Application of reagent for targeted inhibition of circPDK1 in preparation of anti-esophageal cancer drugs

Abstract

The invention relates to application of a targeted inhibition circPDK1 reagent in preparation of an anti-esophageal cancer drug, and belongs to the field of biological medicines. The reagent for targeted inhibition of circPDK1 expression provided by the invention is shRNA or siRNA, and in-vivo and in-vitro experiments prove that the reagent can significantly inhibit circPDK1 expression and inhibit growth and migration of esophageal cancer tumor cells; after siRNA of targeted annular circPDK1 is packaged into efficient and low-toxicity LNP-siRNA, circPDK1 expression is specifically silenced, proliferation and migration of esophageal cancer tumors can be remarkably inhibited, and a basis is provided for clinical treatment and scientific research of esophageal cancer related circRNA.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of reagents that target and inhibit circPDK1 (has-circ-0057090) in the preparation of anti-esophageal cancer drugs. Background Technology

[0002] Esophageal cancer is a highly aggressive malignant gastrointestinal tumor, with a 5-year survival rate of less than 20% for metastatic patients, making its prevention and control a serious challenge. Because the esophagus lacks a serosal layer, tumor cells easily spread within the esophageal wall and invade adjacent organs. Furthermore, the rich vascular and lymphatic networks in the esophageal submucosa provide favorable conditions for the spread of esophageal cancer cells to distant sites. Currently, surgical resection and radiotherapy / chemotherapy remain the main treatments for esophageal cancer. However, traditional chemotherapy methods primarily work by interfering with DNA replication or cell division processes; these drugs often lack sufficient selectivity and specificity, potentially damaging normal cells and causing various side effects. With the advancement of molecular biology research, more precise targeted therapy and immunotherapy strategies are gradually being applied to the treatment of esophageal cancer. Targeted therapy has now been proven to play a crucial role in the treatment of esophageal cancer. Common drugs include tyrosine kinase inhibitors or monoclonal antibodies that act on epidermal growth factor receptors and VEGFR. Nimotuzumab, an EGFR-targeted therapy, possesses a unique bivalent binding property that allows it to more efficiently recognize EGFR on the tumor surface. Furthermore, compared to other EGFR-targeting antibodies, nimotuzumab has fewer side effects, providing patients with a safer and more effective treatment option. Trastuzumab, by targeting HER-2 to inhibit tumor growth, is the drug of choice for treating esophageal adenocarcinoma. Small molecule inhibitors targeting VEGFR, such as bevacizumab, ramucirumab, sorafenib, apatinib, and sunitinib, have also shown good efficacy in the treatment of esophageal squamous cell carcinoma.

[0003] circRNAs are a class of single-stranded, closed circular RNAs, formed through alternative splicing. Their circular structure makes them difficult to degrade in vivo and allows for specific expression in tumors and serum exosomes. They possess advantages such as high stability, conservation, and expression specificity, participating in tumorigenesis by binding miRNAs to regulate gene expression or translating polypeptides. In recent years, multiple studies have shown that circRNAs may be potential therapeutic targets. The circular RNA circPDK1 (has-circ-0057090) is formed through backsplicing of exons 2–8 of the pyruvate dehydrogenase kinase 1 (PDHK1, also known as PDK1) gene. Current research has found that circPDK1, encoding PDHK1-241aa, promotes the growth and metastasis of clear cell renal cell carcinoma. circPDK1 is significantly more highly expressed in pancreatic cancer tissues than in normal tissues, and its expression level is positively correlated with lymph node metastasis, advanced pathological stage, and poor patient prognosis. A search revealed no studies on circPDK1 (hsa_circ_0057090) in esophageal cancer, nor any strategies or clinical translation studies targeting circPDK1 for intervention in esophageal cancer. Summary of the Invention

[0004] To address the above technical problems, this invention provides the application of a reagent targeting and inhibiting circPDK1 in the preparation of anti-esophageal cancer drugs. This invention protects the use of a reagent that targets and inhibits circPDK1 in the preparation of an anti-esophageal cancer drug, wherein the reagent is siRNA or shRNA that targets and inhibits the expression of the circPDK1 gene.

[0005] Furthermore, the nucleotide sequence of the siRNA that targets and inhibits the expression of the circPDK1 gene is shown in SEQ ID NO: 13 or SEQ ID NO: 14.

[0006] Furthermore, the nucleotide sequence of the shRNA that targets and inhibits the expression of the circPDK1 gene is shown in SEQ ID NO: 2 or SEQ ID NO: 3.

[0007] Furthermore, the shRNA expression plasmid that targets and inhibits circPDK1 expression is constructed from oligonucleotide sequences SEQ ID NO: 6 and SEQ ID NO: 7, or from oligonucleotide sequences SEQ ID NO: 8 and SEQ ID NO: 9, and the expression plasmid is obtained by lentiviral packaging and infection.

[0008] This invention also protects an anti-esophageal cancer drug comprising an effective amount of siRNA or shRNA that targets and inhibits the expression of the circPDK1 gene, and a pharmaceutically acceptable vector.

[0009] This invention also protects an LNP-siRNA for treating esophageal cancer, comprising the aforementioned siRNA targeting circPDK1 and lipid nanoparticles.

[0010] Preferably, the lipid nanoparticles are composed of ionizable lipids, cholesterol, DSPC and PEG lipids, and DSPE-PEG-iRGD in a molar ratio of 50:38.5:10:1.5:2, and the ionizable lipid is DLin-MC3-DMA.

[0011] Preferably, the particle size is 80-120 nm and the encapsulation efficiency is ≥95%.

[0012] This invention also protects a method for preparing the LNP-siRNA, comprising the following steps: S1. A mixture of DSPC (10%), Dlin-MC3 (50%), cholesterol (38.5%), DMG-PEG (1.5%), and DSPE-PEG-iRGD (2%) was added to anhydrous ethanol until completely dissolved to obtain a 12.5 mM lipid-ethanol phase. circPDK1 siRNA was prepared into a 0.15 mg / mL siRNA solution (aqueous phase) with an N / P ratio of 6:1 using 0.05 M citrate buffer at pH 4.0. After preheating to 35°C, the solution was instantaneously mixed using a microfluidic chip at a 3:1 flow rate of aqueous phase:lipid phase, with a total flow rate of 12 mL / min, to form an initial LNP suspension. The suspension was then further centrifuged to replace the external solution with PBS. After centrifugation, the supernatant was discarded, and the precipitate was resuspended with an equal volume of PBS. This centrifugation and resuspension were repeated 2-3 times to finally obtain the LNP-siRNA complex. S2 ultrafiltration purification yielded nanoparticles with a particle size of 80-120 nm, PDI < 0.2, and encapsulation efficiency > 95%.

[0013] Compared with the prior art, the present invention has the following beneficial effects: This invention designs shRNA and siRNA that target and inhibit circPDK1 expression. In vivo and in vitro experiments have demonstrated that these shRNAs can significantly inhibit circPDK1 expression and suppress the growth and migration of esophageal cancer tumor cells. Furthermore, it designs an efficient, low-toxicity, and targeted siRNA delivery system for esophageal cancer. By specifically silencing circPDK1 expression in esophageal cancer cells, it inhibits the proliferation and migration of esophageal cancer tumor cells, providing a foundation for the clinical treatment and scientific research of esophageal cancer. Attached Figure Description

[0014] Figure 1 To detect the expression level of circPDK1 in esophageal cancer clinical samples using RT-qPCR experiments; Figure 2This is a comparative graph showing the effects of circPDK1 on the proliferation of esophageal cancer cells. Figure 2 Figure A shows the expression of circPDK1 in Eca109 esophageal cancer cells after constructing stably knocked-down circPDK1 cells and detecting it using RT-qPCR. Figure 2 Figure B shows the expression of circPDK1 overexpressing cells constructed in KYSE450 cells and the results of RT-qPCR assay. Figure 2 Figure C shows the expression of circPDK1 overexpressing cells constructed in KYSE180 cells and the detection of circPDK1 expression in KYSE180 cells by RT-qPCR experiment. Figure 2 Figure D shows the effect of circPDK1 knockdown on the cell viability of Eca109 cells in the CCK8 assay. Figure 2 E shows the effect of circPDK1 overexpression on the cell viability of KYSE450 cells in the CCK8 assay; Figure 2 F shows the effect of circPDK1 overexpression on cell viability of KYSE180 cells in the CCK8 assay; Figure 2 G is the effect of circPDK1 knockdown on the cell cloning ability of Eca109 cells in the plate cloning experiment; Figure 2 H represents the quantitative statistical results of the number of Eca109 cell clones; Figure 2 Figure I shows the effect of overexpression of circPDK1 on the cell cloning ability of KYSE450 and KYSE180 cells in the plate cloning assay. Figure 2 J is a graph showing the quantitative statistical results of KYSE450 and KYSE180 cell clone numbers. *P<0.05, **P<0.01, ***P<0.005. The statistical graph shows the mean ± standard error (error bars), and n=3 for each data group.

[0015] Figure 3 The effect of circPDK1 on the migration ability of esophageal cancer cells, among which Figure 3 Figure A shows the effect of circPDK1 knockdown on the migration ability of esophageal cancer cells Eca109 as detected by Transwell migration assay. Figure 3 B is a statistical result of the number of Eca109 esophageal cancer cells that have migrated. Figure 3 Figure C shows the effect of circPDK1 overexpression on the migration ability of esophageal cancer cells KYSE450 and KYSE180 as detected by Transwell migration assay. Figure 3 D is a statistical result of the migration number of esophageal cancer cells KYSE450 and KYSE180; Figure 4 Particle size distribution and zeta potential of LNP-siRNA; among which Figure 4 A is the particle size distribution diagram of LNP-siRNA. Figure 4 B is the Zeta potential diagram of LNP-siRNA; Figure 5 The graph shows the inhibitory effect of LNP-si-circPDK1 on circPDK1 expression detected by qRT-PCR (*p<0.001). Figure 5 A and Figure 5 B is a comparison of circPDK1 expression in LNP-si-circPDK1 esophageal cancer cells Eca109 and KYSE70 cells. Figure 6 The figure shows the effect of LNP-si-circPDK1 on the viability of esophageal cancer cells Eca109 and KYSE70 as detected by the CCK8 assay; Figure 6 Figure A shows the effect of LNP-si-circPDK1 on the viability of esophageal cancer cells Eca109. Figure 6 Figure B shows the effect of LNP-si-circPDK1 on the viability of KYSE70 esophageal cancer cells. Figure 7 The plate clone assay showed that LNP-si-circPDK1 inhibited the proliferation of esophageal cancer cells Eca109 and KYSE70; among which... Figure 7 A represents the inhibitory effect of LNP-si-circPDK1 on the proliferation of esophageal cancer cells Eca109. Figure 7 B represents the inhibitory effect of LNP-si-circPDK1 on the proliferation of KYSE70 esophageal cancer cells; Figure 8 Figure showing the experimental results of LNP-si-circPDK1 inhibiting the migration of esophageal cancer cells (*p<0.01); where... Figure 8 A shows the staining effect of LNP-si-circPDK1 on the migration of esophageal cancer cells Eca109 and KYSE70. Figure 8 B is a statistical bar chart showing the relative number of migrating cells inhibited by LNP-si-circPDK1 in esophageal cancer cells Eca109 and KYSE70; Figure 9 This is a graph showing the effect of LNP-si-circPDK1 on esophageal cancer tumor growth. Figure 9 A shows the changes in tumor volume. Figure 9 B is the volume change diagram. Figure 9 C is a graph showing changes in tumor weight. Figure 9 D is a graph showing the weight changes of nude mice. Detailed Implementation

[0016] The present invention will be further described below with reference to the embodiments and accompanying drawings, but the present invention is not limited to the following embodiments.

[0017] Example 1: Detection of differential expression of circPDK1 in esophageal cancer tissues and normal tissues This invention collected adjacent and cancerous tissues from 12 pairs of esophageal cancer patients (samples from the First Affiliated Hospital of Zhengzhou University) and detected the expression level of circPDK1 in adjacent and cancerous tissues using RT-qPCR. The results showed that, compared to adjacent tissues, the expression of circPDK1 in esophageal cancer tissues was significantly upregulated. Figure 1 ).

[0018] Example 2: Effects of circPDK1 on the proliferation, clonal expansion, and migration of esophageal cancer cells. A circPDK1 knockdown cell line was constructed using the shRNA method to knock down the expression level of the target RNA. For circPDK1, the knockdown target sequence across the circRNA splice site was analyzed using circinteractome (https: / / circinteractome.nia.nih.gov / ). The designed shRNA sequence and the oligonucleotide sequence used to construct the shRNA plasmid are shown in Table 1 below. The oligonucleotide sequence was synthesized by Beijing Qingke Biotechnology Co., Ltd. Complementary single-stranded oligonucleotides were annealed and renatured to form double-stranded DNA with sticky ends, which was then ligated into the pLKO.1 vector using T4 DNA ligase (the pLKO.1 vector was digested and recovered using AgeI and EcoRI enzymes). The ligation product was added to DH5α competent cells for transformation, positive clones were screened, and the cells were expanded into single cells for plasmid extraction.

[0019] Table 1. Oligonucleotide sequences used for constructing shRNA plasmids

[0020] The nucleotide sequence of the shRNA sh-circPDK1#1 is shown in SEQ ID NO: 2, and the nucleotide sequence of sh-circPDK1#2 is shown in SEQ ID NO: 3. The nucleotide sequence of the control shRNA sh-Ctrl is shown in SEQ ID NO: 1.

[0021] The shRNA sh-circPDK1#1 plasmid inhibiting circPDK1 expression was constructed from oligonucleotide sequences SEQ ID NO: 6 and SEQ ID NO: 7; the shRNA sh-circPDK1#2 plasmid inhibiting circPDK1 expression was constructed from oligonucleotide sequences SEQ ID NO: 8 and SEQ ID NO: 9; and the control shRNA sh-ctrl plasmid was constructed from oligonucleotide sequences SEQ ID NO: 4 and SEQ ID NO: 5. Lentiviral plasmids overexpressing circPDK1 were constructed using the lentiviral expression vector pLC5-ciR, and the lentiviral overexpression plasmids were synthesized by Shanghai Jierui Biotechnology Co., Ltd.

[0022] After successful construction of the sh-circPDK1#1 plasmid, the sequencing sequence is shown in SEQ ID NO: 10; after successful construction of the sh-circPDK1#2 plasmid, the sequencing sequence is shown in SEQ ID NO: 11; and the circPDK1 overexpression plasmid sequence is shown in SEQ ID NO: 12.

[0023] Lentiviral circPDK1 knockdown and overexpression plasmids and lentiviral packaging plasmids were transfected into 293T cells to prepare viral fluid. Esophageal cancer cells Eca109, KYSE450, and KYSE180 were infected with the viral fluid and screened with puromycin. Cells were then collected, total RNA was extracted, and circPDK1 expression levels were detected by RT-qPCR to verify the successful construction of knockdown and overexpression cell lines. The stable transfected cell lines were then subjected to CCK8 assays and plate colony assays to detect tumor cell proliferation. The results are as follows: Figure 2 As shown.

[0024] The results showed that knocking down circPDK1 inhibited cell proliferation and plate colony formation ability, while overexpression of circPDK1 promoted cell proliferation and plate colony formation ability. Figure 2 As shown in Figure A: Stable knockdown cells of circPDK1 were constructed in esophageal cancer cells Eca109. The expression of circPDK1 in Eca109 cells was detected by RT-qPCR. The results showed that circPDK1 was significantly reduced in Eca109 cells. Figure 2 B and Figure 2 As shown in Figure C, circPDK1 overexpressing cells were constructed in KYSE450 and KYSE180 cells. The expression of circPDK1 in KYSE450 and KYSE180 cells was detected by RT-qPCR. The results showed that circPDK1 expression was significantly increased in KYSE450 and KYSE180 cells. Figure 2As shown in D: Knockdown of circPDK1 inhibited cell viability in Eca109 cells in the CCK8 assay; Figure 2 E and Figure 2 F indicates that overexpression of circPDK1 enhances cell viability in KYSE450 and KYSE180 cells in the CCK8 assay. Figure 2 G and Figure 2 H shows that knockdown of circPDK1 inhibits cell cloning in Eca109 cells in a plate cloning assay; Figure 2 I and Figure 2 J showed that overexpression of circPDK1 enhanced the cloning ability of KYSE450 and KYSE180 cells in plate colony-forming assays. The results indicate that circPDK1 promotes cell proliferation and colony formation in esophageal cancer cells, playing a crucial role in the development and progression of esophageal cancer, while knockdown of circPDK1 inhibits the proliferation and cloning of esophageal cancer cells.

[0025] The effect of circPDK1 on esophageal cancer cell migration was investigated using Transwell assays. Results showed that knockdown of circPDK1 inhibited the migration ability of esophageal cancer cells, while overexpression of circPDK1 significantly enhanced their migration and invasion abilities. Figure 3 ).

[0026] Example 3: LNP-siRNA Preparation and Characterization A mixture of DSPC (10%), Dlin-MC3 (50%), cholesterol (38.5%), DMG-PEG (1.5%), and DSPE-PEG-iRGD (2%) was added to anhydrous ethanol until completely dissolved to obtain a 12.5 mM lipid-ethanol phase. circPDK1 siRNA was prepared into a 0.15 mg / mL siRNA solution (aqueous phase) with an N / P ratio of 6:1 using 0.05 M citrate buffer at pH 4.0, which served as the two-phase raw material. After preheating to 35°C, the mixture was instantaneously mixed via a microfluidic chip at a flow rate of 3:1 (total flow rate 12 mL / min) to form an initial LNP suspension. This suspension was then further centrifuged to replace the extracorporeal solution with PBS. After centrifugation, the supernatant was discarded, and the precipitate was resuspended in an equal volume of PBS (gently pipetting to avoid vigorous shaking that could break the LNP). This centrifugation and resuspension process was repeated 2-3 times to finally obtain the PBS-resuspended LNP-siRNA complex. The particle size and zeta potential of the complex were detected using a dynamic light scattering instrument.

[0027] The circPDK1 siRNA sequence is shown below: si-circPDK 1#1:GACUGUGAAGGAUCAGUGAAU (SEQ ID NO: 13); si-circPDK 1#2:GUGAAGGAUCAGUGAAUGCUU (SEQ ID NO: 14).

[0028] Experimental results show that the physicochemical properties of LNP-siRNA are as follows: Dynamic light scattering (DLS) results show a particle size of 150±5 nm and a Zeta potential of -3 mV. Figure 4 ).

[0029] Example 4: Detection of the effect of LNPs-si-circPDK1 on circPDK1 expression using RT-qPCR. To evaluate the inhibitory effect of LNPs-si-circPDK1 on circPDK1 expression in esophageal cancer cells, the effect of LNPs-si-circPDK1 on circPDK1 expression levels was detected by qRT-PCR. Esophageal cancer cells Eca109 and KYSE70 were seeded in six-well plates. After 24 hours, the cells were treated with serum-free media containing LNP-si-Ctrl and LNP-si-circPDK1, respectively, for 6 hours, followed by replacement with fresh medium. After 48 hours of culture, the cells were washed twice with PBS and TRIzol® lysis buffer (1 mL / 1*10⁻⁶ cells) was added. 6 Cells were lysed on ice for 5 minutes and collected into nuclease-free EP tubes. Chloroform (1 / 5 the volume of TRIzol®) was added, and the mixture was vigorously vortexed for 15 seconds and incubated on ice for 5 minutes. The mixture was centrifuged at 12,000 × g for 15 minutes at 4°C, and the supernatant was transferred to a new tube. An equal volume of isopropanol was added to precipitate the RNA, and the mixture was incubated at -20°C for 30 minutes. The mixture was centrifuged at 12,000 × g for 10 minutes at 4°C, the supernatant was discarded, and the precipitate was washed twice with 75% ethanol. After drying, the precipitate was dissolved in nuclease-free water, and the RNA concentration was determined (A260 / A280 should be between 1.8 and 2.1). The RNA was reverse transcribed into cDNA using a reverse transcription kit, and qPCR amplification was performed for data analysis.

[0030] The results are as follows Figure 5 As shown, in Eca109 and KYSE70 cell lines, both siRNAs (LNPs-si-circPDK1#1 and LNPs-si-circPDK1#2) significantly reduced the expression level of the circPDK1 gene, but the expression level of the PDK1 gene did not change significantly in either cell line. This demonstrates that the drug inhibits circPDK1 expression, and compared to the LNPs-Ctrl group, the LNPs-si-circPDK1 treatment showed a 60-70% inhibition rate of circPDK1 expression.

[0031] Example 5: Effect of LNPs-si-circPDK1 on the proliferation of esophageal cancer cells To assess the effect of the drugs on cell proliferation, the CCK8 assay was used. Esophageal cancer cells Eca109 and KYSE70 were seeded in six-well plates. After 24 hours, they were treated with serum-free medium containing LNP-si-Ctrl and LNP-si-circPDK1, respectively, for 6 hours, followed by replacement with fresh medium. After 48 hours of culture, the cells were washed twice with PBS, digested, centrifuged, and seeded into 96-well plates (1000 cells / well) and incubated in a cell culture incubator (37℃, 5% CO2). CCK8 assay: After 12 hours, 10 μL of CCK8 reagent was added to the first row of cells, and the cells were incubated for 2 hours. The absorbance at 450 nm was measured using a microplate reader and marked as 0 hours. 24 hours later, 10 μL of CCK8 reagent was added to the second row of cells, and the absorbance was measured and marked as 12 hours. 48 hours later, 10 μL of CCK8 reagent was added to the third row of cells, and the absorbance was measured and marked as 24 hours. 10 μL of CCK8 reagent was added at 72 and 96 hours, and the absorbance was measured and marked as 48 hours and 72 hours, respectively. Finally, all values ​​were statistically analyzed.

[0032] The results are as follows Figure 6 and Figure 7 As shown, in both Eca109 and KYSE70 esophageal cancer cell lines, the use of LNP-encapsulated siRNAs targeting circPDK1 (LNP-si-circPDK1#1 and LNP-si-circPDK1#2) significantly inhibited the relative cell activity, and this inhibitory effect persisted for 96 hours. In contrast, the control group (LNP-Ctrl) showed significantly higher relative cell activity, indicating that inhibiting circPDK1 expression can effectively suppress the proliferation of esophageal cancer cells. Compared with the control group LNP-si-Ctrl, LNP-si-circPDK1 significantly inhibited the proliferation of esophageal cancer cells.

[0033] Example 6: Effect of LNPs-si-circPDK1 on the migration ability of esophageal cancer cells To assess the effect of the drugs on cell migration, a Transwell migration assay was used. Esophageal cancer cells Eca109 and KYSE70 were seeded in six-well plates. After 24 hours, the cells were treated with serum-free media containing LNP-si-Ctrl and LNP-si-circPDK1, respectively, for 6 hours, followed by replacement with fresh medium. After 48 hours of culture, the cells were washed twice with PBS, digested, centrifuged, resuspended in the medium, counted, and the cell concentration was adjusted to 2 × 10⁶ cells / well. 4 / 200μL. Cell seeding: Add 200μL of cell suspension to the upper chamber of the Transwell and 800μL of DMEM medium containing 5% serum to the lower chamber. After ensuring there are no air bubbles in the chamber and at the bottom, incubate at 37°C and 5% CO2 for 24 hours. Staining, fixation, and photography: Remove the chamber, gently wipe away the cells on the upper surface of the chamber with a moistened cotton swab, wash with PBS, and fix the chamber with methanol for 10 minutes. Discard the methanol, stain with 0.1% crystal violet for 15 minutes, and wash the chamber with PBS. Randomly photograph five fields of view under a microscope and count the cells. Perform subsequent statistical analysis using Graphpad software.

[0034] like Figure 8 As shown, compared with the control group, the number of migrating cells in the LNP-si-circPDK1 group was reduced by 60-70%, indicating that LNP-si-circPDK1 significantly inhibited the migration ability of esophageal cancer cells. Figure 8 ).

[0035] Example 7: Effects of LNPs-si-circPDK1 on esophageal cancer xenografts (in vivo experiment) A subcutaneous xenograft model of esophageal cancer cells (Eca109) was constructed in nude mice. When the tumor reached 80 mm... 3 At the left and right lateral positions, PBS, LNP-Ctrl, and LNP-si-circPDK1 (si-circPDK1#2) were injected via the tail vein, respectively. The size of the tumor and the weight of the tumor-bearing nude mice were measured. After seven administrations, the nude mice were euthanized, the tumors were removed, and their weight was measured.

[0036] like Figure 9 As shown, compared with the PBS and LNP-si-Ctrl treatment groups, the tumor growth volume in the LNP-si-circPDK1 group ( Figure 9 A and Figure 9 B) Decrease in size and tumor weight ( Figure 9 C) was significantly reduced, indicating that LNP-si-circPDK1 significantly inhibited esophageal cancer tumor growth, and there was no significant change in body weight of nude mice after LNP-si-circPDK1 treatment. Figure 9 D).

Claims

1. The use of an agent that targets and inhibits circPDK1 in the preparation of an anti-esophageal cancer drug, characterized in that: The reagent is siRNA or shRNA for targeted inhibition of expression of the circPDK1 gene.

2. Use according to claim 1, characterized in that: The nucleotide sequence of the siRNA for targeted inhibition of expression of the circPDK1 gene is shown in SEQ ID NO: 13 or SEQ ID NO:

14.

3. Use according to claim 1, characterized in that: The nucleotide sequence of the shRNA for targeted inhibition of expression of the circPDK1 gene is shown in SEQ ID NO: 2 or SEQ ID NO:

3.

4. Use according to claim 3, wherein the compound is ###0002### The shRNA expression plasmid for targeted inhibition of expression of the circPDK1 gene is constructed from the oligonucleotide sequences SEQ ID NO: 6 and SEQ ID NO: 7, or from the oligonucleotide sequences SEQ ID NO: 8 and SEQ ID NO:

9.

5. An anti-esophageal cancer drug, characterized by comprising the compound of claim 1 or 2. An effective amount of the siRNA or shRNA for targeted inhibition of expression of the circPDK1 gene as claimed in any one of claims 2-4, and a pharmaceutically acceptable carrier.

6. An LNP-siRNA for treating esophageal cancer, characterized by, The siRNA for targeted inhibition of expression of the circPDK1 gene as claimed in claim 1, and a lipid nanoparticle.

7. The LNP-siRNA for treating esophageal cancer according to claim 6, wherein the siRNA is selected from the group consisting of SEQ ID NOs: 1 to 4. The lipid nanoparticle is composed of ionizable lipid, cholesterol, DSPC, and PEG lipid, DSPE-PEG-iRGD, with a molar ratio of 50:38.5:10:1.5:2, and the ionizable lipid is DLin-MC3-DMA.

8. The LNP-siRNA for treating esophageal cancer according to claim 7, wherein, The particle size is 80-120 nm, and the encapsulation efficiency is ≥95%.

9. The preparation method of the LNP-siRNA as claimed in any one of claims 6-8, comprising the following steps: S1: mixing DSPC, Dlin-MC3, cholesterol, DMG-PEG, and DSPE-PEG-iRGD in a molar ratio of 10:50:38.5:1.5:2 in anhydrous ethanol until completely dissolved to obtain a 12.5 mM lipid ethanol phase; taking circPDK1 siRNA, and preparing a 0.15 mg / mL siRNA aqueous phase solution with an N / P ratio of 6:1 using a 0.05 M citric acid buffer with a pH of 4.0, preheating to 35℃, and then instantaneously mixing the aqueous phase and the lipid phase at a flow rate ratio of 3:1 through a microfluidic chip at a total flow rate of 12 mL / min to form an LNP primary suspension and further centrifuging to replace the external liquid with PBS, discarding the supernatant after centrifugation, resuspending the precipitate with an equal volume of PBS, repeating the centrifugation and resuspension 2-3 times, and finally obtaining an LNP-siRNA complex; S2: ultrafiltration purification to obtain a nanoparticle with a particle size of 80-120 nm, a PDI of <0.2, and an encapsulation efficiency of >95%.

Images