052] Figure 1B is a graph showing relative PINK1 protein levels in PINK1 KO HEK293T cells transduced with AAV1 CIS plasmids containing WT PINK1 (GT65) or PINK1 variants.

[0053] Figures 2A-2B Representative images of HEK293T wild type and PINK1 knockout cells treated with DMSO vehicle or valinomycin drug before and after overexpression of AAV1-PINK1 are shown. Figure 2A is immunocytochemistry of pS65-Ub in PINK1 WT and KO HEK293T cells treated with DMSO vehicle or valinomycin. Figure 2B is a graph showing pS65-Ub readout in PINK1 WT and KO HEK293T cells overexpressing PINK1 WT or PINK1 variants with or without valinomycin treatment.

[0054] Figures 3A-3E is a graph showing the amount of LDH released in primary cortical neurons transduced with AAV1 vectors containing PINK1 variants GT67 Figure 3A ), GT69 Figure 3B ), GT74 Figure 3C ), GT77 Figure 3D ), or GT79 Figure 3E ).

[0055] Figure 4 is a graph showing the amount of LDH released in primary cortical neurons transduced with AAV1 vectors containing GT69 or GT74 at the indicated MOI compared to untransduced neurons.

[0056] Figure 5 In vivo expression of human PINK1 in rats transduced with AAV vectors containing PINK1 WT (panel A), PINK1 variant GT69 (panel B), or PINK1 variant GT74 (panel C) is shown. Panel D shows human PINK1 mRNA levels in untransduced rats. Figure 6 and Figure 7 show Western blot and qPCR results, respectively, from striatal samples.

[0057] Figure 8ADopamine (DA) levels in the striatum of wild type and PINK1 KO rodents treated with different amounts of control and GT65 are shown. Figure 8B Dopamine (DA) levels in the striatum of wild type and PINK1 KO rodents treated with different amounts of control and GT69 are shown.

[0058] Figures 9A-9B Levels of tyrosine hydroxylase (TH) in the midbrain of PINK1 KO rodents treated with different amounts of GT65 and GT69 are shown, as measured by mass spectrometry Figure 9A ) and by Western blot Figure 9B

[0059] Figure 10 A to Figure 10 D is a roadmap of WT rats, PINK1 KO rats, or PINK1 KO rats transduced with AAV containing the WT PINK1 gene (GT65) or the variant PINK1 gene (GT69). Figure 10 E to Figure 10 G is a graph showing changes in motor skills of PINK1 KO rats after transduction with AAV containing the WT PINK1 gene (GT65) or the variant PINK1 gene (GT69).

[0060] Figure 11 In situ hybridization (ISH) and immunohistochemistry (IHC) of hPINK1 mRNA and protein and canine tyrosine hydroxylase (TH) in the canine brain that received a single injection of AAV1 vector containing GT69 into the substantia nigra is shown. DETAILED DESCRIPTION

[0061] The present invention is hereinafter described and claimed. Also, as is known, the subject matter described and claimed herein will be understood to be considered and interpreted at the time of filing of this patent application.

[0062] Various publications, articles and patents are cited or described in the background and throughout this specification; each of these references is herein incorporated by reference in its entirety. Discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is intended as background information to assist the reader in understanding the application. Such discussion is not an admission that any of these items was published at the time the present application was made or that such background information was part of the common general knowledge of the art.

[0063] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which this application belongs. Otherwise, certain terms used herein have the meanings as set forward in the specification.

[0064] ​It should be noted that, as used in this document and the appended claims, the singular form "a", "an", and "the" include plural references unless the context clearly dictates otherwise.

[0065] Unless otherwise indicated, any numerical values, such as concentrations or ranges of concentrations described herein, should be understood to be modified in all instances by the term "about." Accordingly, numerical values are generally intended to include ±10% of the recited value. For example, a concentration of 1 mg / ml includes 0.9 mg / ml to 1.1 mg / ml. Likewise, a concentration range of 1% to 10% (w / v) includes 0.9% (w / v) to 11% (w / v). As used herein, the use of a numerical range expressly includes all possible sub-ranges, all individual numerical values within the range, including integers and fractions within the range, unless the context clearly indicates otherwise.

[0066] Unless otherwise indicated, the term "at least" preceding a series of elements, is to be understood to refer to every element in the series. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the application described herein. Such equivalents are considered to be within the scope of the application.

[0067] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or any other variation thereof, are to be understood to be non- exclusive in that a composition, mixture, process, method, article, or apparatus that "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or the like, can contain additional elements not expressly mentioned or inherent to such composition, mixture, process, method, article, or apparatus. Additionally, "or" as used herein is typically inclusive, i.e., the term "or" is the inclusive or, unless explicitly indicated to the contrary, e.g., complementary to another term such as "only one of the alternatives" will be exclusive. For example, the expression A or B is satisfied by any of the following: A is true (or present) and B is false (or not present), A is false (or not present) and B is true (or present), and both A and B are true (or present).

[0068] As used herein, the conjunctive term "and / or" between multiple recited elements is to be understood to include both the individual options and the combined options. For example, where two elements are connected by "and / or", a first option is that the first element applies without the second element. A second option is that the second element applies without the first element. A third option is that the first and second elements apply together. Any of these options is to be understood as falling within the meaning and therefore satisfying the requirement of the term "and / or" as used herein. The concurrent applicability of more than one option is also to be understood as falling within the meaning and therefore satisfying the requirement of the term "and / or".

[0069] As used herein, the term "consisting of is used throughout the specification and claims to mean including any recited integers or groups of integers but not including additional integers or groups of integers not specified.

[0070] As used herein, the term "consisting essentially of is used throughout the specification and claims to mean including any recited integers or groups of integers and optionally including additional integers or groups of integers that do not materially alter the basic and novel characteristics of the specified method, structure or composition. See M.P.E.P. § 2111.03.

[0071] It should also be understood that, when referring to the size or characteristics of components of the preferred application, the terms "about," "approximately," "on the order of," "substantially," and like terms as used herein mean that the described size / characteristic is not a strict boundary or parameter and that slight variations therefrom, as would be appreciated by those of ordinary skill in the art, are functionally equivalent. At a minimum, such references include variations in numerical values of up to ±10% using accepted mathematical and industrial principles (e.g., rounding, measurement or other system errors, manufacturing tolerances, etc.) that do not change the least significant digit.

[0072] In the context of two or more nucleic acid or polypeptide sequences, the terms "identical" or percent "identity," mean that two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. For sequence comparison, typically one sequence acts as the reference sequence to which the test sequence is compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence against the reference sequence, based on the designated program parameters.

[0073] Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48:443 (1970); by the search for similarity method, Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by visual inspection (see generally, Current Protocols in Molecular Biology, F. M. Ausubel et al., eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (1995 supplement) (Ausubel)).

[0074] Examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., (1990) J. Mol. Biol. 215:403-410; and Altschul et al., (1997) Nucleic Acids Res. 25:3389-3402, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. The algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, e.g., the parameters described in Altschul et al., supra.

[0075] For nucleotide sequences, the parameters W, T and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a word length (W) of 11, an expectation value (E) of 10, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word length of 3, and expectation value (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915 (1992)).

[0076] In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Natl. Acad. Sci. USA 90: 5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

[0077] Another indication that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross-reactive with a polypeptide encoded by the second nucleic acid as described below. Thus, a polypeptide is typically substantially identical to a second polypeptide, e.g., where the two peptides differ only by conservative substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions, as described below.

[0078] As used herein, the term "polynucleotide," synonymously referred to as "nucleic acid molecule," "nucleotide," or "nucleic acid," refers to any polyribonucleotide or polydeoxyribonucleotide, which can be unmodified RNA or DNA or modified RNA or DNA. "Polynucleotide" includes single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that can be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, "polynucleotide" refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term polynucleotide also encompasses a DNA or RNA molecule containing one or more modified bases. "Modified" bases include, for example, tritylated bases and rare bases such as inosine. A variety of modifications can be made to DNA and RNA; thus, "polynucleotide" includes a chemically, enzymatically or metabolically modified form of polynucleotide, as typically found in nature, as well as the chemical forms of DNA and RNA specific to the viral and cellular states. "Polynucleotide" also includes relatively short nucleic acid chains, often referred to as oligonucleotides.

[0079] As used herein, the terms "peptide," "polypeptide," or "protein" can refer to a molecule composed of amino acids and can be recognized by one of skill in the art as a protein. The conventional one-letter or three-letter codes for amino acid residues are used herein. The terms "peptide," "polypeptide," and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer can be linear or branched, it can comprise modified amino acids, and it can be interrupted by non-amino acids. The term also encompasses an amino acid polymer that has been modified by natural processes, such as post-translational

[0080] The peptide sequences described herein are written according to the usual convention in which the N-terminal region of the peptide is on the left and the C-terminal region is on the right. While isomeric forms of amino acids are known, it is the L-form of the indicated amino acid unless otherwise indicated explicitly.

[0081] In one aspect, the present disclosure provides a recombinant gene therapy vector comprising an expression cassette for expressing PTEN-induced putative kinase 1 (PINK1) protein (SEQ ID NO: 9, listed below), and the vector is an adeno-associated vector (AAV). In some embodiments, the expression cassette comprises a polynucleotide encoding PINK1 operably linked to a promoter.

[0082] A polynucleotide encoding PINK1 can comprise a sequence that is at least about 70%, about 75%, 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to SEQ ID NO: 1 (which corresponds to nucleotides 92-1834 of the human wild-type human PINK1 gene (NM_032409.3)). In some embodiments, a polynucleotide encoding PINK1 can also be a variant polynucleotide derived from a modified wild-type human PINK1 gene. In some embodiments, a polynucleotide encoding PINK1 can comprise a sequence that is at least about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 2-3. In some embodiments, a polynucleotide encoding PINK1 can comprise a sequence selected from the group consisting of SEQ ID NOs: 2-3. In some embodiments, a polynucleotide encoding PINK1 can comprise the sequence of SEQ ID NO: 2. In some embodiments, a polynucleotide encoding PINK1 can comprise the sequence of SEQ ID NO: 3.

[0083] As used herein, a “variant polynucleotide encoding PINK1,” “variant PINK1 gene,” or “PINK1 variant” are used interchangeably and refer to a polynucleotide sequence derived from a modified wild-type human PINK1 gene. In other words, a “variant polynucleotide encoding PINK1,” “variant PINK1 gene,” or “PINK1 variant” contains at least one nucleotide change compared to the wild-type human PINK1 gene (SEQ ID NO: 1) and encodes a PINK1 protein (SEQ ID NO: 9).

[0084] SEQ ID NO: 1

[0085]

[0086] SEQ ID NO: 2

[0087]

[0088] SEQ ID NO:3

[0089]

[0090] MAVRQALGRGLQLGRALLLRFTGKPGRAYGLGRPGPAAGCVRGERPGWAAGPGAEPRRVGLGLPNRLRFFRQSVAGLAARLQRQFVVRAWGCAGPCGRAVFLAFGLGLGLIEEKQAESRRAVSACQEIQAIFTQKSKPGPDPLDTRRLQGFRLEEYLIGQSIGKGCSAAVYEATMPTLPQNLEVTKSTGLLPGRGPGTSAPGEGQERAPGAPAFPLAIKMMWNISAGSSSEAILNTMSQELVPASRVALAGEYGAVTYRKSKRGPKQLAPHPNIIRVLRAFTSSVPLLPGALVDYPDVLPSRLHPEGLGHGRTLFLVMKNYPCTLRQYLCVNTPSPRLAAMMLLQLLEGVDHLVQQGIAHRDLKSDNILVELDPDGCPWLVIADFGCCLADESIGLQLPFSSWYVDRGGNGCLMAPEVSTARPGPRAVIDYSKADAWAVGAIAYEIFGLVNPFYGQGKAHLESRSYQEAQLPALPESVPPDVRQLVRALLQREASKRPSARVAANVLHLSLWGEHILALKNLKLDKMVGWLLQQSAATLLANRLTEKCCVETKMKMLFLANLECETLCQAALLLCSWRAAL

[0091] Adeno-associated virus (AAV) is a single-stranded DNA parvovirus that grows only in cells, with certain functions provided by a co-infecting helper virus. Basic information and reviews of AAV can be found, for example, in Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169-228 and Berns, 1990, Virology, pp. 1743-1764, Raven Press, (New York). It is fully expected that the same principles described in these reviews will be applicable to additional AAV serotypes characterized after the date of publication of the reviews, since it is well known that the various serotypes are closely related in structure and function, even at the genetic level. (See, e.g., Blacklowe, 1988, Parvoviruses and Human Disease, pp. 165-174, ed. J.R. Pattison; and Rose, Comprehensive Virology 3:1-61 (1974)). For example, all AAV serotypes exhibit remarkably similar replication properties mediated by homologous rep genes; and all have three related capsid proteins, such as those expressed in AAV2. The degree of relatedness is further indicated by heteroduplex analysis showing extensive cross-hybridization between serotypes along the length of the genome; and the presence of similar self-annealing fragments at the termini, which correspond to the "inverted terminal repeat (ITR)". Similar patterns of infectivity also indicate that the replication functions in each serotype are under similar regulatory control.

[0092] As used herein, an "AAV vector" or "rAAV vector" refers to a recombinant vector comprising one or more polynucleotides of interest (or transgenes) flanked by AAV inverted terminal repeats (ITRs). Such AAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been transfected with a plasmid encoding and expressing rep and cap gene products. Alternatively, a host cell that has been stably engineered to express rep and cap genes can be used to package AAV vectors into infectious particles.

[0093] As used herein, an “AAV virion” or “AAV viral particle” or “AAV vector particle” refers to a viral particle composed of at least one AAV capsid protein and an encapsidated polynucleotide AAV vector. As used herein, if the particle comprises a heterologous polynucleotide (i.e., a polynucleotide other than a wild-type AAV genome, such as a transgene to be delivered to a mammalian cell), it is often referred to as an “AAV vector particle” or simply an “AAV vector.” Thus, production of an AAV vector particle necessarily includes production of an AAV vector, as the vector is contained within the AAV vector particle.

[0094] AAV is a replication-defective parvovirus with a single-stranded DNA genome of approximately 4.7 kb in length, containing two 145-nucleotide terminal inverted repeats (ITRs). There are multiple known variants of AAV, which are sometimes also referred to as serotypes when classified by antigenic epitopes. The nucleotide sequences of the genomes of AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV-2 is provided in GenBank Accession No. NC_001401 and in Srivastava et al., J. Virol., 45: 555-564 (1983); the complete genome of AAV-3 is provided in GenBank Accession No. NC_1829; the complete genome of AAV-4 is provided in GenBank Accession No. NC_001829; the AAV-5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV-6 is provided in GenBank Accession No. NC_001862; at least portions of the AAV-7 and AAV-8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively; the AAV-9 genome is provided in Gao et al., J. Virol., 78: 6381-6388 (2004); the AAV-10 genome is provided in Mol. Ther., 13(1): 67-76 (2006); and the AAV-11 genome is provided in Virology, 330(2): 375-383 (2004). The sequence of the AAVrh.74 genome is provided in U.S. Patent No. 9,434,928, which is incorporated herein by reference. The cis-acting sequences that direct viral DNA replication (rep), encapsidation / packaging, and host cell chromosome integration are contained within the AAV ITRs. Three AAV promoters, designated by their relative map positions as p5, p19, and p40, drive expression of the two AAV internal open reading frames that encode the rep and cap genes. Coupled with differential splicing of a single AAV intron (at nucleotides 2107 and 2227), the two rep promoters (p5 and p19) result in the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. The rep proteins have multiple enzymatic properties that are ultimately responsible for replicating the viral genome. The cap gene is expressed from the p40 promoter, and it encodes the three capsid proteins VP1, VP2, and VP3. Alternative splicing and a non-canonical translation initiation site are responsible for the production of the three related capsid proteins. A single, consensus polyadenylation site is located at map position 95 of the AAV genome.The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992).

[0095] AAV has unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV infects many mammalian cells, allowing the possibility of targeting many different tissues in vivo. In addition, AAV transduces slowly dividing and non-dividing cells and can persist essentially for the lifetime of these cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is inserted as cloned DNA in a plasmid, which makes possible the construction of recombinant genomes. Furthermore, since the signals directing AAV replication and genome encapsidation are contained in the ITRs of the AAV genome, some or all of the approximately 4.3 kb internal genome (encoding the replication and structural capsid proteins, rep-cap) can be replaced with foreign DNA. For the generation of AAV vectors, the rep proteins and cap proteins can be provided in trans. Another notable feature of AAV is that it is an extremely stable and hardy virus. It is easily withstood the conditions used to inactivate adenovirus (56°C to 65°C for several hours), making cold storage of AAV less important. AAV can even be lyophilized. Finally, AAV-infected cells are not susceptible to superinfection.

[0096] The AAV DNA in the rAAV genome can be from any AAV variant or serotype that can be derived from a recombinant virus, including but not limited to AAV variants or serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, and AAVrh10. The production of pseudotyped rAAV is disclosed, for example, in WO 01 / 83692. Other types of rAAV variants are also contemplated, for example, rAAV with capsid mutations. See, for example, Marsic et al., Molecular Therapy, 22(11): 1900-1909 (2014). The nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0097] In some cases, the rAAV comprises a self-complementary genome. As defined herein, rAAVs comprising a "self-complementary" or "double stranded" genome refer to rAAVs that have been engineered such that the coding region of the rAAV is configured to form an intramolecular double stranded DNA template, as described in McCarty et al. Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis. Gene Therapy. 8(16): 1248-54 (2001). In some cases, the present disclosure contemplates the use of rAAVs comprising a self-complementary genome because upon infection (this transduction) rather than waiting for cell-mediated synthesis of the second strand of the rAAV genome, the two complementary halves of the scAAV will associate to form one double stranded DNA (dsDNA) unit ready for immediate replication and transcription. It will be appreciated that rAAVs comprising a self-complementary genome can only retain about half of the total coding capacity (= 2.4 kb) rather than the total coding capacity (4.7-6 kb) found in rAAVs.

[0098] The full-length sequences and capsid gene sequences of most known AAVs are provided in U.S. Patent No. 8,524,446, which is incorporated by reference herein in its entirety.

[0099] An AAV vector can comprise a wild-type AAV sequence, or it can comprise one or more modifications to a wild-type AAV sequence. In certain embodiments, an AAV vector comprises one or more amino acid modifications, e.g., substitutions, deletions, or insertions, within a capsid protein (e.g., VP1, VP2, and / or VP3). In particular embodiments, the modification provides reduced immunogenicity when the AAV vector is provided to a subject.

[0100] According to the present disclosure, AAVs used herein are wild-type AAVs or modified AAVs. In some embodiments, AAVs used herein comprise a capsid protein that is at least 95% identical to a wild-type VP1, VP2, or VP3 capsid protein. In some embodiments, AAVs used herein are AAV1.

[0101] According to the present disclosure, the polynucleotide encoding PINK1 is operably linked to a promoter. In some embodiments, the promoter is a eukaryotic active promoter, which is capable of facilitating initiation of RNA transcription from the polynucleotide in a eukaryotic cell. In some embodiments, the promoter is a tissue-specific promoter, such as a promoter capable of driving expression to a greater extent in neurons than in non-neuronal cells. Suitable neuronal-specific promoters include, but are not limited to, hSYNI (human synapsin), INA (alpha-filamin), NES (nestin), hTH (human tyrosine hydroxylase), FOXA2 (forkhead box protein A2), CaMKII (calcium / calmodulin-dependent protein kinase II), Prnp (prion protein promoter), Hb9, and NSE (neuron-specific enolase) promoters. In some cases, the promoter is a ubiquitous promoter. A "ubiquitous promoter" refers to a promoter that is not tissue-specific under experimental or clinical conditions. Suitable ubiquitous promoters for use herein include, but are not limited to, CMV, CAG, UBC, PGK, EF1-alpha, EFS (human eukaryotic translation elongation factor 1 alpha 1 short form), SFFV (spleen focus-forming virus promoter), GAPDH, SV40, HBV, chicken beta-actin, and human beta-actin promoters.

[0102] In some embodiments, the polynucleotide encoding PINK1 is operably linked to a hSYNI promoter (SEQ ID NO: 4).

[0103] SEQ ID NO: 4

[0104] CTGCAGAGGGCCCTGCGTATGAGTGCAAGTGGGTTTTAGGACCAGGATGAGGCGGGGTGGGGGTGCCTACCTGACGACCGACCCCGACCCACTGGACAAGCACCCAACCCCCATTCCCCAAATTGCGCATCCCCTATCAGAGAGGGGGAGGGGAAACAGGATGCGGCGAGGCGCGTGCGCACTGCCAGCTTCAGCACCGCGGACAGTGCCTTCGCCCCCGCCTGGCGGCGCGCGCCACCGCCGCCTCAGCACTGAAGGCGCGCTGACGTCACTCGCCGGTCCCCCGCAAACTCCCCTTCCCGGCCACCTTGGTCGCGTCCGCGCCGCCGCCGGCCCAGCCGGACCGCACCACGCGAGGCGCGAGATAGGGGGGCACGGGCGCGACCATCTGCGCTGCGGCGCCGGCGACTCAGCGCTGCCTCAGTCTGCGGTGGGCAGCGGAGGAGTCGTGTCGTGCCTGAGAGCGCAG

[0105] In some embodiments, the polynucleotide encoding PINK1 is operably linked to a CAG promoter (SEQ ID NO: 5).

[0106] SEQ ID NO: 5

[0107]

[0108] The recombinant gene therapy vectors disclosed herein can also comprise one or more regulatory elements, such as enhancers, introns, polyA signal sequences, and transcript stabilization elements.

[0109] In some embodiments, the transcript stabilization element can be a WPRE (Woodchuck hepatitis virus post-transcriptional regulatory element) sequence, a HPRE (Hepatitis post-transcriptional regulatory element) sequence, a scaffold attachment region, a 3’ UTR, or a 5’ UTR. In some embodiments, the recombinant gene therapy vectors disclosed herein comprise both a 5’ UTR and a 3’ UTR.

[0110] Suitable enhancers used herein include, but are not limited to, a CMV enhancer, a GAPDH enhancer, a beta-actin enhancer, or an EF1-alpha enhancer.

[0111] In some embodiments, the recombinant gene therapy vectors disclosed herein comprise one or more intron sequences. For example, the intron sequence can be selected from a rabbit globin intron sequence, a chicken beta-actin intron sequence, a synthetic intron sequence, or an EF1-alpha intron sequence.

[0112] In some embodiments, the recombinant gene therapy vectors disclosed herein comprise a polyA signal sequence. For example, the polyA signal sequence is a rabbit globin polyA signal sequence, a human growth hormone polyA signal sequence, a bovine growth hormone polyA signal sequence, a PGK polyA signal sequence, a SV40 polyA signal sequence, or a TK polyA signal sequence. In some embodiments, the polyA signal sequence can be a bovine growth hormone polyA signal sequence.

[0113] In some embodiments of the recombinant gene therapy vectors disclosed herein, the expression cassette can comprise an additional polynucleotide encoding a protein other than PINK1, and the polynucleotide encoding PINK1 and the additional polynucleotide are linked by a linker. Suitable linkers include, but are not limited to, an IRES (internal ribosome entry site) and a 2A peptide coding sequence.

[0114] In various embodiments of the recombinant gene therapy vectors disclosed herein, the expression cassette comprises, in 5’ to 3’ order:

[0115] a CAG promoter and a polynucleotide encoding PINK1;

[0116] a CAG promoter, a polynucleotide encoding PINK1, and a WPRE;

[0117] a hTH promoter and a polynucleotide encoding PINK1;

[0118] an EF1 a promoter and a polynucleotide encoding PINK1 ;

[0119] an EF1 a promoter, a polynucleotide encoding PINK1, and a WPRE;

[0120] a CBA promoter and a polynucleotide encoding PINK1 ; or

[0121] a CBA promoter, a polynucleotide encoding PINK1, and a WPRE.

[0122] Also within the scope of the present disclosure, a recombinant gene therapy vector comprises a variant polynucleotide encoding PINK1, wherein the PINK1 expression level is higher. That is, a cell transduced with the vector expresses PINK1 at a higher level as compared to the level of PINK1 expressed in a same type of cell transduced with a same type of vector comprising a wild-type polynucleotide encoding PINK1.

[0123] In another aspect, the present disclosure provides a host cell comprising any one of the recombinant gene therapy vectors as provided above. Exemplary host cells include, but are not limited to, HEK293, 293T, HeLa, Vero, and Sf9 cells.

[0124] In yet another aspect, the present disclosure provides a variant polynucleotide encoding PINK1 and having the sequence of SEQ ID NO: 2 or 3, or at least about 70%, about 75%, 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 2 or 3. In some embodiments, the variant polynucleotide has at least 90% identity to SEQ ID NO: 2 or 3. In some embodiments, the variant polynucleotide has at least 95% identity to SEQ ID NO: 2 or 3. In some embodiments, the variant polynucleotide has at least 98% identity to SEQ ID NO: 2 or 3. In some embodiments, the variant polynucleotide has at least 99% identity to SEQ ID NO: 2 or 3.

[0125] In yet another aspect, the present disclosure provides a plasmid comprising a variant polynucleotide encoding PINK1 as described above.

[0126] In yet another aspect, the present disclosure provides a method of increasing expression of PINK1 in cells (e.g., neurons) of a subject by contacting the cells with a recombinant gene therapy vector as provided above. The method can be practiced, for example, in vitro or in vivo in a subject in need thereof. In some embodiments, the subject is a human subject. In some embodiments, the human subject has PD or is at risk of developing PD. In some embodiments, the PD is early onset PD. In some embodiments, the PD is early onset autosomal recessive PD. In some embodiments, the human subject comprises a mutation in the PINK1 gene. In some embodiments, the neurons are primary tyrosine hydroxylase positive neurons. As demonstrated in Example 2, both PINK1 protein and mRNA expression were detected when gene therapy vectors containing PINK1 genes (wild type or variants) were transduced into PINK1 knockout (KO) HEK293T cells. Furthermore, cells transduced with vectors containing PINK1 variants GT69 (SEQ ID NO: 2) or GT74 (SEQ ID NO: 3) exhibited higher levels of PINK1 protein and mRNA expression compared to cells transduced with vectors containing WT PINK1 gene (SEQ ID NO: 1). Moreover, in Example 3, high PINK1 function was detected in PINK1 KO HEK293T cells transduced with vectors containing PINK1 variants GT69 or GT74.

[0127] In yet another aspect, the present disclosure provides a method for increasing expression of PINK1 in cells of a subject. The method comprises contacting the cells with a recombinant gene therapy vector as described above comprising a variant polynucleotide encoding PINK1, wherein the expression of PINK1 in the cells is increased relative to the expression of PINK1 in the same type of cells contacted under the same conditions with the same amount of the same type of vector comprising a wild type polynucleotide encoding PINK1.

[0128] In yet another aspect, the present disclosure provides a method of inhibiting, reducing, or delaying degeneration or death of a neuron by contacting the neuron with a recombinant gene therapy vector as provided above. The method can be practiced in vitro or in vivo, e.g., in a subject in need thereof. In some embodiments, the subject is a human subject. In some embodiments, the human subject has PD or is at risk of developing PD. In some embodiments, the PD is early onset PD. In some embodiments, the PD is early onset autosomal recessive PD. In some embodiments, the human subject comprises a mutation in the PINK1 gene. In some embodiments, the neuron is a primary tyrosine hydroxylase positive neuron. In some embodiments, MPP+ (1 -methyl-4-phenylpyridinium) induced neurodegeneration is attenuated. In some embodiments, MPTP (1 -methyl-4-phenyl-1,2,3,6-tetrahydropyridine) induced neuronal loss is prevented. As demonstrated in Examples 4-5, cortical neurons transduced with vectors containing PINK1 variants (GT69 or GT74) exhibited reduced levels of LDH release compared to untransduced cells.

[0129] Administration of the recombinant gene therapy vector or a composition comprising the recombinant gene therapy vector can be by routes standard in the art, including but not limited to systemic, local, direct injection, parenteral, intravenous, brain, cerebrospinal fluid, intrathecal, intracisternal, intranucleus lentiformis, intrahippocampal, intranigral, intrastriatal, or intracerebroventricular administration. In some cases, administration includes intravenous, brain, cerebrospinal fluid, intrathecal, intracisternal, intranucleus lentiformis, intrahippocampal, intrastriatal, or intracerebroventricular injection.

[0130] In some embodiments, the present disclosure provides local and systemic administration of a therapeutically effective amount of the recombinant gene therapy vectors disclosed herein. For example, systemic administration can be administration into the circulatory system such that the entire body is affected. Systemic administration includes enteral administration, such as by absorption through the gastrointestinal tract and parenteral administration by injection, infusion, or implantation.

[0131] In some embodiments, actual administration of the recombinant gene therapy vectors disclosed herein can be accomplished by using any physical method that transports the vector into the target tissue of the subject. Suitable routes of administration include, but are not limited to, injection into the central nervous system (CNS) or cerebrospinal fluid (CSF) and / or direct injection into the brain.

[0132] The capsid proteins of the recombinant gene therapy vectors can be modified so that the vectors target a particular target tissue of interest, such as a neuron, or more specifically, a dopaminergic neuron. See, e.g., Albert et al. AAV Vector-Mediated Gene Delivery to Substantia Nigra Dopamine Neurons: Implications for Gene Therapy and Disease Models. Genes. February 8, 2017; see also U.S. Patent No. 6,180,613 and U.S. Patent Publication No. US20120082650A1, the disclosures of both of which are incorporated herein by reference. In some embodiments, the recombinant gene therapy vector is injected directly into the substantia nigra of the subject.

[0133] For purposes of administration, e.g., by injection, various solutions can be employed, such as sterile aqueous solutions. Such aqueous solutions can be buffered, if desired, and made isotonic with fluid diluents such as saline or glucose. The vehicle solution can be prepared in water with a surface active agent such as hydroxypropylcellulose or the like, in free acid (DNA contains acidic phosphate groups) or in a pharmaceutically acceptable salt form. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In this connection, all employed aqueous media should be sterile. All solutions should be fluid to the extent that easy syringability exists, and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.

[0134] The pharmaceutical forms suitable for injectable use include, but are not limited to, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form is sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The vehicle can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0135] Sterile injectable solutions can be prepared by incorporating the recombinant gene therapy vector in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile- filtered solution of these ingredients.

[0136] Transduction with the recombinant gene therapy vector can also be performed in vitro. In one embodiment, the desired target cells are removed from the subject, transduced with the recombinant gene therapy vector, and reintroduced into the subject.

[0137] Suitable methods for transducing and reintroducing transduced cells into a subject are known in the art. In one embodiment, cells can be transduced in vitro by combining the recombinant gene therapy vector with the cells, e.g., in an appropriate medium, and using conventional techniques, such as Southern blotting and / or PCR, or by using selectable markers to screen for those cells that carry the DNA of interest. The transduced cells can then be formulated into a pharmaceutical composition and the composition introduced into a subject by various techniques, such as by systemic, local, direct injection, parenteral, intravenous, brain, cerebrospinal fluid, intrathecal, intracisternal, intranuclear, intrahippocampal, intrastriatal, or intraventricular administration. In some cases, the administration includes intravenous, brain, cerebrospinal fluid, intrathecal, intracisternal, intranuclear, intrahippocampal, intrastriatal, or intraventricular injection. Intrathecal injection can be administered by Trendelenburg tilting.

[0138] Transduction of cells with the recombinant gene therapy vectors disclosed herein results in the sustained or increased expression of PINK1. Accordingly, provided herein are methods of administering or delivering a recombinant gene therapy vector expressing PINK1 to a mammalian subject, preferably a human. These methods include transducing tissues, including but not limited to brain tissue, with the recombinant gene therapy vectors disclosed herein. The transduction can be performed with a gene expression cassette comprising tissue-specific control elements. For example, in one embodiment, transduction of neuronal cells and brain tissue is directed by neuronal-specific control elements, including but not limited to those derived from neuron-enriched promoters and other control elements.

[0139] In yet another aspect, the disclosure provides a recombinant gene therapy vector comprising a variant polynucleotide encoding PINK1, wherein a cell transduced with the vector expresses PINK1 at a higher level compared to the level of PINK1 expressed in a same type of cell transduced with a same type of vector comprising a wild-type polynucleotide encoding PINK1.

[0140] In some embodiments, a cell is contacted with a recombinant gene therapy vector comprising a variant polynucleotide encoding PINK1, thereby increasing expression of PINK1 in the cell relative to expression of PINK1 in a same type of cell contacted with the same amount of a same type of vector comprising a wild-type polynucleotide encoding PINK1 under the same conditions.

[0141] In some embodiments, a neuron of a subject is contacted with a recombinant gene therapy vector comprising a variant polynucleotide encoding PINK1, thereby increasing expression of PINK1 in the neuron relative to expression of PINK1 in a same type of neuron contacted with the same amount of a same type of vector comprising a wild-type polynucleotide encoding PINK1 under the same conditions, and thereby inhibiting, reducing, or delaying dysfunction / degeneration or death of the neuron in the subject.

[0142] In some embodiments, the variant polynucleotide and / or the wild-type polynucleotide is operably linked to a promoter.

[0143] In some embodiments, the vector is an adeno-associated virus (AAV).

[0144] In some embodiments, the PINK1 expressed by a cell or neuron contacted with or transduced with a vector comprising a variant polynucleotide encoding PINK1 is at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, or 2-fold compared to the PINK1 expressed by a cell or neuron contacted with or transduced with a vector comprising a wild-type polynucleotide encoding PINK1.

[0145] In some embodiments, the variant polynucleotide encoding PINK1 is at least about 70%, at least about 80%, at least about 85%, or at least about 90% identical to SEQ ID NO: 2 or SEQ ID NO: 3.

[0146] In some embodiments, the cell is a neuron, which can be selected from the group consisting of a cortical neuron, an ependymal cell, a glutamatergic neuron, a gamma-aminobutyric acidergic neuron, a dopaminergic neuron, an oligodendrocyte, an astrocyte, and a microglial cell.

[0147] In yet another aspect, the present disclosure provides a method for inhibiting, reducing, or delaying degeneration or death of neurons in a subject, the method comprising contacting the neurons with an amount of a recombinant gene therapy vector comprising a polynucleotide encoding PINK1, wherein the amount of the vector is an amount effective to inhibit, reduce, or delay degeneration or death of neurons in the subject.

[0148] In some embodiments, the neurons are contacted with the vector in an amount corresponding to a multiplicity of infection (MOI) of between about 1 and about 10A5, or between about 10 and about 104, or about 1, or about 10, or about 101, or about 102, or about 103, or about 104, or about 105.

[0149] In some embodiments, the polynucleotide is operably linked to a promoter.

[0150] In some embodiments, the polynucleotide is a variant polynucleotide encoding PINK1. And the variant polynucleotide encoding PINK1 is at least about 70%, at least about 80%, at least about 85%, or at least about 90% identical to SEQ ID NO: 2 or SEQ ID NO: 3.

[0151] In some embodiments, the vector is an adeno-associated virus (AAV).

[0152] In some embodiments, the cell is a neuron. And the neuron can be selected from the group consisting of a cortical neuron, an ependymal cell, a glutamatergic neuron, a gamma-aminobutyric acidergic neuron, a dopaminergic neuron, an oligodendrocyte, an astrocyte, and a microglial cell.

[0153] Example

[0154] Those skilled in the art will appreciate that modifications can be made to the above described embodiments without departing from the broad inventive concepts of the present invention. Therefore, it is understood that this invention is not limited to the particular embodiments disclosed herein but it is intended to cover modifications within the scope and spirit of the invention, as defined by the description. And, it is expressly intended that the claims be limited only to the extent required by the appended claims.

[0155] Example 1: Design of human PINK1 gene variants

[0156] Sixteen (16) human PINK1 gene variants were designed using various design algorithms (see Table 1) and cloned into AAV1 vectors (where GT0065 is wild-type PINK1 (WT PINK1)).

[0157] Table 1

[0158] Vector ID SEQ ID NO % identity to WT PINK1 % GC content GT0065 1 100％ 63 GT0066 - 80％ 63 GT0067 6 80％ 63 GT0068 - 79％ 65 GT0069 2 78％ 59 GT0070 - 76％ 56 GT0071 - 76％ 56 GT0072 - 77％ 60 GT0073 - 77％ 60 GT0074 3 78％ 61 GT0075 - 82％ 73 GT0076 - 81％ 68 GT0077 7 78％ 63 GT0078 - 74％ 55 GT0079 8 74％ 55 GT0080 - 75％ 55 GT0081 - 75％ 54

[0159] SEQ ID NO:6

[0160]

[0161] SEQ ID NO: 7

[0162]

[0163] SEQ ID NO: 8

[0164]

[0165] Example 2: Screening of protein expression

[0166] AAV1 CIS plasmids were generated for WT PINK1 (GT65) and all 16 PINK1 variants (GT66-GT81). The plasmids were then tested for protein and mRNA expression in PINK1 knockout (KO) human embryonic kidney (HEK) 293T cells. Figure 1A Relative PINK1 protein levels for 6 representative PINK1 variant constructs in PINK1 KO HEK293T cells are shown. PINK1 KO HEK293T cells were cultured for 24 hours at the same cell density. The next day, these cells were treated with plasmid DNA carrying 6 different PINK1 variants at concentrations of 0.3 and 1 microgram. The treated cells were incubated for 48 hours and collected for protein estimation using Western blot. Specifically, the cells were lysed and the lysate was run on an electrophoresis gel to separate proteins by size and charge. The separated proteins were then probed with an antibody specific for PINK1 protein and detected by autoradiography. A housekeeping protein, i.e., actin, was used as an internal control to normalize protein levels between samples. The intensities of the PINK1 and actin protein bands were measured using imaging software and plotted as shown. Figure 1B Figure 1B Representative Western blot analysis of 16 PINK1 variant constructs overexpressed in PINK1 KO HEK293T cells is shown. The graph represents the relative enrichment of PINK1 protein compared to GT65 (WT PINK1) and is plotted in increasing order of expression. The experiment was repeated three times. Statistical analysis was performed in GraphPad Prism software (one-way ANOVA, p<0.0001).

[0167] Example 3: Functional assay of selected PINK1 variants. This set of data shows that AAV1 CIS plasmids selected from the expression data above are functional within the cells in which they are expressed. Figure 2A Representative images of HEK293T wild type and PINK1 knockout cells treated with DMSO vehicle or valinomycin drug before and after overexpression of AAV1-PINK1 are shown. Valinomycin is a mitochondrial autophagy stressor that causes PINK1 protein to stabilize on the surface of mitochondria, triggering a PINK1-specific modification of another protein called ubiquitin. This modification, called pS65-Ub, can be detected by immunocytochemistry Figure 2A ) and by Mesoscale Discovery (MSD, Figure 2B ​) Assay performed and is a direct readout of PINK1 function. Both HEK293T wild type and KO cells overexpressing AAV1-PINK1 show very strong pS65-Ub signal after valinomycin treatment (last panel) compared to DMSO (first and third panels) or background levels (second panel). Overexpression of PINK1 variants was performed as previously described.

[0168] Five (5) selected PINK1 variants (GT67, GT69, GT74, GT77 and GT79) and WT PINK1 (GT65) were further tested in a PINK1 specific functional assay that measures PINK1 phosphorylation of ubiquitin at serine-65 (p-S65-Ub) after induction of mitochondrial autophagy stress with valinomycin. Figure 2B Representative data from the pS65-Ub MSD assay in PINK1 WT and KO HEK293T overexpressing 5 PINK1 variants (GT67, GT69, GT74, GT77 and GT79) compared to WT PINK1 (GT0065) is shown. Blue bars represent pS65-Ub levels under normal or non-stressed conditions, while red bars show stabilized pS65-Ub levels (as a response to PINK1 overexpression and function).

[0169] Example 4: Assessment of neuronal survival

[0170] Neurotoxin rescue experiments were performed in primary neuronal cultures. LDH release assay measures cytotoxicity in cortical neurons transduced with AAV1-PINK1 vectors. Here is shown the amount of LDH released to the media by vectors containing one of the selected 5 PINK1 variants compared to WT PINK1 vector ("GT65") after challenging the neuronal cultures with MPP+ (500 μΜ) at the indicated MOI 7 days post transduction. E18 rat cortex was dissociated using standard protocols and plated on PDL coated 96 well plates and incubated at 37°C for 7 days. E18 neurons were then transduced with AAV1 vectors containing one of the 5 PINK1 variants or WT PINK1 at a range of 10 to 10^4 viral genomes / cell multiplicity of infection (MOI) rate. Cells were incubated for another 7 days and an aliquot of media was collected from all wells as a pre-treatment control. Neurotoxin MPP+ was added at a 500 μΜ concentration and cells were incubated with the toxin for 24 hours. Media containing LDH (released due to cell death) was collected after MPP+ treatment and LDH levels of pre- and post-treatment conditions were measured using a commercially available colorimetric assay. The graph presents the ratio of post- to pre-treatment LDH levels for GT67 ( Figure 3A ), GT69 ( Figure 3B ), GT74 (Figure 3C ), GT77( Figure 3D ) and GT79( Figure 3E ), the amount of LDH released from the various treatment conditions specified on the X-axis. AAV1.rPINK1 (rPINK1 = rat PINK1; MOI = 10^4) is the positive control, which shows rescue of cell death, i.e. less LDH released compared to the controls (first two bars). In Figure 3A and Figure 3B , the control is rat cortical neurons transduced with empty AAV1 vector, while in Figure 3C , Figure 3D and Figure 3E , the control is untransduced cortical neurons. Only GT 69( Figure 3B ) and GT74( Figure 3C ) show similar effects at lower MOI as the positive control.

[0171] Example 5: Reproducibility of the effect of GT69 and GT74 on neuronal survival between batches

[0172] AAV1 vectors containing GT69 and GT74 perform equally well in transducing neurons and attenuating cell death after toxin challenge, indicating that these sequences are reproducible between production sites. Figure 4 shows the LDH release assay for measuring cytotoxicity as described above in primary cortical neurons transduced with GT69 or GT74 at the indicated MOI. Statistical results from one-way ANOVA are indicated with *.

[0173] Example 6: PINK1 expression in rats in vivo

[0174] Robust in vivo PINK1 expression was achieved after direct injection of AAV encoding all three constructs into the brain of WT rats Figure 5 ). 6e9 GC of GT65 (A), GT69 (B) or GT74 (C) were stereotaxically directly injected into the midbrain of adult WT rats, with a fixed volume of 4 pL per injection (n = 4 for each vector). After 3 weeks, brains were collected and processed for in situ hybridization (ISH) to determine human PINK1 mRNA levels (top images) and immunohistochemistry (bottom images). Representative images of whole coronal brain sections of the injected hemisphere are shown on the left (scale bar = 1 mm) and zoomed in on the red outlined section at the right (scale bar = 100 pM). (D) This IHC method has been optimized to detect human PINK1 only, therefore no signal is detected in un-injected WT rats. In addition, Figure 6 and Figure 7The images show Western blot and qPCR results from striatal samples, respectively. These indicate that GT69 and GT74 are as effective as or better than GT65 in inducing human PINK1 protein expression in the striatum of WT rats.

[0175] It is known that at 12 months of age, Pink1 KO mice have increased dopamine (DA) levels in the striatum compared to WT controls (comparative). Figure 8A and Figure 8B The checkered bars and solid gray bars in the image. This is thought to be a result of presynaptic compensation caused by damage to the nigrostriatum. Six months after injection, treatment with all tested doses of GT69 resulted in significantly different dopamine levels compared to the PINK1 KO control group without any AAV treatment. Figure 8B ), while the AAV1.wtPINK1 vector (GT65) at matched dose levels did not significantly reduce the increased striatal DA levels at levels closer to the WT control. Figure 8A Although there was no significant correction trend at the highest tested dose, these results demonstrate that GT69 normalizes dopamine levels in striatal samples from PINK1 KO rats.

[0176] Furthermore, in midbrain samples from PINK1 KO rats, GT69 rescued TH loss at a lower dose than GT65. Tyrosine hydroxylase (TH) is a marker of dopaminergic neurons. In 12-month-old Pink1 KO rats, the minimum effective dose of GT65 to significantly increase midbrain TH levels was 5e9 vg, while GT69 rescued TH loss at a dose of 2e9. This was determined by mass spectrometry (MS / MS). Figure 9A ) and protein blotting ( Figure 9B Similar results were obtained.

[0177] Example 7: Motor skills

[0178] Figure 10 A to Figure 10 D shows the pathway of WT rats, PINK1 KO rats, or PINK1 KO rats transduced with AAV containing the WT PINK1 gene (GT65) or the variant PINK1 gene (GT69). Figure 10 E to Figure 10 G shows a graph illustrating changes in motor skills in PINK1 KO rats after AAV transduction with either the WTPINK1 gene (GT65) or the variant PINK1 gene (GT69).

[0179] Example 8: PINK1 expression in dogs in vivo

[0180] In this embodiment, a single injection of the AAV1 vector containing GT69 into the substantia nigra of the canine brain resulted in robust hPINK1 transgene expression in that region. Figure 11 As shown, in situ hybridization (ISH) and immunohistochemistry (IHC) of hPINK1 mRNA and protein, as well as canine tyrosine hydroxylase (TH), confirmed the desired transduction pattern in the canine brain. These images are representative images of canine midbrain sections (representative first, out of six) taken one week after injection of GT69 (1e10 vg, in 20 μL).

Claims

1. A recombinant gene therapy vector comprising a polynucleotide operatively linked to a promoter, wherein the vector is an adeno-associated virus (AAV), and the polynucleotide encodes PTEN-induced kinase 1 (PINK1) and has at least about 90% identity with SEQ ID NO:2 or SEQ ID NO:

3.

2. The recombinant gene therapy vector according to claim 1, wherein the polynucleotide encoding PINK1 has at least 95% identity with SEQ ID NO:2 or SEQ ID NO:

3.

3. The recombinant gene therapy vector according to claim 1, wherein the polynucleotide encoding PINK1 has at least 98% identity with SEQ ID NO:2 or SEQ ID NO:

3.

4. The recombinant gene therapy vector according to claim 1, wherein the polynucleotide encoding PINK1 has at least 99% identity with SEQ ID NO:2 or SEQ ID NO:

3.

5. The recombinant gene therapy vector according to claim 1, wherein the polynucleotide encoding PINK1 has the sequence of SEQ ID NO:2 or SEQ ID NO:

3.

6. The gene therapy vector according to any one of claims 1 to 5, wherein the vector is serotype 1 adeno-associated virus (AAV1).

7. The gene therapy vector according to any one of claims 1 to 6, wherein the promoter is selected from the group consisting of: hSYNI (human synaptic protein), INA (α-filamentin), NES (nesin), hTH (human tyrosine hydroxylase), FOXA2 (forkhead box protein A2), CaMKII (calmodulin-dependent protein kinase II), NSE (neuron-specific enolase), CMV, CAG, UBC, PGK, EF1-α, GAPDH, SV40, HBV, chicken β-actin, and human β-actin promoters.

8. The gene therapy vector according to any one of claims 1 to 7, wherein the gene therapy vector further comprises one or more regulatory elements.

9. The gene therapy vector of claim 8, wherein the one or more regulatory elements are selected from the group consisting of enhancers, introns, poly-A signal sequences, and transcript stabilizing elements.

10. The gene therapy vector according to claim 9, wherein the enhancer is selected from the group consisting of: CMV enhancer, GAPDH enhancer, β-actin enhancer and EF1-α enhancer.

11. The gene therapy vector according to claim 9, wherein the transcript stabilizing element is selected from the group consisting of: WPRE (marmot hepatitis virus post-transcriptional regulatory element) sequence, HPRE (hepatitis post-transcriptional regulatory element) sequence, scaffold attachment region, 3'UTR and 5'UTR.

12. The gene therapy vector according to any one of claims 1 to 11, wherein the gene therapy vector comprises an expression cassette comprising, in a 5' to 3' sequence: a) a CAG promoter and a polynucleotide encoding PINK1; b) a CAG promoter, a polynucleotide encoding PINK1, and a WPRE; c) an hTH promoter and a polynucleotide encoding PINK1; d) an EF1a promoter and a polynucleotide encoding PINK1; e) an EF1a promoter, a polynucleotide encoding PINK1, and a WPRE; f) a CBA promoter and a polynucleotide encoding PINK1; or g) a CBA promoter, a polynucleotide encoding PINK1, and a WPRE.

13. A host cell comprising a gene therapy vector according to any one of claims 1 to 12.

14. The host cell according to claim 13, wherein the host cell is selected from the group consisting of HEK293, 293T, HeLa, Vero, and Sf9 cells.

15. A method for increasing the expression of PINK1 in said cells by contacting the cells of a subject with a recombinant gene therapy vector according to any one of claims 1-12.

16. The method of claim 15, wherein the cell is a neuron.

17. The method of claim 16, wherein the neuron is a primary tyrosine hydroxylase-positive neuron.

18. The method according to any one of claims 15 to 17, wherein the subject is a human subject.

19. The method of claim 18, wherein the human subject comprises a mutation in the PINK1 gene.

20. The method of claim 18 or 19, wherein the human subject has Parkinson's disease (PD) or is at risk of developing Parkinson's disease.

21. The method of claim 20, wherein the PD is an early-onset PD.

22. The method of claim 20, wherein the PD is early-onset autosomal recessive PD.

23. A method for inhibiting, reducing, or delaying neuronal degeneration or death in a subject, the method being carried out by contacting the neurons with a gene therapy vector according to any one of claims 1 to 12, thereby increasing the expression level of PINK1 in the neurons and inhibiting, reducing, or delaying neuronal dysfunction / degeneration or death.

24. The method of claim 23, wherein the subject is a human subject.

25. The method according to claim 23 or 24, wherein the neuron is a primary tyrosine hydroxylase-positive neuron.

26. The method according to any one of claims 23 to 25, wherein the MPP+(1-methyl-4-phenylpyridinium)-induced neurodegeneration is attenuated in the subject.

27. The method according to any one of claims 23 to 25, wherein MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine)-induced neuronal loss is prevented in the subject.

28. The method according to any one of claims 24 to 27, wherein the human subject comprises a mutation in the PINK1 gene.

29. The method of any one of claims 24 to 28, wherein the human subject has Parkinson's disease (PD) or is at risk of developing Parkinson's disease.

30. The method of claim 29, wherein the PD is an early-onset PD.

31. The method of claim 29, wherein the PD is early-onset autosomal recessive PD.

32. A polynucleotide that encodes PINK1 and has at least about 90% identity with SEQ ID NO:2 or SEQ ID NO:

3.

33. The polynucleotide of claim 32, wherein the polynucleotide has at least 95% identity with SEQ ID NO:2 or SEQ ID NO:

3.

34. The polynucleotide of claim 32, wherein the polynucleotide has at least 98% identity with SEQ ID NO:2 or SEQ ID NO:

3.

35. The polynucleotide of claim 32, wherein the polynucleotide encoding PINK1 has at least 99% identity with SEQ ID NO:2 or SEQ ID NO:

3.

36. The polynucleotide of claim 32, wherein the polynucleotide encoding PINK1 has the sequence of SEQ ID NO:2 or SEQ ID NO:

3.

37. A plasmid comprising a polynucleotide according to any one of claims 32 to 36.

38. A recombinant gene therapy vector comprising a variant polynucleotide encoding PINK1, wherein cells transduced with the vector express PINK1 at a higher level than cells transduced with the same type of vector containing a wild-type polynucleotide encoding PINK1.

39. A method for increasing the expression of PINK1 in the cells of a subject, the method comprising contacting the cells with a recombinant gene therapy vector containing a variant polynucleotide encoding PINK1, wherein the expression of PINK1 in the cells is increased relative to the expression of PINK1 in the same type of cells contacted under the same conditions with the same amount of the same type of vector containing a wild-type polynucleotide encoding PINK1.

40. A method for inhibiting, reducing, or delaying neuronal dysfunction / degeneration or death in a subject, the method comprising contacting the neurons with a recombinant gene therapy vector containing a variant polynucleotide encoding PINK1, wherein the expression of PINK1 in the neurons is increased relative to the expression of PINK1 in neurons of the same type contacted under the same conditions with the same amount of a vector containing a wild-type polynucleotide encoding PINK1.

41. The vector or method according to any one of claims 38 to 40, wherein the variant polynucleotide is operatively linked to a promoter.

42. The vector or method according to any one of claims 38 to 40, wherein each of the variant polynucleotide and the wild-type polynucleotide is operatively linked to the same type of promoter.

43. The vector or method according to any one of claims 38 to 42, wherein the vector is adeno-associated virus (AAV).

44. The vector or method according to any one of claims 38 to 43, wherein the PINK1 expressed by cells or neurons contacted with or transduced with the vector containing a wild-type polynucleotide encoding PINK1 is at least about 1.1 times, 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, or 2 times that expressed by the vector containing a variant polynucleotide encoding PINK1.

45. The vector or method according to any one of claims 38 to 44, wherein the variant polynucleotide encoding PINK1 has at least about 70%, at least about 80%, at least about 85%, or at least about 90% identity with SEQ ID NO:2 or SEQ ID NO:

3.

46. ​​The carrier or method according to any one of claims 38 to 45, wherein the cell is a neuron.

47. The carrier or method according to claim 46, wherein the neuron is selected from the group consisting of: cortical neurons, ependymal cells, glutamatergic neurons, γ-aminobutyric acid (GABAergic) neurons, dopaminergic neurons, oligodendrocytes, astrocytes, and microglia.

48. A method for inhibiting, reducing, or delaying neuronal degeneration or death in a subject, the method comprising contacting the neurons with an amount of a recombinant gene therapy vector containing a polynucleotide encoding PINK1, wherein the amount of the vector is such that it effectively inhibits, reduces, or delays neuronal degeneration or death in the subject.

49. The method of claim 48, wherein the neuron is contacted with a carrier corresponding to an infection multiplicity (MOI) between about 1 and about 10^5.

50. The method of claim 48, wherein the neuron is contacted with a carrier corresponding to an MOI between about 10 and about 10^4.

51. The method of claim 48, wherein the neuron is contacted with a carrier corresponding to an amount of MOI of about 1, about 10, about 10^1, about 10^2, about 10^3, about 10^4 or about 10^5.

52. The method according to any one of claims 48 to 51, wherein the polynucleotide is operatively linked to a promoter.

53. The method according to any one of claims 48 to 51, wherein the polynucleotide is a variant polynucleotide.

54. The method according to any one of claims 48 to 53, wherein the vector is adeno-associated virus (AAV).

55. The method according to any one of claims 48 to 54, wherein the variant polynucleotide encoding PINK1 has at least about 70%, at least about 80%, at least about 85%, or at least about 90% identity with SEQ ID NO:2 or SEQ ID NO:

3.

56. The method of claim 56, wherein the neuron is selected from the group consisting of: cortical neurons, ependymal cells, glutamatergic neurons, GABAergic neurons, dopaminergic neurons, oligodendrocytes, astrocytes, and microglia.

Images