DsRNA fragment for improving content of wheat amylopectin as well as synthesis method and application of dsRNA fragment

Abstract

The invention discloses a dsRNA fragment capable of improving wheat amylopectin content and a synthesis method and application thereof, and relates to the field of wheat starch content regulation, pET28a is used as an initial skeleton, a sequence containing a reverse T7 promoter, multiple cloning sites and ISA1 or ISA2 gene fragment is inserted, a recombinant vector is constructed through restriction enzyme digestion connection of restriction enzymes SalI and EcoRI, and the recombinant vector is used as a recombinant vector for improving wheat amylopectin content. And transforming the recombinant expression vector into an escherichia coli HT115 competent cell, and synthesizing the dsRNA fragment after induced expression. According to the invention, a non-transgenic transient silencing technology is adopted, and target gene expression is inhibited in a targeted manner, so that the problems of long period, low efficiency, dependence on complex gene cloning and vector construction processes and potential off-target effect and ecological risk existing in the traditional gene technology are avoided.

Description

Technical Field

[0001] This invention relates to the field of wheat starch content regulation, specifically to a dsRNA fragment for increasing wheat amylopectin content, its synthesis method, and its application. Background Technology

[0002] Wheat, as one of the world's most important food crops, is a core source of energy and nutrition for billions of people. Its grain quality is directly related to food security, the development of the food industry, and agricultural economic value. Starch accounts for 65%-80% of the dry matter composition of wheat grains and is a key component determining wheat processing characteristics (such as cooking and baking quality) and taste. The physicochemical properties and functions of starch are mainly determined by the ratio of amylose to amylopectin. Increasing the amylopectin content can significantly improve the softness, viscosity, and water retention of wheat products, meeting the quality requirements of high-end noodles, steamed buns, and other staple foods and pastries. Therefore, targeted improvement of wheat amylopectin content has become one of the core objectives in the field of crop quality improvement.

[0003] In the molecular regulatory network of plant starch synthesis, DBE is a key functional gene. Its main function is to specifically hydrolyze the α-1,6 glycosidic bonds in amylopectin molecules. By removing some branches formed during starch synthesis, it regulates the molecular structure and fine arrangement of amylopectin, directly affecting the balance of amylose and amylopectin ratio in the final starch composition. Therefore, precise regulation of DBE gene expression has become a core breakthrough for targeted optimization of wheat starch composition and increasing amylopectin content.

[0004] However, traditional wheat quality breeding techniques (such as hybridization breeding and mutation breeding) have significant limitations: on the one hand, it is difficult to achieve precise targeted regulation of the DBE gene, which can easily introduce undesirable traits due to linkage genetic effects, and the breeding cycle can take several to more than ten years, resulting in low efficiency; on the other hand, although conventional transgenic technology can achieve gene function regulation, it relies on a complex gene cloning and genome integration process, which is not only cumbersome and costly, but may also have off-target effects of exogenous genes and potential ecological risks. Its application is also subject to strict regulatory restrictions, making it difficult to promote on a large scale. Summary of the Invention

[0005] This invention provides a dsRNA fragment for increasing the amylopectin content of wheat, its synthesis method, and its application. It employs a non-transgenic transient silencing technology to target and inhibit the expression of the target gene, thus avoiding the long cycle, low efficiency, reliance on complex gene cloning and vector construction processes, and potential off-target effects and ecological risks of traditional gene technologies.

[0006] To achieve the above objectives, the specific solution adopted by the present invention is as follows: a dsRNA fragment for increasing the amylopectin content of wheat, wherein the dsRNA fragment contains at least one of two gene fragments, ISA1 and ISA2, the sequence of ISA1 is shown in SEQ ID NO.1, and the sequence of ISA2 is shown in SEQ ID NO.2.

[0007] A method for synthesizing a dsRNA fragment that increases the amylopectin content of wheat involves using pET28a as the initial backbone, inserting a sequence containing a reverse T7 promoter, a multiple cloning site, and an ISA1 or ISA2 gene fragment, constructing a recombinant vector by digestion and ligation with restriction endonucleases SalI and EcoRI, transforming the recombinant expression vector into Escherichia coli HT115 competent cells, and synthesizing the dsRNA fragment after induction of expression.

[0008] As a further optimization of the above technical solution, the following steps are included:

[0009] S1. Expression vector construction: Using the vector pET28a as the initial backbone, double digestion was performed using restriction endonucleases SalI and EcoRI. At the same time, a gene sequence of 113 bp in length containing the inverted T7 promoter and multiple cloning site was inserted to construct the dsRNA expression vector pRNAi for later use.

[0010] S2. PCR amplification: Using cDNA from wheat leaves or grains as templates, specific primer pairs were used to amplify the ISA1 and ISA2 gene fragments, respectively.

[0011] S3. Enzyme digestion and ligation: The pRNAi vector constructed in step S1 and the PCR amplification product obtained in step S2 were double-digested using restriction endonucleases SalI and EcoRI, respectively, to obtain a vector fragment with complementary sticky ends and a gene fragment; the vector fragment and the gene fragment were ligated under the catalysis of ligase to obtain a recombinant vector.

[0012] S4. Transformation and Induction of Expression: The recombinant vector obtained in step S3 was transformed into Escherichia coli HT115 competent cells, and colony PCR was performed after culture. Positive colonies were picked and inoculated into liquid culture medium, and an inducer was added to induce T7 RNA polymerase expression, which was then transcribed to generate dsRNA.

[0013] S5. dsRNA extraction and purification: Collect the bacterial culture after induction and expression, centrifuge, and discard the supernatant; resuspend the precipitate in SDS aqueous solution, incubate, centrifuge, and collect the supernatant to obtain the purified dsRNA fragment.

[0014] As a further optimization of the above technical solution, in step S2, the specific primer pairs include ISA1-F: GCTCCCATGACCCGCTAT, ISA1-R: CACGAGTTGCCAACACCC, and ISA2-F: TGGAGGTCTTTATCTAGTAGGG, ISA2-R: GTGGTCGTGTATCGTGAATGC.

[0015] As a further optimization of the above technical solution, in step S3, the ligase is T4 DNA ligase.

[0016] As a further optimization of the above technical solution, in step S4, the culture time after the recombinant vector obtained in step S3 is transferred into Escherichia coli HT115 competent cells is 16h.

[0017] As a further optimization of the above technical solution, in step S4, the inducing agent is IPTG.

[0018] As a further optimization of the above technical solution, in step S5, the bacterial culture after induced expression is collected, centrifuged at 12000 rpm for 2 min, and the supernatant is discarded; the precipitate is resuspended in 1 mL of 0.2% SDS aqueous solution, incubated at 80℃ for 20 min, centrifuged at 12000 rpm for 5 min, and the supernatant is collected to obtain the purified dsRNA fragment.

[0019] An application of the above-mentioned dsRNA fragment in increasing the amylopectin content of wheat.

[0020] As a further optimization of the above technical solution, the above-mentioned dsRNA fragment is sprayed onto the wheat leaves during the grain-filling stage.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The dsRNA fragments (ds-ISA1, ds-ISA2) designed in this invention specifically target the ISA2a gene in the wheat DBE gene family. Their nucleotide sequences are precisely complementary to specific regions of the target gene. Through RNAi technology, they silence only the DBE gene expression without affecting the function of other unrelated genes in the wheat genome, thus avoiding starch metabolism disorders caused by non-targeted interference. The DBE gene normally regulates amylopectin structure by hydrolyzing α-1,6 glycosidic bonds. The dsRNAs of this invention can effectively inhibit DBE gene function, ultimately significantly increasing the amylopectin content in wheat while simultaneously decreasing the amylose content, achieving precise optimization of the starch composition ratio and directly improving wheat processing quality.

[0023] Unlike traditional transgenic technology, which requires the integration of exogenous genes into the wheat genome, this invention employs non-transgenic dsRNA transient silencing technology. It achieves regulatory effects by temporarily suppressing DBE gene expression (efficient silencing can be achieved within 1-2 weeks), without altering the wheat genome structure. This avoids potential ecological risks such as off-target effects and gene drift, and also meets stringent biosafety regulatory requirements. The application method utilizes SIGS technology, allowing for direct foliar spraying of dsRNA during the wheat grain-filling stage. It eliminates the need for complex genetic transformation procedures, simplifying the process, reducing time consumption, and facilitating large-scale field application.

[0024] This invention significantly reduces production costs while increasing dsRNA yield, successfully overcoming the technical bottleneck of large-scale production. It successfully achieves targeted regulation of the wheat starch debranching enzyme gene ISA2a, accompanied by a significant change in the amylose to amylopectin ratio. It provides a specific, efficient, and easily scalable dsRNA fragment that can significantly increase the amylopectin content of wheat grains while maintaining excellent agronomic traits. Attached Figure Description

[0025] Figure 1 These are the sequences of the two gene fragments ISA1 and ISA2 in this invention;

[0026] Figure 2 This is a diagram showing the main components of wheat leaves after spraying ds-ISA1 and 2 in Example 3 of the present invention; where (a) is a picture of spraying during the seedling stage in the experimental field; (b) is the relative expression level of the TaISA2a gene; (c) is the starch content in wheat leaves; (d) is the protein content in wheat leaves; (e) is the fatty acid content in wheat leaves; (f) is the total sugar content in wheat leaves; (g) is the amylose in leaves treated with dsRNA; and (h) is the amylopectin in leaves treated with dsRNA. ** in the table indicates a significant correlation at the 0.01 level.

[0027] Figure 3 The table shows the expression levels of wheat synthesis-related genes after spraying ds-ISA2 in Example 3 of this invention; (a) starch metabolism network diagram; (b) qRT-PCR detection of gene expression in treated leaves on day 3; (c) qRT-PCR detection of gene expression in treated leaves on day 7. ** in the table indicates a significant correlation at the 0.01 level.

[0028] Figure 4The following figures show the results of wheat grain content after spraying ds-ISA1 and 2 in Example 4 of this invention: (a) Spraying image of the experimental field during the grain-filling stage; (b) Images of wheat grains in the control group and after spraying dsRNA; (c) Starch content in wheat grains; (d) Protein content in wheat grains; (e) Fatty acid content in wheat grains; (f) Dry weight of 1000 wheat grains under different treatments; (g) Amylose content in dsRNA-treated grains; (h) Amylopectin content in dsRNA-treated grains; ** in the table indicates a significant correlation at the 0.01 level. Detailed Implementation

[0029] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. Parts not described or disclosed in detail in the following embodiments of the present invention should be understood as prior art known or should be known by those skilled in the art. In the following genes or dsRNAs, "Ta" is an abbreviation for "Triticum aestivum," representing wheat.

[0030] Example 1

[0031] This invention discloses a dsRNA fragment that increases the amylopectin content of wheat. The dsRNA fragment contains at least one of two gene fragments, ISA1 and ISA2. Both ISA1 and ISA2 can silence the DBE gene in wheat.

[0032] The sequence of ISA1 is shown in SEQ ID NO.1, and the sequence of ISA2 is shown in SEQ ID NO.2.

[0033] SEQ ID NO.1:

[0034] GCTCCCATGACCCGCTATGCAAGTGCTGGTGGTGGACCATTGGCT GCTTCCAGAGAGCTCAAGCAGATGGTCAAGGCATTGCATAAAGCTGGTATAGAGGTTATTCTGGACGTCGTTTACAACCATACGAATGAAGCAGATGATGCTAATCCTTATGTTACTTCTTTCCGTGGCATCGACAACAAGGTTTATTACATGTTAGATCCAAAGAACAACTCTCAACTGCTGAACTTCTCGGGATGCGGGAATACACTAAACTGCAACCATCCTGTTGTCATGGAACTCGTACTCGACAGCTTGAGACATTGGGTTAAGGAGTATCACATAGATGGATTTCGGTTTGACCTTGCAAGTGTTCTTTGTCGTGGACCAGATGGTAGTCCTCTTGATGCTCCTCCACTCATCAGGGAAATTGCCAAAGATTCTGTGTTATCTCGATGCAAGATAATTGCTGAACCTTGGGATTGTGGAGGTCTTTATCTAGTAGGGCGTTTCCCTAACTGGGACAGGTGGGCTGAATGGAATGGAAAGTACAGAGACGATCTTCGAAGGTTCATCAAGGGTGACCCTGGTATGAAGGGGGTGTTGGCAACTCGTG。

[0035] SEQ ID NO.2:

[0036] TGGAGGCTTTATCTAGTAGGGCGTTTCCCTAACTGGGACAGGTG.

[0037] Example 2

[0038] This invention also discloses a method for synthesizing dsRNA fragments that increase the amylopectin content of wheat. The CDS sequence of the ISA gene was found in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), and finally two sequences at different sites in the ISA2a gene were selected as interference targets, namely the two gene fragments ISA1 and ISA2.

[0039] Using pET28a as the initial backbone, a sequence containing a reverse T7 promoter, a multiple cloning site, and an ISA1 or ISA2 gene fragment is inserted. The recombinant vector is constructed by digestion and ligation with restriction endonucleases SalI and EcoRI. The recombinant expression vector is transformed into E. coli HT115 competent cells, and the above-mentioned dsRNA fragment is synthesized after induction of expression. This method has low production cost and high yield, and is suitable for large-scale preparation.

[0040] This invention constructs a recombinant vector for stable dsRNA production based on the wheat DBE gene. Using RNAi technology, precise targeted inhibition of this gene expression is achieved, while simultaneously meeting the requirements of low cost and high yield. Furthermore, it opens up a completely new pathway for dsRNA technology in optimizing crop quality, demonstrating its enormous potential in agricultural technological innovation and crop genetic improvement.

[0041] Specifically, the synthesis method includes the following steps:

[0042] S1. Expression vector construction: Using the vector pET28a as the initial backbone, double digestion was performed using restriction endonucleases SalI and EcoRI. At the same time, a gene sequence of 113 bp in length containing the inverted T7 promoter and multiple cloning site was inserted to construct the dsRNA expression vector pRNAi for later use.

[0043] S2. PCR amplification: Using cDNA from wheat leaves or grains as templates, specific primer pairs were used to amplify the ISA1 and ISA2 gene fragments, respectively. The specific primer pairs included ISA1-F: GCTCCCATGACCCGCTAT, ISA1-R: CACGAGTTGCCAACACCC, and ISA2-F: TGGAGGTCTTTATCTAGTAGGG, ISA2-R: GTGGTCGTGTATCGTGAATGC.

[0044] S3. Enzyme digestion and ligation: The pRNAi vector constructed in step S1 and the PCR amplification product obtained in step S2 were double-digested using restriction endonucleases SalI and EcoRI, respectively, to obtain a vector fragment with complementary sticky ends and a gene fragment; the vector fragment and the gene fragment were ligated under the catalysis of T4 DNA ligase to achieve gene cloning and obtain a ligation solution containing the recombinant vector.

[0045] S4. Transformation and Induction of Expression: 5 μL of the ligation solution obtained in step S3 was transformed into Escherichia coli HT115 competent cells and cultured continuously for 16 h before colony PCR verification. Positive colonies were picked and inoculated into liquid culture medium, and IPTG (isopropyl-β-D-thiogalactoside) was added to induce T7 RNA polymerase expression, which was then transcribed into dsRNA.

[0046] S5. dsRNA Extraction and Purification: Collect the induced bacterial culture for extraction and purification. The specific steps are as follows: Transfer 1 mL of bacterial culture to a 2 mL centrifuge tube, centrifuge at 12000 rpm for 2 minutes, and discard the supernatant. Resuspend the precipitate in 1 mL of 0.2% SDS aqueous solution, incubate at 80℃ for 20 min, centrifuge at 12000 rpm for 5 min, transfer the supernatant to a new centrifuge tube, and perform electrophoresis on a 0.8% agarose gel to obtain the purified dsRNA fragment.

[0047] This invention also provides the application of dsRNA fragments in increasing the amylose content of wheat. By constructing a dsRNA expression vector and applying the dsRNA fragments via foliar spraying using SIGS technology, ds-ISA1 and ds-ISA2 were sprayed onto wheat experimental fields during the grain-filling stage. Compared with wheat that was not sprayed with dsRNA, the amylopectin content of wheat sprayed with ds-ISA1 and ds-ISA2 was significantly increased.

[0048] This invention utilizes dsRNA-specific target gene silencing to apply dsRNA to wheat. By temporarily inhibiting gene expression, efficient silencing of the ISA gene can be achieved rapidly within 1-2 weeks without genome integration. Foliar spraying using SIGS technology provides sustainable and environmentally friendly disease control and effective crop protection. dsRNA can penetrate the wheat epidermal barrier, significantly improving silencing efficiency compared to traditional methods, thereby increasing amylopectin content in wheat grains and improving starch quality. This discovery provides a unique perspective for in-depth analysis of the molecular mechanisms of starch synthesis and lays a solid theoretical foundation for improving crop quality through metabolic engineering.

[0049] Example 3

[0050] During the wheat grain-filling stage, two dsRNA fragments from Example 1, namely ds-ISA1 and ds-ISA2, were sprayed. Samples taken at days 1, 3, 5, and 7 were amplified by qRT-PCR using TaISA2a external reference primers. Figure 2This is a sequence diagram analyzing the main components of wheat leaves. Both dsRNAs designed in this experiment produced short-term inhibitory effects on the expression of target genes in wheat leaves, with the most significant gene silencing effect observed in the first three days of the experiment. Protein, fat, and soluble sugar content showed no significant changes compared to the control. Iodine colorimetric assay of amylose solution revealed a significant increase in starch content in wheat leaves sprayed with dsRNA seven days after the initial treatment compared to the control. On the third day, after significant inhibition by ISA, amylose synthesis in leaves showed a significant decreasing trend compared to the control, while amylopectin content in wheat leaves showed an increasing trend on both the third and seventh days. Due to the accumulation of amylopectin, the proportion of amylose is relatively reduced. This functional defect can directionally alter the physicochemical properties of starch, providing a theoretical basis for the development of high-amylose varieties, stress resistance improvement, and functional foods.

[0051] Observe the structure of the starch metabolism network. Figure 3 This is a sequence diagram analyzing the expression levels of genes related to starch synthesis in wheat leaves. The analysis was performed using qRT-PCR. Under dsRNA-mediated gene silencing, compared to the control, spraying ds-ISA1 and ds-ISA2, after 3 days, interfered with the relative expression of starch synthesis genes TaAGPS, TaSBE2b2, TaPUL1, TaSSII, TaSSⅣ, TaDPEⅠ, TaGWⅠ, and TaAMY, while promoting TaPKⅠ expression. By day seven, due to the weakening effect of dsRNA, the relative expression of TaAGPS, TaPUL1, and TaSBE2b gradually recovered.

[0052] Example 4

[0053] In a wheat field trial, ds-ISA1 and ds-ISA2 were sprayed during the wheat grain-filling stage. Figure 4 This is a sequence of chromatograms showing the analysis results of wheat grain content. Samples treated with dsRNA and those not sprayed with dsRNA were used as controls. The results showed that spraying with ds-ISA2 significantly increased the starch content of wheat seeds, while the protein and fat contents remained essentially unchanged compared to the control. While spraying with ds-ISA1 did not alter the starch and fat contents, it did increase the protein content. Both dsRNA sprays increased the thousand-grain weight, with no significant change in amylose content. The amylopectin content in mature seeds sprayed with ds-ISA2 was significantly higher than the control. Therefore, the amylopectin content obtained in this example after spraying with dsRNA was significantly higher than the control, which is of significant value for precisely targeting and inhibiting its expression and improving wheat quality.

[0054] It should be noted that ds-TaISA2 in the attached diagram is ds-ISA2, and ds-TaISA1 is ds-ISA1.

[0055] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A dsRNA fragment for increasing the amylopectin content of wheat, characterized in that, The dsRNA fragment comprises at least one of ISA1 and ISA2 gene fragments, the sequence of ISA1 is shown as SEQ ID NO. 1, and the sequence of ISA2 is shown as SEQ ID NO.

2.

2. The method for synthesizing dsRNA fragments to increase the amylopectin content of wheat according to claim 1, characterized in that, The recombinant vector is constructed by inserting a sequence comprising a reverse T7 promoter, a multiple cloning site and an ISA1 or ISA2 gene fragment into pET28a as an initial skeleton and then performing restriction enzyme SalI and EcoRI enzyme digestion and ligation, the recombinant vector is transformed into E. coli HT115 competent cells, and the dsRNA fragment of claim 1 is synthesized after induction and expression.

3. The method for synthesizing dsRNA fragments to increase the amylopectin content of wheat according to claim 2, characterized in that, The method comprises the following steps: S1, expression vector construction: using the vector pET28a as an initial skeleton, performing double enzyme digestion using restriction enzymes SalI and EcoRI, and inserting a gene sequence with a length of 113 bp and comprising a reverse T7 promoter and a multiple cloning site, to construct a dsRNA expression vector pRNAi for standby use; S2, PCR amplification: using cDNA of wheat leaves or grains as a template, ISA1 and ISA2 gene fragments are amplified respectively using specific primer pairs; S3, enzyme digestion and ligation: performing double enzyme digestion on the pRNAi vector constructed in step S1 and the PCR amplification product obtained in step S2 using restriction enzymes SalI and EcoRI respectively to obtain a vector fragment and a gene fragment with complementary cohesive ends; under the catalysis of a ligase, the vector fragment and the gene fragment are connected to obtain a recombinant vector; S4, transformation and induction expression: the recombinant vector obtained in step S3 is transformed into E. coli HT115 competent cells, and after culture, colony PCR verification is performed; positive colonies are inoculated into a liquid culture medium, an inducer is added to induce T7 RNA polymerase expression, and then transcription generates dsRNA; S5, dsRNA extraction and purification: after induction and expression, the bacterial liquid is collected, centrifuged, and the supernatant is discarded; the precipitate is resuspended in an SDS aqueous solution, incubated, centrifuged, and the supernatant is collected, thereby obtaining purified dsRNA fragments.

4. The method for synthesizing dsRNA fragments to increase the amylopectin content of wheat according to claim 3, characterized in that, In step S2, the specific primer pairs comprise ISA1-F: GCTCCCATGACCCGCTAT, ISA1-R: CACGAGTTGCCAACACCC, ISA2-F: TGGAGGTCTTTATCTAGTAGGG, and ISA2-R: GTGGTCGTGTATCGTGAATGC.

5. The method for synthesizing dsRNA fragments to increase the amylopectin content of wheat according to claim 3, characterized in that, In step S3, the ligase is T4 DNA ligase.

6. The method for synthesizing dsRNA fragments to increase the amylopectin content of wheat according to claim 3, characterized in that, In step S4, the culture time of the recombinant vector obtained in step S3 after being transformed into E. coli HT115 competent cells is 16 h.

7. The method for synthesizing dsRNA fragments to increase the amylopectin content of wheat according to claim 3, characterized in that, In step S4, the inducer is IPTG.

8. The method for synthesizing dsRNA fragments to increase the amylopectin content of wheat according to claim 3, characterized in that, In step S5, after induction and expression, the bacterial liquid is collected, centrifuged at 12000 rpm for 2 min, and the supernatant is discarded; the precipitate is resuspended in 1 mL of 0.2% SDS aqueous solution, incubated at 80°C for 20 min, centrifuged at 12000 rpm for 5 min, and the supernatant is collected, thereby obtaining purified dsRNA fragments.

9. Application of the dsRNA fragment of claim 1 to increasing amylopectin content of wheat.

10. Use of a dsRNA fragment according to claim 9 for increasing amylopectin content in wheat, characterized in that, Spraying the dsRNA fragment as claimed in claim 1 to the leaf surface of wheat in the grouting period.

Images