Application of transgenic zebrafish in preparation of animal model capable of visually monitoring mast cells
By constructing a transgenic model of EGFP driven by the cpa5 promoter in zebrafish, the problems of mast cell stability, specific fluorescent labeling, and dynamic tracking were solved, enabling in vivo visualization and dynamic observation of mast cells, which is applicable to various disease models and drug screening studies.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-14
- Publication Date
- 2026-05-15
AI Technical Summary
Current technologies cannot achieve stable, specific fluorescent labeling and dynamic tracking of mast cells in zebrafish, thus failing to meet the observation needs from embryonic development to adult stages, and lack effective transgenic models.
A transgenic zebrafish model with cpa5 promoter-driven fluorescent protein expression was constructed. The cpa5 gene promoter sequence was integrated into a recombinant plasmid of the fluorescent protein gene EGFP in the early embryonic stage of zebrafish. The Tol2 transposition system was used to achieve stable integration of the exogenous gene into the genome, and Tg(cpa5:EGFP) transgenic zebrafish were obtained.
It achieves highly specific, visual labeling and long-term tracking of mast cells, enabling real-time observation in vivo. It is suitable for various disease models and drug screening studies, improving research efficiency and accuracy.
Smart Images

Figure CN122038477A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical research technology, and specifically relates to the application of a transgenic zebrafish in the preparation of an animal model that can visualize and monitor mast cells. Background Technology
[0002] Mast cells are a type of immune cell derived from hematopoietic stem cells, widely distributed in barrier tissues such as the skin, intestines, and respiratory tract, playing a crucial role in allergic reactions, parasitic infections, inflammation regulation, and tissue homeostasis. Mast cells are rich in inflammatory mediators such as histamine and proteases, and their abnormal activation is closely related to various diseases, including allergic asthma, atopic dermatitis, anaphylactic shock, fibrosis, and immune dysregulation (Kirshenbaum, AS, et al., Demonstration That Human Mast Cells Arise From a Progenitor Cell Population That Is CD34+, c-kit+, and Expresses Aminopeptidase N (CD13). Blood, 1999. 94(7): p. 2333-2342.). However, due to the scarcity and dispersed distribution of mast cells in mammals, and the difficulty in observing them using traditional imaging methods, many gaps remain regarding their occurrence, differentiation, migration, and functional regulation mechanisms.
[0003] Zebrafish (Danio rerio), as a classic vertebrate model, possesses advantages such as developmental transparency, high reproductive capacity, high gene homology (approximately 70% homology with human genes), in vitro embryonic development, and suitability for genetic manipulation. Therefore, it is widely used in research on immune development, hematologic diseases, and drug screening (Xia, J., et al., Activation of lineage competence in hemogenic endothelium precedes the formation of hematopoietic stem cell heterogeneity. Cell Res, 2023. 33(6): p. 448-463. Prykhozhij, SV and JN Berman, The progress and promise of zebrafish as a model to study mast cells. Developmental&Comparative Immunology, 2014. 46(1):p. 74-83.). In recent years, the development of gene editing and transgenic technologies has enabled scientists to visually observe the spatial localization and dynamic changes of specific cell types through fluorescent labeling. However, while fluorescent dyes (such as anti-IgE antibodies labeled with Alexa Fluor 488) can achieve short-term labeling, they have problems such as cytotoxicity (affecting mast cell survival and migration) and rapid fluorescence decay (unable to track for more than 72 hours), which cannot meet the observation needs of mast cells from embryonic development to adult fish stage. Moreover, no transgenic model has yet been found that is specifically used to label zebrafish mast cells. Most existing models rely on small molecule dyes or non-specific labels, which cannot accurately track the behavioral changes of mast cells under physiological or pathological conditions.
[0004] Studies have shown that carboxypeptidase A5 ( cpa5) can serve as a specific marker gene for zebrafish mast cells (Dobson, JT, et al., Carboxypeptidase A5 identifies a novel mast cell lineage in the zebrafish providing new insight into mast cell fate determination. Blood, 2008. 112(7): p. 2969-2972. Da'as, S., et al., Zebrafish mast cells possess an FcɛRI-like receptor and participate in innate and adaptive immune responses. Developmental & Comparative Immunology, 2011. 35(1): p. 125-134. Da'as, SI, et al., The zebrafish reveals dependence of the mast cell lineage on Notch signaling in vivo. Blood, 2012. 119(15): p. 3585-3594.). Although cpa5 Genes are considered to be highly associated with mast cells, but the specific sequence composition of their promoter regions, regulatory elements, and their ability to mediate cell type-specific expression in vivo have not been systematically reported, and existing technologies lack the capacity to utilize them. cpa5 Technical solutions for constructing stable transgenic models using gene promoters. Therefore, obtaining regulatory sequences that can stably and specifically drive mast cell fluorescent labeling in zebrafish, given the lack of promoter sequence information and unclear regulatory mechanisms, remains a technical challenge for those skilled in the art. Against this backdrop, constructing a... cpa5 Transgenic zebrafish with promoter-driven fluorescent protein expression, and its application to the visualization of mast cells and monitoring of drug responses, will break through the limitations of traditional research methods and provide important technical support for the study of mast cell physiology, immune function and pathological mechanisms. Summary of the Invention
[0005] The primary objective of this invention is to overcome the shortcomings and deficiencies of the prior art and to provide an application of transgenic zebrafish in the preparation of an animal model that can visualize and monitor mast cells.
[0006] Another object of the present invention is to provide the use of the aforementioned transgenic zebrafish in screening for drugs effective against mast cell-related diseases.
[0007] The objective of this invention is achieved through the following technical solution: An application of a transgenic zebrafish in the preparation of an animal model capable of visually monitoring mast cells, wherein the transgenic zebrafish is prepared by the following method: (1) As shown in SEQ ID NO: 1 cpa5 The gene promoter sequence was digested with XhoI and BamHI to obtain the target gene sequence; the plasmid containing the fluorescent protein gene and the Tol2 transposon recognition site was digested with XhoI and BamHI to obtain a linearized vector; the target gene sequence was ligated into the linearized vector to obtain a recombinant plasmid. (2) The recombinant plasmid and Tol2 transposase mRNA were introduced into the zebrafish embryo at the 1-cell stage of embryonic development by microinjection (under the action of transposase, the gene DNA fragment between the two Tol2 recognition site sequences on the transgenic vector was integrated into the zebrafish genome), and transgenic zebrafish embryos were obtained. (3) The transgenic zebrafish embryos were placed in a constant temperature incubator to obtain the transgenic zebrafish (F0 generation).
[0008] The steps described in step (1) cpa5 Gene promoters can be obtained from the zebrafish genome via PCR amplification. The specific steps are as follows: First, search... cpa5 Its location on the zebrafish genome indicates cpa5 The distance from the upstream gene is approximately 4–6 kb (preferably approximately 5 kb), based on which it is inferred that... cpa5 The possible promoter sequence range was determined, and primers capable of amplifying the promoter sequence were designed; then, zebrafish genome was extracted, and high-fidelity PCR was performed using the extracted genomic DNA as a template to amplify the genome. cpa5 Gene promoter sequence.
[0009] The preferred nucleotide sequences of the primers are as shown in SEQ ID NO: 2 and SEQ ID NO: 3.
[0010] The fluorescent protein gene mentioned in step (1) is preferably the green fluorescent protein gene EGFP.
[0011] The plasmid with fluorescent protein gene and Tol2 transposon recognition site mentioned in step (1) is preferably a plasmid with green fluorescent protein gene EGFP and Tol2 transposon recognition site; more preferably, it is pTol2-promoter-T2A-EGFP plasmid.
[0012] The Tol2 transposase mRNA mentioned in step (2) is Tol2 transposase mRNA transcribed in vitro from the pCS2-Tol2 transposase vector using the mMESSAGEmMACHINE system.
[0013] In step (2), the two Tol2 recognition site sequences on the transgenic vector are TP_LA and TP_RA, and their nucleotide sequences are shown in SEQ ID NO: 4 and SEQ ID NO: 5.
[0014] The preferred cultivation temperature in step (3) is 28.5°C.
[0015] In step (3), the transgenic zebrafish embryos are placed in a constant temperature incubator at 28.5℃ for cultivation. Dead eggs need to be removed and the culture medium replaced in a timely manner.
[0016] In step (3), once the F0 generation transgenic zebrafish have reached sexual maturity, they are hybridized with wild-type zebrafish to obtain the F1 generation for preservation.
[0017] In step (3), EGFP signaling is specifically expressed in mast cells of zebrafish and interacts with endogenous EGFP. cpa5 The expression patterns are consistent.
[0018] The application of the transgenic zebrafish in the preparation of an animal model capable of visually monitoring mast cells includes, after step (3), a further step of identifying the transgenic zebrafish (F0, F1, F2 generations), including at least one of fluorescence microscopy observation, gene identification, and electrophoresis detection; specifically, this can be achieved through at least one of the following methods: (i) F0 generation identification: After injection, once the embryo has developed to approximately 1 day post-exposure (dpf), observe it under a fluorescence microscope for the expression of fluorescent proteins to verify the effectiveness of the recombinant plasmid. If fluorescence is observed, it indicates... cpa5 The promoter-driven fluorescent protein was successfully integrated into the zebrafish genome; (ii) F0 generation identification: The fluorescent protein sequence in transgenic zebrafish was amplified by PCR and then identified by agarose gel electrophoresis. cpa5 Whether the fluorescent protein gene driven by the promoter is successfully integrated into the zebrafish genome (e.g., the fluorescent protein gene EGFP, which shows a clear and bright band at the 146bp position). (iii) F1 generation identification: Once the F0 generation of transgenic zebrafish reaches sexual maturity, they are crossed with wild-type zebrafish to obtain the F1 generation. Then, several embryos are randomly selected for gene identification to detect whether the fluorescent protein gene is integrated into the zebrafish genome, and the fluorescence expression of the F1 generation is observed under a microscope. (iv) F1 generation identification: Once the F0 generation transgenic zebrafish reach sexual maturity, they are crossed with wild-type zebrafish to obtain the F1 generation; then a small amount of tissue from the tail of the F1 generation adult fish is taken for genotyping. (v) F2 generation identification: F1 generation (EGFP-positive F1 generation) was crossed with wild-type zebrafish to obtain F2 generation, and then fluorescent protein expression was observed using a fluorescence microscope.
[0019] The applications include detecting at least one dynamic change in mast cells during the following processes: (a) Migration and distribution of mast cells during development; (b) Activation of mast cells induced by exogenous stimuli; (c) Changes in the number or functional status of mast cells in the inflammation model.
[0020] The exogenous stimuli mentioned in (b) include at least one of allergic reactions, infections, injuries, etc.
[0021] The aforementioned transgenic zebrafish is used in screening drugs effective against mast cell-related diseases. This transgenic zebrafish can be used for research on the pathogenesis of mast cell-related diseases, drug screening, and evaluation of treatment effects.
[0022] The mast cell-related diseases mentioned above include diseases caused by abnormal activation of inflammatory mediators (histamine, proteases, etc.) in mast cells, such as at least one of inflammation, allergy, infection and / or skin lesions.
[0023] The overall concept of this invention is as follows: 1. This invention overcomes the shortcomings of existing technologies, such as the inability to visualize mast cells in vivo, the inability to perform dynamic tracking, and the need to destroy samples for detection. It provides a transgenic animal model in zebrafish that allows observation of mast cell distribution, migration, and developmental changes, namely Tg( cpa5 Transgenic zebrafish (EGFP). This was achieved by constructing... cpa5 The promoter-driven EGFP expression framework enables mast cells to naturally emit green fluorescence in zebrafish, thereby achieving precise labeling and long-term tracking of live mast cells. This can significantly improve the efficiency and accuracy of basic research and disease model studies related to mast cells.
[0024] 2. During the embryonic stage, utilize cpa5 TSA experiments were conducted using probes to detect colocalization among myeloid markers, using "Tg( coro1a Myeloid cell localization was detected using "GFP", and Tg( lyz :DsRed) detection of neutrophil localization; elucidation of CHTcpa5 The source and cell type of positive cells were identified to test the transgenic line Tg( cpa5 Distribution of EGFP in EGFP).
[0025] 3. During the embryonic stage, transgenic zebrafish Tg (Tg) were sorted by flow cytometry. cpa5 EGFP-positive cells were subjected to May-Giemsa staining and toluidine blue staining (TB) to observe mast cell development.
[0026] The present invention has the following advantages and effects compared with the prior art: (1) This invention discloses a transgenic zebrafish for visualizing mast cells and its application: Through experiments on the upstream genomic region of the cpa5 gene, this invention identifies and obtains for the first time a regulatory sequence with significant mast cell-specific initiation activity, and uses it to drive the expression of fluorescent proteins in zebrafish, successfully constructing a transgenic zebrafish model driven by the cpa5 promoter to express fluorescent proteins. This model can achieve highly specific and visual labeling of mast cells without the need for exogenous stimulation or staining, and exhibits stable and consistent expression characteristics throughout individual development and adult stages. This invention not only solves the technical problem of mast cell-specific labeling under unknown cpa5 promoter conditions, but also provides a novel, stable, and reliable technical means for studying mast cell-related physiological functions, immune regulation, and disease mechanisms.
[0027] (2) The transgenic zebrafish of the present invention is prepared by the following method: 1) constructing a structure containing cpa5 promoter and pTol2- of the EGFP expression framework cpa5 -EGFP recombinant plasmid; 2) The recombinant plasmid and Tol2 transposase mRNA were co-injected into 1-cell stage zebrafish embryos to achieve stable integration of the exogenous gene into the zebrafish genome, obtaining Tg( cpa5 :EGFP); 3) Through progeny selection and TSA in situ hybridization verification, it was proved that the EGFP signal is related to endogenous EGFP. cpa5 It exhibits high colocalization and good cell type specificity.
[0028] (3) This invention achieves dynamic and non-destructive imaging of mast cells: Traditional mast cell research relies on tissue sections, immunostaining or chemical staining, which requires tissue fixation and structural destruction, and can only provide static endpoint information; while this invention uses currently known mast cell-specific markers. cpa5 The promoter drives EGFP, thereby enabling real-time fluorescence localization of mast cells in vivo. This allows for continuous observation of the same fish without the need for sampling or staining, avoiding experimental damage and improving the continuity of observation.
[0029] (4) The method of the present invention has high labeling specificity and accurate and reliable fluorescence signal: cpa5 Specifically expressed in zebrafish mast cells, this invention confirmed the link between EGFP signaling and endogenous [genes / genes] through TSA in situ hybridization and immunological verification. cpa5 High colocalization of expression makes the model highly specific and reliable, avoiding misjudgments caused by non-specific labels.
[0030] (5) This invention is based on the Tol2 system integration, resulting in high genetic stability: This invention utilizes the Tol2 transposon system to achieve efficient integration of exogenous genes into the zebrafish genome, resulting in Tg( cpa5 The EGFP strain can stably express EGFP in its offspring, allowing for long-term preservation and making it suitable for large-scale experiments.
[0031] (6) This invention is applicable to a variety of disease models and research scenarios: Tg ( cpa5 Transgenic zebrafish (EGFP) can clearly demonstrate the behavior of mast cells in different tissues, at different developmental stages, and under different pathological stimuli (inflammation, infection, allergic reactions, skin damage, etc.). It enables in vivo visualization, dynamic tracking, and functional studies of mast cells, and can be used for dynamic observation of mast cell behavior in various pathological models such as inflammation, allergy, infection, and skin damage. It provides an effective animal model for mechanism research and drug screening of mast cell-related diseases and has wide application value. It can also be used in combination with other fluorescent zebrafish models to achieve multi-cell population interaction studies.
[0032] (7) The technology of this invention is simple to operate, has good reproducibility, and is easy to promote: the promoter amplification, plasmid construction, microinjection and screening process involved in this invention are all standardized operations, and at the same time, it provides accurate promoter regions and construction methods, so that other laboratories can easily reproduce it.
[0033] (8) Compared with existing methods that rely on tissue staining, immunolabeling or transient expression, the transgenic zebrafish model constructed in this invention has shown excellent performance in analyzing the spatiotemporal distribution of mast cells, tracking dynamic behavior, and monitoring drug intervention response. In particular, under in vivo, long-term and high-throughput observation conditions, it significantly improves research efficiency and data reliability. Attached Figure Description
[0034] Figure 1 yes cpa5 A schematic diagram showing the corresponding location of the promoter on the zebrafish genome; where A represents... cpa5 The specific region of the promoter on the genome; B is Tg ( cpa5 Schematic diagram of the EGFP expression vector (in the diagram, "TP_LA" and "TP_RA" are transposon recognition sequences, "... cpa5"promoterI" is obtained by PCR from zebrafish genomic DNA, and "EGFP" is the green fluorescent protein sequence; C is 28 hpf Tg ( cpa5 The expression location of EGFP fluorescent protein in transgenic juvenile fish (63x), the image below is a magnified fluorescence signal image of the tail hematopoietic tissue (CHT) (100x, 200x); D represents F0 generation 10 hpf and 32 hpf Tg ( cpa5 EGFP fluorescence expression distribution diagram and agarose gel electrophoresis results of EGFP protein identification in transgenic juvenile fish; E represents the Tg of 3dpf F1 generation (EGFP). cpa5 Image showing the expression distribution of EGFP fluorescence in transgenic juvenile fish and the agarose gel electrophoresis results of EGFP protein.
[0035] Figure 2 It is a genetically modified strain Tg ( cpa5 The graph shows the results of the EGFP construction effect test; where A represents the period from 1 cell stage to 5 dpf. cpa5 Spatiotemporal expression pattern of genes (63x), with red boxes indicating further magnified head and tail hematopoietic tissue (CHT) regions (200x); red arrows represent the zebrafish head and CHT. cpa5 The signal, indicated by the blue arrow, is located in the pancreas. cpa5 B is cpa5 With myeloid markers coro1a The colocation map, red indicates cpa5 Positive cells, green indicates coro1a Labeled myeloid cells; C is cpa5 With neutrophil markers lyz The colocation map, red indicates cpa5 Positive cells, green indicates lyz Labeled neutrophils.
[0036] Figure 3 It is 6 dpf Tg ( cpa5 EGFP) Zebrafish whole embryo cpa5Figure 1 shows the results of flow cytometry sorting of EGFP-positive cells (scale bar in the figure, 20 μm; data were analyzed using a two-tailed Student's t-test and are expressed as mean ± SD; *p<0.05, **p<0.01, ***p<0.001); where A represents the ratio of EGFP-positive to EGFP-negative cells sorted by flow cytometry, and the morphology of mast cells under Giemsa staining and toluidine blue staining (400x) for EGFP-positive and EGFP-negative cells, with red arrows representing neutrophils and blue arrows representing mast cells; B represents the number and difference of mast cells and neutrophils under toluidine blue staining; C represents the number and difference of mast cells and neutrophils under Giemsa staining. Detailed Implementation
[0037] The present invention will be further described in detail below with reference to embodiments, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field. Test methods in the following embodiments that do not specify specific experimental conditions are generally performed according to conventional experimental conditions or experimental conditions recommended by the manufacturer. All raw materials used in the following embodiments, unless otherwise specified, are commercially available.
[0038] The zebrafish farming method in this invention is carried out according to the method described in the literature (Westerfield M. The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Danio Rerio): University of Oregon Press; 2000.).
[0039] The following strains of zebrafish are used in this invention: (1) AB wild-type zebrafish; (2) Tg ( coro1a :GFP) transgenic zebrafish, Tg ( lyz :DsRed) transgenic zebrafish, both transgenic strains were purchased from the China Zebrafish Resource Center (China Zebrafish Resource Center); (3) Tg ( cpa5 Transgenic zebrafish (constructed in this invention) containing EGFP.
[0040] The term "wild type" or "WT" used in this invention refers to wild-type zebrafish.
[0041] In this invention, the terms "hpf" and "dpf" refer to the time (hours or days) after fertilization; for example, "10hpf" means 10 hours after fertilization, and "1dpf" means 1 day after fertilization.
[0042] Example 1 Tg ( cpa5 Construction and efficacy testing of EGFP transgenic fish 1. Materials and Methods: (1) Zebrafish farming The zebrafish strains required in this embodiment are AB wild-type zebrafish (WT) and transgenic zebrafish. The zebrafish farming is as described in the literature (Westerfield M. The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Danio Rerio): University of Oregon Press; 2000.).
[0043] (2) Establishment of transgenic zebrafish This application uses transposon-mediated transgenic technology to construct Tg ( cpa5 EGFP transgenic zebrafish strain. The pTol2- used in this strain... cpa5 -EGFP plasmid is composed of cpa5 It consists of a promoter, Tol2 element, and SV40 Poly A sequence. It was obtained from zebrafish genomic DNA using polymerase chain reaction (PCR). cpa5 Promoter fragment; subsequently, after digestion with restriction endonucleases, cpa5 The promoter sequence was inserted and subcloned into the pTol2-promoter-T2A-EGFP plasmid (plasmid vector purchased from NovoPro, V012905), forming pTol2- cpa5 -EGFP constructs the vector. To generate Tg( cpa5 EGFP transgenic zebrafish, further incorporating pTol2- cpa5 The EGFP construct vector was uniformly mixed with Tol2 transposon mRNA and microinjected into zebrafish embryos at the single-cell stage. The specific process is as follows: First, we search cpa5 The location on the genome of AB wild-type zebrafish is known cpa5 It is about 5kb away from the upstream gene, based on which we can infer... cpa5The possible promoter sequence range was determined, and primers capable of amplifying the promoter sequence were designed. Then, the genome of wild-type AB zebrafish was extracted, and high-fidelity PCR was performed using the extracted genomic DNA as a template to amplify the promoter sequence. The promoter sequence was coupled with XhoI and BamHI restriction enzyme sites at both ends, and the plasmid vector was amplified simultaneously. cpa5 The gene promoter was ligated into the pTol2-promoter-T2A-EGFP plasmid (a plasmid containing a Tol2 transposon recognition site) to obtain the recombinant plasmid pTol2- cpa5 -EGFP; cpa5 The specific regions of the promoter on the genome, such as Figure 1 As shown in Figure A, the schematic diagram of the recombinant expression vector is as follows. Figure 1 As shown in B. The PCR primers involved are as follows (5′-3′): cpa5 promoter FPI: ctcgAGATCTTCAAATGTCAGCGGGTC (SEQ ID NO: 2); cpa5 promoter RP: ggatcCCTTTTAAGCTCACTATCTCAAAATCATTC (SEQ ID NO: 3).
[0044] cpa5 Gene promoter sequence (SEQ ID NO: 1):
[0045] Tol2 transposase mRNA was transcribed in vitro from the pCS2-Tol2 transposase vector using mMESSAGE mMACHINE (the sequence of which is disclosed in Chinese Patent No. 201810464900.X, entitled "Application of a Transgenic Zebrafish in the Preparation of an Animal Model of Chronic Myeloid Leukemia" (see Sequence 2)). The recombinant plasmid pTol2- cpa5 -EGFP and Tol2 transposase mRNA were introduced into zebrafish embryos at the 1-cell stage of embryonic development via microinjection (the dosage of both can be adjusted according to actual needs, such as injecting 50 pg Tol2 transposase mRNA + 50 pg plasmid vector into each zebrafish embryo; under the action of transposase, the gene DNA fragment between the two Tol2 recognition site sequences (TP_LA and TP_RA, sequences shown as SEQ ID NO: 4 and SEQ ID NO: 5) on the transgenic vector was integrated into the zebrafish genome), resulting in Tg ( cpa5 Transgenic zebrafish embryos containing EGFP (eGFP). Tg ( cpa5 Transgenic zebrafish embryos (eGFP) were cultured in a 28.5℃ incubator, with dead eggs removed and the culture medium replaced promptly. After injection, when the embryos reached approximately 1 day post-fertilization (dpf), they were observed under a fluorescence microscope for the expression of green fluorescent protein to verify pTol2-. cpa5 -Is the EGFP plasmid effective? After the F0 generation of transgenic zebrafish reaches sexual maturity, they are crossed with AB wild-type zebrafish to obtain the F1 generation for preservation. The two Tol2 recognition site sequences (TP_LA and TP_RA) on the transgenic vector are as follows: TP_LA: AATACTCAAGTACAATTTTAATGGAGTACTTTTTTACTTTTACTCAAGTAAGATTCTAGCCAGATACTTTTACTTTTAATTGAGTAAAATTTTCCCTAAGTACTTGTACTTTCACTTGAGTAAAATTTTTGAGTACTTTTTACACCTCTG (SEQ ID NO: 4); TP_RA: CAGAGGTGTAAAGTACTTGAGTAATTTTACTTGATTACTGTACTTAAGTATTATTTTTGGGGATTTTTACTTTACTTGAGTACAATTAAAAATCAATACTTTTACTTTTACTTAATTACATTTTTTTAGAAAAAAAAGTACTTTTTACTCCTTACAATTTTATTTACAGTCAAAAAGTACTTATTTTTTGGAGATCACTT (SEQ ID NO: 5).
[0046] (3) Genotyping Several embryos were randomly selected for gene identification to detect whether EGFP was integrated into the zebrafish genome, and the fluorescence expression of the F1 generation was observed under a microscope. A small amount of tail tissue was excised from F1 adult fish for genotyping and screening for EGFP-positive F1 cells. These F1 cells were then crossed with wild-type zebrafish to obtain F2 embryos. EGFP embryos were selected under a fluorescence microscope and subjected to a tyrosine signal amplification (TSA) assay to screen for EGFP integration with the zebrafish genome. cpa5 Complete colocalization (i.e., consistent expression patterns) lineages were identified, and the corresponding F1 scores were preserved. The experiment was conducted in triplicate.
[0047] The results are as follows Figure 1 As shown: Tg ( cpa5 EGFP fluorescent protein expression is observed in embryos, and in 28 hpf transgenic larvae. GFP expression is also observed in notochord vacuolar cells, with isolated signals visible at the CHT site. Figure 1 C in the middle). F0 generation 10 hpf and 32 hpf Tg ( cpa5 EGFP fluorescence expression was clearly observed in transgenic juvenile fish. Further specific polymerase chain reaction (PCR) amplification of the EGFP protein sequence and agarose gel electrophoresis results showed… cpa5 Promoter-driven expression of EGFP protein was successfully integrated ( Figure 1 D in the middle). Select offspring with strong fluorescent signal expression and breed them to adulthood. The 3dpf F1 generation Tg ( cpa5 In transgenic juvenile fish, EGFP fluorescence is concentrated in the pancreatic tissue, due to... cpa5 In juvenile fish, weak expression was observed at the CHT site (weak signal and low cell number), making the signal difficult to observe. Further specific polymerase chain reaction (PCR) amplification of the EGFP protein sequence confirmed this. cpa5 The promoter sequence has been integrated into Tg ( cpa5 In the genome of EGFP ( :EGFP) Figure 1 (E in the text).
[0048] (4) Expression profile verification First build cpa5 The probe was inserted according to the method described in the reference (Xu Songen. Spatiotemporal expression and function of zebrafish mast cell-related gene cpa5 in hematopoietic development [D]. Southern Medical University, 2020. DOI:10.27003 / d.cnki.gojyu.2020.001492.), and then observed by zebrafish whole embryo in situ hybridization (WISH). cpa5 Spatiotemporal gene expression patterns from the 1-cell stage to 5 dpf in zebrafish, and Tg (inorganic glutaraldehyde) levels in transgenic fish collected. coro1a :GFP), Tg ( lyz Offspring produced by mating with :DsRed cpa5 Probe hybridization was used to observe the presence of tyrosine in tail hematopoietic tissue (CHT) via a tyrosine signal amplification assay (TSA). cpa5 With myeloid markers coro1a and neutrophil markers lyz Colocalization. The experiment was set up with three replicates.
[0049] The results are as follows Figure 2 As shown: The results show that cpa5 It is mainly expressed in pancreatic tissue and CHT. Specifically, it is found in the early pancreatic region. cpa5 CHT expression begins at 2 dpf and gradually increases with development; cpa5 Expression begins at 28 hpf and continues until 5 dpf ( Figure 2 In the diagram, A, the red arrow indicates the zebrafish's head and CHT. cpa5 The signal, indicated by the blue arrow, is located in the pancreas. cpa5 Further research cpa5 With myeloid markers coro1a and neutrophil markers lyz Co-localization was performed, and the TSA results showed that in CHT... cpa5 Originating from the myeloid system, belonging to cells of myeloid origin ( Figure 2 (B and C in the middle); and Tg ( cpa5 (EGFP) cpa5 The distribution of pancreas and CHT was consistent with expectations, but due to the presence of [unclear - possibly a specific metric] in zebrafish... cpa5 Due to the low expression level and the decrease in copy number caused by random insertion of transgenes, the fluorescence expression in F1 and offspring is very weak and difficult to observe with the naked eye.
[0050] (5) Flow cytometry cell sorting To further explore cpa5 The role of Tg in mast cell development was determined by flow cytometry in transgenic zebrafish.cpa5 EGFP-positive cells were stained with May-Giemsa and toluidine blue (TB) staining. May-Giemsa was more specific for recognizing neutrophils, while TB was more specific for recognizing mast cells. The experiment was performed in triplicate.
[0051] The results are as follows Figure 3 As shown: Flow cytometry sorting of 6 dpf Tg ( cpa5 GFP-positive and GFP-negative cells in whole zebrafish embryos were stained with May-Giemsa and TB, respectively, to determine their relative abundance. cpa5 The markers are a group of mast cells that are more mature than GFP-negative cells, and are present in tissues throughout the body. cpa5 + Approximately 20% of the cells are mast cells, suggesting... cpa5 It has indicative significance for the maturity of mast cell granules. cpa5 It can serve as a marker for some mature mast cells.
[0052] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. The application of a transgenic zebrafish in the preparation of an animal model capable of visually monitoring mast cells, characterized in that: The transgenic zebrafish was prepared by the following method: (1) As shown in SEQ ID NO: 1 cpa5 The gene promoter sequence was digested with XhoI and BamHI to obtain the target gene sequence; The plasmid containing the fluorescent protein gene and the Tol2 transposon recognition site was digested with XhoI and BamHI to obtain a linearized vector; the target gene sequence was ligated into the linearized vector to obtain a recombinant plasmid. (2) The recombinant plasmid and Tol2 transposase mRNA were introduced into zebrafish embryos at the 1-cell stage of embryonic development by microinjection to obtain transgenic zebrafish embryos. (3) The transgenic zebrafish embryos were placed in a constant temperature incubator and cultured to obtain the transgenic zebrafish.
2. The application according to claim 1, characterized in that: The plasmid with fluorescent protein gene and Tol2 transposon recognition site mentioned in step (1) is a plasmid with green fluorescent protein gene EGFP and Tol2 transposon recognition site; The cultivation temperature described in step (3) is 28.5℃.
3. The application according to claim 2, characterized in that: The plasmid containing the fluorescent protein gene and the Tol2 transposon recognition site mentioned in step (1) is the pTol2-promoter-T2A-EGFP plasmid.
4. The application according to claim 1, characterized in that: In step (2), the two Tol2 recognition site sequences on the transgenic vector are TP_LA and TP_RA, and their nucleotide sequences are shown in SEQ ID NO: 4 and SEQ ID NO:
5.
5. The application according to claim 1, characterized in that: The process includes identifying the genetically modified zebrafish after step (3); The identification includes at least one of fluorescence microscopy observation, gene identification, and electrophoresis detection.
6. The application according to claim 1, characterized in that, The applications include detecting at least one dynamic change in mast cells during the following processes: (a) Migration and distribution of mast cells during development; (b) Activation of mast cells induced by exogenous stimuli; (c) Changes in the number or functional status of mast cells in the inflammation model.
7. The application according to claim 1, characterized in that: The exogenous stimuli mentioned in (b) include at least one of allergic reactions, infections, and injuries.
8. The use of the transgenic zebrafish described in claim 1 in screening for drugs effective against mast cell-related diseases.
9. The application according to claim 8, characterized in that: The mast cell-related diseases mentioned above include those caused by abnormal activation of inflammatory mediators in mast cells.
10. The application according to claim 9, characterized in that: The mast cell-related diseases mentioned include at least one of inflammation, allergy, infection, and skin lesions.