Application of P-G3 in preparation of medicine for improving fertility of obese women

Abstract

The invention discloses application of P-G3 in preparation of a medicine for improving fertility of obese women. The invention provides a first double-target treatment new drug P-G3 (third-generation PAMAM) for obese female infertility, which can reverse double injuries of peripheral ovarian fat accumulation and central reproductive axis imbalance (hypothalamic GnRH neuron low activity) at the same time, reduce fat around ovaries in a targeted manner, improve the curative effect of the ovaries, and improve the curative effect of the ovaries. The problems of female follicular dysplasia caused by obesity, low secretion level of luteinizing hormone (LH) and weak reaction of hypothalamus-pituitary axis (HP) to Kisspeptin-54 are obviously improved, and the fertility of obese women is improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of medical biology, in particular to the application of P-G3 in the preparation of a medicine for improving the fertility of obese women. BACKGROUND

[0002] Infertility is a common problem caused by reproductive disorders, affecting at least 10%-15% of couples of childbearing age. There are many factors that can cause infertility, such as obesity, tumors, deformities, etc., which can cause serious harm to women's health and family happiness, so it is of great significance to treat female infertility.

[0003] Obesity-induced female infertility accounts for about 20%-30% of all infertility patients, which mainly refers to female infertility caused by obesity-induced accumulation of fat around the ovary. At present, there is no drug that can target the reduction of fat around the ovary for the treatment of this disease, and the existing systemic weight loss drugs (such as semaglutide) cannot effectively treat this disease. SUMMARY

[0004] The purpose of the present application is to solve the problem of no targeted treatment drug for obesity-induced female infertility in the prior art, and provide the application of P-G3 in the preparation of a medicine for improving the fertility of obese women.

[0005] In order to achieve the above-mentioned purpose, the present application provides the application of P-G3 in the preparation of a medicine for improving the fertility of obese women. The improvement of the fertility of obese women is any one of the following: i) promoting follicular development and ovulation; the follicle is a follicle of a mammalian mouse or human.

[0006] ii) increasing the secretion of luteinizing hormone; iii) enhancing the response of the hypothalamic-pituitary axis to Kisspeptin-54.

[0007] Optionally, the preparation method of the medicine comprises dissolving P-G3 in a phosphate buffer to obtain the medicine. The concentration of P-G3 in the phosphate buffer is 2 mg / mL.

[0008] Optionally, the medicine is an injection preparation, and the intraperitoneal injection dose is 10 mg / kg•bw / week-20 mg / kg•bw / week, preferably 20 mg / kg•bw / week.

[0009] Optionally, the medicine further comprises a pharmaceutically acceptable excipient, carrier or diluent.

[0010] Compared with the prior art, the present application has the following beneficial effects: (1) The present application provides the first double-target treatment new drug for "obese female infertility" - P-G3 (the third generation of PAMAM), which can simultaneously reverse the double damage of "peripheral ovarian fat accumulation" and "central reproductive axis disorder" (low activity of hypothalamic GnRH neurons), target to reduce the fat around the ovary, significantly improve the problems of female follicular development caused by obesity, low luteinizing hormone (LH) secretion level, weak response of hypothalamic-pituitary axis (HP) to Kisspeptin-54, and improve the fertility of obese women.

[0011] (2) The treatment new drug P-G3 provided by the present application has good safety and effectiveness: P-G3 shows good fat-reducing effect and anti-inflammatory effect in animal experiments, and does not show obvious toxicity. Compared with existing treatment methods such as GLP-1 receptor agonists (side effects including nausea, vomiting) and fat-reducing surgery (high invasiveness and risk), P-G3 has significant advantages in safety and effectiveness. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 It is a schematic diagram for the experimental design of the present application.

[0013] Figure 2 It is a result graph of Example 1 P-G3 reducing ovarian peripheral fat accumulation and inflammation; A is a mouse ovarian peripheral fat observation result graph; B is a mouse ovarian peripheral fat volume result graph; C is a size distribution frequency graph of fat cells in ovarian peripheral fat tissue; D is a result graph of mRNA level of Pparg in ovarian peripheral fat tissue of Obese control group, P+H group, HSA-P-G3 group and P-G3 group; E is a result graph of mRNA level of Adiponectin in ovarian peripheral fat tissue of Obese control group, P+H group, HSA-P-G3 group and P-G3 group; F is a result graph of mRNA level of Rela in ovarian peripheral fat tissue of Obese control group, P+H group, HSA-P-G3 group and P-G3 group; G is a result graph of mRNA level of Tnfa in ovarian peripheral fat tissue of Obese control group, P+H group, HSA-P-G3 group and P-G3 group; H is a result graph of mRNA level of Il10 in ovarian peripheral fat tissue of Obese control group, P+H group, HSA-P-G3 group and P-G3 group; I is the result chart of Western blot analysis of the expression of total NFKB protein in the periovarian adipose tissue of the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group; J is the result chart of Western blot analysis of the expression of phosphorylated NFKB protein in the periovarian adipose tissue of the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group.

[0014] Figure 3 B is the result chart of the observation of mouse ovaries; A is the result chart of the observation of mouse ovaries; B is the result chart of the observation of mouse ovaries; C is the result chart of the number of primary follicles in the ovaries of the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group; D is the result chart of the number of growing follicles in the ovaries of the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group; E is the result chart of the number of pre-ovulatory follicles in the ovaries of the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group; F is the result chart of the number of corpora lutea in the ovaries of the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group; G is the result chart of the mRNA level of FOXO3a in the ovaries of the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group; H is the result chart of the mRNA level of Il6 in the ovaries of the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group; I is the result chart of the mRNA level of Bmp15 in the ovaries of the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group; J is the result chart of the mRNA level of Gdf9 in the ovaries of the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group; K is the result chart of Western blot analysis of the expression of NFKB, phosphorylated NFKB, and FOXO3a protein levels in the ovaries of the first group of mice of the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group; Figure L shows the expression results of NFκB, phosphorylated NFκB and FOXO3a protein levels in the ovaries of mice in the second group (Obese control group, P+H group, HSA-P-G3 group, and P-G3 group) using Western blot analysis. Figure 4 This is a graph showing the results of Example 3, which shows that P-G3 can enhance the responsiveness of the hypothalamus-pituitary (HP) axis to Kisspeptin-54. A represents the luteinizing hormone (LH) test results during estrus in the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group. B represents the results of luteinizing hormone (LH) detection during the interestrus period in the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group. C represents the luteinizing hormone (LH) levels detected after kisepteptin-54 administration in the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group. D represents the luteinizing hormone (LH) levels in Obese control mice during the proestrus phase. E represents the luteinizing hormone (LH) levels detected in another Obese control mouse during the proestrus phase. F represents the luteinizing hormone (LH) levels in a P-G3 mouse during the proestrus phase. G represents the luteinizing hormone (LH) test result from another P-G3 mouse during the proestrus phase. H represents the detection results of LH pulse frequency in the Obese control group and the P-G3 group; I represents the average LH level detection results for the Obese control group and the P-G3 group.

[0015] Figure 5 Example 4: Results of P-G3 restoring fertility; A represents the estrous cycle status of the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group. B represents the estrous cycle regularity status of the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group. C shows the number of pups born in the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group. D represents the time interval from mating to delivery in the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group. E represents the number of offspring in the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group. F is the birth weight condition of the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group of the pups; G is the length condition of the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group of the pups; H is the weight / length condition of the Obese control group, P+H group, HSA-P-G3 group, and P-G3 group of the pups. DETAILED DESCRIPTION

[0016] The technical solutions of the present application are further described below in combination with the drawings and examples.

[0017] The present application research found that P-G3 can overcome the limitation of the existing weight loss drugs in the market, which can only reduce weight in the whole body, and target the fat around the ovary, significantly improve the problems of poor follicular development, low luteinizing hormone secretion level, and weak response of the hypothalamic-pituitary axis to Kisspeptin-54 caused by fat accumulation in female mice, and significantly improve the fertility of obese female mice. Based on this, the present application provides the use of P-G3 in the preparation of a drug for improving the fertility of obese women.

[0018] The present application is further described below in combination with examples.

[0019] Example 1: P-G3 can reduce fat accumulation and inflammation around the ovary In this embodiment, P-G3 is purchased from Merck Life Science Company, with the item number 412422, specifically a 20wt% P-G3 methanol preparation.

[0020] (1) Construction of a high-fat diet-fed obese mouse model: As shown in Figure 1 , C57BL / 6J female mice (purchased from Guangdong Medical Laboratory Animal Center, SPF level) were randomly divided into groups and fed with standard food (control: Nomal control) and high-fat diet (HFD), respectively, for 8 weeks, and the changes in body weight and food intake were monitored every week. When the body weight of the HFD group of mice was more than 20% of the body weight of the Nomal control group, it was determined that the obese mouse modeling was successful.

[0021] (2) Experimental grouping of female mice: the obese mice were randomly divided into 4 groups: Obese control group: intraperitoneal injection of PBS (phosphate buffer) twice a week for 6 consecutive weeks; P+H group: P-G3 drug was injected intraperitoneally twice a week (10 μg P-G3 drug / g body weight each time) + HSA-P-G3 drug was injected locally once a week in the fat pad around the ovary of mice (1 cm below the left or right costal margin and 1 cm lateral to the spine) (10 μg HSA-P-G3 drug / 30g body weight each time) for 6 consecutive weeks.

[0022] HSA-P-G3 group: Local injection of HSA-P-G3 drug once a week (10μg HSA-P-G3 drug / 30g body weight each time) for 6 consecutive weeks; P-G3 group: P-G3 drug was injected intraperitoneally twice a week (10ug P-G3 drug / g body weight each time, twice a week, which is 20ug P-G3 drug / g body weight per week, or 20mg P-G3 drug / kg body weight per week) for 6 consecutive weeks. The total P-G3 drug dosage was the same as that of the HSA-P-G3 group.

[0023] The preparation method of the above-mentioned P-G3 drug is to dissolve the P-G3 methanol preparation in PBS. Specifically, 60uL of 20wt% P-G3 methanol preparation is diluted in 5mL of PBS, and the concentration of P-G3 in PBS is about 2mg / mL.

[0024] The preparation method of HSA-P-G3 drug involves blowing nitrogen gas into the P-G3 methanol formulation to remove methanol, and then redissolving the remaining gel-like P-G3 in deionized water and HSA solution.

[0025] Periovariate fat was collected from each group of mice, and the fat volume was observed and photographed. The results are as follows: Figure 2 As shown. The results showed that P-G3 injection significantly reduced the volume of fat around the ovaries ( Figure 2 AC), and through gene expression analysis, it was found that P-G3 inhibits the expression of PPARG and adiponectin, while reducing the expression of inflammation-related genes, such as Rela and Tnfa ( Figure 2 DH).

[0026] The primers for gene expression analysis are as follows: PPARG Forward (SEQ ID No.1): TCGCTGATGCACTGCCTATG PPARG Reverse (SEQ ID No.2): GAGAGGTCCACAGAGCTGATT adiponectin Forward (SEQ ID No.3): GGAACTTGTGCAGGTTGGAT adiponectin Reverse (SEQ ID No. 4): GCTTCTCCAGGCTCTCCTTT Rela Forward (SEQ ID No. 5): TTCCTGGCGAGAGAAGCAC Rela Reverse (SEQ ID No. 6): AAGCTATGGATACTGCGGTCT Tnfa Forward (SEQ ID No. 7): AGGGTCTGGGCCATAGAACT Tnfa Reverse (SEQ ID No. 8): CCACCACGCTCTTCTGTCTAC Il1b Forward (SEQ ID No. 9): TCACAGCAGCACATCAACAA Il1b Reverse (SEQ ID No. 10): TGTCCTCATCCTGGAAGGTC Il10 Forward (SEQ ID No. 11): TTAATAAGCTCCAAGACCAAGG Il10 Reverse (SEQ ID No. 12): CATCATGTATGCTTCTATGCAG In addition, P-G3 also significantly reduced the total NFκB protein level, while the phosphorylated NFκB level did not change significantly (Fig. I-J), suggesting that P-G3 might reduce the inflammatory response by inhibiting the activation of NFκB. Figure 2 I-J), suggesting that P-G3 might reduce the inflammatory response by inhibiting the activation of NFκB. This indicates that P-G3 significantly improves the fat accumulation and inflammatory state of the periovarian adipose tissue by inhibiting adipocyte differentiation, reducing adiponectin secretion, reducing pro-inflammatory gene expression, and up-regulating the anti-inflammatory factor Il10.

[0027] Example 2: P-G3 can restore follicle development The ovaries of mice in each group of Example 1 were taken, and the ovarian morphology was observed by paraffin section preparation and HE staining.

[0028] (1) Preparation of ovarian frozen sections Take the material → fixation (4% paraformaldehyde, more than 24h) → dehydration (20% sucrose → 30% sucrose until the ovary precipitates) → embedding (frozen embedding agent) → section (20μm) → patch.

[0029] (2) HE staining Rinse sections with distilled water for 5 min → stain with hematoxylin for 5 min, rinse with running water → differentiate with 5% acetic acid for 1 min, rinse with running water → stain with eosin for 1 min, rinse with running water → dehydrate (80% alcohol for 2 seconds, 90% alcohol I for 3 seconds, 90% alcohol II for 5 seconds, 100% alcohol for 5 minutes, xylene carbolic acid for 10 minutes, xylene I, II, and III for 2 minutes each) → air dry for 5 min → mount with neutral resin and observe under a microscope.

[0030] The experimental results showed that, compared with the obese control group, the number of primary follicles in the ovaries of the P-G3 group and the P+H group was significantly reduced, while the number of pre-ovulatory follicles was significantly increased, indicating that P-G3 promotes follicle development and ovulation. Figure 3 Furthermore, P-G3 significantly inhibited the expression of FOXO3a (AF). Figure 3 G) promotes the activation of dormant follicles, further inhibits the activation of the NFκB pathway, and reduces ovarian inflammation. Figure 3 In addition, P-G3 upregulated the expression of Bmp15 and Gdf9 (H). Figure 3 These growth factors (IJ) play a crucial role in follicle development, granulosa cell proliferation and differentiation, oocyte maturation, and ovulation.

[0031] Example 3: P-G3 can enhance the responsiveness of the hypothalamus-pituitary (HP) axis to Kisspeptin-54. The secretion level of luteinizing hormone (LH) in the blood of mice in each group of Example 1 was detected by double antibody sandwich ELISA.

[0032] (1) Coating: Coating was carried out the afternoon of the day before (16:00-19:00). 5 μl of coating antibody was added to 4995 μl of 0.1M PBS, 50 μl of coating antibody was added to each well, wrapped with plastic wrap, placed in a box with a damp paper towel, and stored in the refrigerator overnight. (2) Blocking: Place the coated antibody on a clean piece of paper, add 200 μl of 5% skim milk powder to each well, and shake for 2 hours; (3) Washing: Wash each well 3 times with 200 μl of 0.05% PBST for 3 minutes each time, and pat dry the liquid in the well as much as possible; (4) Add blood sample and standard, 50 μl per well, shake for 2 hours. The standard preparation method is as follows (the standard is SA-SJ, a total of 10 types).

[0033] When adding samples, the 96-well plate should have two additional Quality Control (QC) wells and two blank wells. The QC sample volume is the same as the SC volume, and no standard is added to the blank wells. Add 40 μl of SA-40 μl mouse LH standard to 460 μl of BSA; Add 240 μl of SB-240 μl mouse LH standard to 240 μl of BSA; Add 120 μl of BSA to SC and QC-120 μl mouse LH standard; SD-SJ was serially diluted with 120 μl of BSA. (5) Wash the plate; (6) Add primary antibody: Add 20 μl of primary antibody to 4980 μl of skim milk powder and shake well. Add 50 μl to each well and shake for 1.5 hours. Do not add primary antibody to blank wells. (7) Wash the plate; (8) Add secondary antibody; add 2.5 μl of secondary antibody to a mixture of 2.5 ml skim milk powder and 2.5 ml 0.1 M PBS, add 50 μl to each well, and shake for 1.5 hours; (9) Wash the plate; (10) Substrate color development: The entire process is carried out in a dark room. Dissolve 2 OPD tablets in 10 ml of citrate buffer, add 10 μl of hydrogen peroxide after dissolution, add 100 μl to each well, wait for half an hour, and avoid light. (11) Termination: Use 3M hydrochloric acid to terminate the plate, 100 μl per well, read the plate with a microplate reader at a wavelength of 490 nm, and record the OD value; (12) Plot the standard curve and analyze the ELISA results.

[0034] Experimental results show that P-G3 can: (1) Partial restoration of LH secretion pattern suppressed by obesity in obese female mice: During estrus and diaestrus, there was no significant difference in basal LH levels between the P-G3 group and the Obese control group. Figure 4 (AB), but in dynamic LH responsiveness assessment, the P-G3 group showed a significantly enhanced LH response to Kisspeptin-54 ( Figure 4 C) Kisspeptin-54 is a neuropeptide encoded by the KISS1 gene that can increase the activity of hypothalamic GnRH neurons, stimulate the release of GnRH hormones, and restore ovarian function. The enhanced LH response to Kisspeptin-54 in the P-G3 group indicates that ovarian function in the P-G3 mice is recovering.

[0035] In addition, the LH pulse frequency and average LH level were increased in the P-G3 group during the proestrus phase. Figure 4 (DI). This indicates that P-G3 can partially restore the LH secretion pattern suppressed by obesity in obese female mice.

[0036] (2) Enhance the sensitivity of the HP axis: The LH response mode of P-G3 group to Kisspeptin-54 was similar to that of P+H group, while the LH response of HSA-P-G3 group was weaker, suggesting that intraperitoneal injection of P-G3 (P-G3 targets the fat around the ovary after circulating in the whole body) is more effective than local injection (P-G3 directly acts on the fat around the ovary), and intraperitoneal injection of P-G3 may enhance the sensitivity of the HP axis through central regulation mechanism Figure 4 C}.

[0037] (3) The effect of treating ovarian function is significant: P-G3 treatment significantly improves dynamic LH response ( Figure 4 C), increases the pulse frequency of LH in blood and the average level of LH ( Figure 4 D-I), indicating that the regulation of P-G3 on the HP axis has statistical significance and can restore ovarian function.

[0038] Example 4: P-G3 can restore fertility Vaginal exfoliative cell smears of mice in each group of Example 1 were performed to observe the estrous cycle of rats.

[0039] The vaginal cells were collected by flushing with 10 μL of normal saline from a pipette and then transferred to a labeled slide, air-dried and stained with 0.1% crystal violet. According to the presence or absence of three cell types, leukocytes, keratinized and nucleated epithelial cells, the estrous cycle stage of mice was evaluated by optical microscopy. The proestrus, usually referred to as the short phase of the estrous cycle one day before ovulation, is identified by the presence of most nucleated epithelial cells and a few anucleated cells, the presence of keratinized epithelial cells in estrus, and the identification of anucleated keratinized epithelial cells and a large number of leukocytes in the postestrus, and the interestrus stage is composed of a large number of leukocytes.

[0040] The experimental results show that P-G3 can: (1) restore the estrous cycle The obese control mice had a disordered estrous cycle, manifested as prolonged proestrus, shortened or absent estrus ( Figure 5 A). The estrous cycle of mice in the HSA-P-G3, P-G3 and P+H groups gradually improved in regularity, among which the estrous cycle of the P-G3 and P+H groups almost recovered to the normal level (82% of the cycle regularity) ( Figure 5 B).

[0041] (2) improve fertility: the pregnancy rates of the HSA-P-G3 group (31.8%), the P-G3 group (37.5%) and the P+H group (36.4%) are higher than that of the obese control group (26.3%), close to the level of the normal weight group (33.3%) ( Figure 5 C). P-G3 and P+H groups significantly shortened the interval from mating to delivery (Figure 5 D), indicating that it can effectively alleviate the decline in fertility caused by high-fat diet obesity (E-H). Figure 5

[0042] In summary, the application provides a use of P-G3 in the preparation of a drug for improving the fertility of obese women. P-G3 can simultaneously reverse the double damage of "peripheral ovarian fat accumulation" and "central reproductive axis disorder" (low activity of hypothalamic GnRH neurons), target to reduce the fat around the ovary, significantly improve the problems of poor follicular development, low luteinizing hormone (LH) secretion level, and weak response of the hypothalamic-pituitary axis (HP) to Kisspeptin-54 in obese women, and improve the fertility of obese women.

[0043] Although the content of the application has been described in detail by the above preferred embodiments, it should be recognized that the above description should not be considered as a limitation of the application. After reading the above content, various modifications and alternatives of the application will be apparent to those skilled in the art. Therefore, the protection scope of the application should be defined by the appended claims.​

Claims

1. Application of P-G3 in the preparation of drugs to improve fertility in obese women.

2. The application as described in claim 1, characterized in that, The improvement of fertility in obese women includes any of the following: i) Promote follicle development and ovulation; ii) Increase the secretion of luteinizing hormone; iii) Enhance the hypothalamic-pituitary axis response to Kisspeptin-54.

3. The application as described in claim 2, characterized in that, The follicles mentioned are mammalian follicles.

4. The application as described in claim 3, characterized in that, The mammal in question is either a mouse or a human.

5. The application as described in claim 1, characterized in that, The method for preparing the drug includes dissolving P-G3 in phosphate buffer to obtain the drug.

6. The application as described in claim 5, characterized in that, The concentration of P-G3 in the phosphate buffer solution is 2 mg / mL.

7. The application as described in claim 1, characterized in that, The drug is an injectable preparation.

8. The application as described in claim 7, characterized in that, The intraperitoneal injection dose of the drug is 10 mg / kg·bw / week to 20 mg / kg·bw / week.

9. The application as described in claim 8, characterized in that, The intraperitoneal injection dose of the drug is 20 mg / kg·bw / week.

10. The application as described in claim 1, characterized in that, The drug also contains pharmaceutically acceptable excipients, carriers, or diluents.

Images