Application of OsbZIP65, a bZIP-like transcription factor associated with low-temperature tolerance in rice, in the cultivation of stress-tolerant plants.
By overexpressing or editing the OsbZIP65 transcription factor in rice, its response mechanism to low temperature was regulated, thus solving the problem of rice's tolerance to low temperature stress, improving the rice's low temperature adaptability, and demonstrating significant potential for genetic improvement.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-26
- Publication Date
- 2026-05-26
AI Technical Summary
Rice is sensitive to low temperature stress, and traditional breeding methods are unable to effectively improve its cold resistance, affecting yield and quality. Furthermore, global climate change is increasing the frequency and extent of low temperature events.
By utilizing the newly identified bZIP-like transcription factor OsbZIP65 in rice, we can enhance the plant's low-temperature tolerance through gene overexpression or editing, and regulate the expression of related genes to improve rice's adaptability to low temperatures.
Transgenic rice overexpressing OsbZIP65 showed improved tolerance to low temperatures and reduced MDA content, while gene-edited lines showed low-temperature sensitivity and increased MDA content, suggesting the potential application value of OsbZIP65 in rice genetic improvement.
Smart Images

Figure CN121227787B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bio-agricultural technology, and in particular to the application of the rice low-temperature tolerance-related bZIP transcription factor OsbZIP65 in the cultivation of stress-tolerant plants. Background Technology
[0002] As one of the world's major food crops, rice ( Oryza sativa Rice (L.) is a staple food source for over 2 billion people. Originating in tropical and subtropical regions, it is a warm-season crop and is quite sensitive to low temperatures. However, abiotic stress, especially chilling injury, has become a severe challenge for rice production. Low-temperature stress can be divided into chilling injury (0-15℃) and freezing injury (<0℃), which have significant negative impacts on all developmental stages of rice, including inhibited seed germination, slowed seedling growth, and impaired photosynthetic activity, ultimately leading to a decline in rice yield and quality. With the intensification of climate change and the increasing frequency of low-temperature events, the importance of in-depth research and mitigation of low-temperature stress in rice is becoming increasingly prominent.
[0003] With the continued growth of global food demand, rice cultivation areas are expanding towards higher altitudes and latitudes, a trend that significantly increases the risk of rice suffering from low-temperature stress. It is estimated that approximately 24 countries worldwide, including China, Japan, and North Korea, have faced severe low-temperature damage. In China, rice cultivation areas span approximately 34 degrees of latitude (from Mohe at 53°27′N in the north to Hainan at 18°90′N in the south), with an elevation difference of 2,700 meters (from the southeastern coastal areas to the Yunnan-Guizhou Plateau). Northeast China, the Yangtze River Basin, the Pearl River Basin, and some high-altitude areas are all susceptible to varying degrees of low-temperature damage. In South China and the double-cropping rice areas of the middle and lower reaches of the Yangtze River, early rice seedlings often encounter "late spring frosts," while late rice is vulnerable to "cold dew winds" during the heading and flowering stages, leading to significant yield reductions. Low-temperature damage of varying degrees is prevalent in these regions. Under the influence of low-temperature stress, a series of significant changes occur in the physiological and metabolic processes of rice. Specifically, this manifests as altered chlorophyll fluorescence properties, a significant increase in electrolyte leakage (EL), and a marked rise in the levels of metabolites such as reactive oxygen species (ROS), malondialdehyde (MDA), sucrose, lipid peroxides, and proline. Furthermore, the levels of endogenous plant hormones abscisic acid (ABA) and gibberellin (GA) also change. In-depth investigation into the physiological and metabolic changes in rice under low-temperature stress and the molecular mechanisms of its low-temperature response is of paramount theoretical and practical significance for guiding the genetic improvement of rice's low-temperature tolerance traits.
[0004] Genome-wide association studies (GWAS) have identified qRSP10 and bZIP73 As a major effector in the cold resistance of rice. qPSR10 Identified in 1033 germplasm accessions using GWAS, it exhibits cold tolerance at both the seedling and reproductive stages. bZIP73 enhances rice cold tolerance by interacting with the protein bZIP71, regulating ABA levels and ROS balance. Since establishing cold tolerance assessment criteria at the seedling stage is relatively easy, many primary effector genes have been identified, including... COLD1 , COLD11 , HAN1 , LTG1 , qCTS-9 , GSTZ2 , COG1 and COG2 In genes that regulate G protein signaling COLD1 Chinese researchers selected a single nucleotide polymorphism (SNP) to enhance the cold resistance of japonica rice; COLD11 The rice improves its cold resistance by repairing DNA double-strand breaks (DSBs) under low temperature stress through its encoded DNA repair protein COLD11 / RAD51A1. HAN1 It encodes an oxidase that catalyzes the conversion of bioactive jasmonic acid-L-isoleucine (JA-Ile) to inactive 12-hydroxy-JA-Ile (12OH-JA-Ile), thereby regulating JA-mediated low-temperature stress response; LTG1 Encoding casein kinase I, it enhances the growth rate and yield of rice under low temperatures; GSTZ2 When the 99th amino acid is isoleucine (Ile), it plays an important role in improving the low temperature tolerance of rice seedlings; the COG1-OsSERL2 complex transmits cold signals from the plasma membrane to the cytoplasm, activates the MAPK cascade reaction, and thus triggers the rice's defense response to cold stress. COG2 It negatively regulates cold damage resistance in rice seedlings by influencing cell wall composition. COG2 Overexpressing transgenic plants are sensitive to chilling injury, while knockout transgenic lines have enhanced chilling injury resistance.
[0005] Numerous studies have shown that cold tolerance is a complex trait controlled by multiple genes, and its physiological and biochemical processes are the result of the coordinated regulation of multiple genes. A large number of identified cold stress-related genes can be divided into two main categories: the first category is functional genes, such as osmotic protectant synthase genes and ascorbic acid oxidase, whose encoded products directly play a protective role when plants are subjected to abiotic stress; the second category is regulatory genes, such as protein kinases and transcription factors, whose encoded products regulate the coordinated expression of functional genes to protect plants from damage when plants are subjected to abiotic stress. Transcription factors (TFs) are a class of proteins that can specifically recognize and bind to specific DNA sequences in the promoter regions of their target genes. Through interaction with these cis-acting elements, transcription factors can precisely regulate the initiation, rate, and on / off state of transcription, thereby affecting the level and pattern of gene expression and ultimately leading to different biological phenotypes. In abiotic stress signaling pathways, transcription factors, as key regulatory elements, sense and respond to changes in the external environment, such as drought, salinity, low temperature, and high temperature. By regulating the expression of downstream stress genes, they activate plant defense mechanisms and enhance plant resistance, thus playing a crucial role in the adaptation of plants to complex and variable environments. Several transcription factor families have been identified in both animals and plants. Among them, the basic leucine zipper (bZIP) transcription factor family is one of the largest and most diverse dimerized transcription factor families.
[0006] Previous studies have shown that bZIP transcription factors are involved in seed germination, seedling formation, flower bud differentiation, and floral induction. Simultaneously, bZIP transcription factors are widely involved in biological processes such as responses to abiotic stresses (salt stress, drought stress, cold stress) and defense against biotic stresses. For example, in Arabidopsis thaliana, ABF2 Involved in ABA-dependent low-temperature stress signal transduction; AtbZIP1 Involved in ROS-mediated low-temperature stress signaling responses. In rice, OsbZIP38 / LIP19 interacts with OsbZIP87 and participates in low-temperature stress signal transduction; OsbZIP52 / RISBZ5 Negative regulation of low-temperature stress signal transduction. OsbZIP10 / OsABI5 , OsbZIP12 / OsABF1 and OsbZIP46 / OsABF2 / ABL1 Expression was upregulated by low temperature; at 4°C, OsbZIP27 and OsbZIP45 The expression is adjusted upwards, while OsbZIP4, OsbZIP18 , OsbZIP65 and OsbZIP83 Expression was downregulated. In the regulation of cold stress, wheat bZIP transcription factor...TabZIP60 and TaAREB3 Overexpression in Arabidopsis significantly enhanced seedling tolerance to cold stress. TabZIP96 interacts with TaICE1 in yeast, thus positively regulating cold tolerance in wheat. In maize, negative regulatory genes... ZmbZIP68 After being phosphorylated by MPK8, the stability of the protein under low temperature stress and its relationship with DREB1.7 The promoter's DNA binding affinity is enhanced.
[0007] Against the backdrop of global warming, extreme low-temperature events are becoming more frequent and intense, and low-temperature stress has become one of the key abiotic stresses limiting high and stable yields. Traditional breeding methods have limited efficiency in improving complex traits such as cold resistance, and there is an urgent need to explore key genetic variations at the gene function level. Summary of the Invention
[0008] The purpose of this invention is to provide the application of the rice low-temperature tolerance-related bZIP transcription factor OsbZIP65 in cultivating stress-tolerant plants, thereby addressing the problems existing in the prior art. This invention relates to a newly identified S-type bZIP transcription factor in rice. OsbZIP65 Low-temperature resistance. Preliminary expression analysis indicates that... OsbZIP65 The expression level increased significantly under low temperature stress and under treatment with the stress-related hormone ABA. This indicates that... OsbZIP65 It plays a crucial role in rice's adaptation to harsh environmental conditions. This invention utilizes functional analysis and gene expression studies. OsbZIP65 How it participates in stress tolerance. By clarifying... OsbZIP65 Based on the functional mechanism described herein, this invention aims to provide a reference for developing rice varieties that are more adaptable to environmental challenges, thereby supporting sustainable agriculture and global food security.
[0009] To achieve the above objectives, the present invention provides the following solution:
[0010] One of the technical solutions of this invention, OsbZIP65 Application of genes or their encoded proteins in improving the cold tolerance of plants.
[0011] The second technical solution of the present invention OsbZIP65 Genes or containing OsbZIP65 Application of gene recombinant vectors, expression cassettes, transgenic cell lines, or recombinant bacteria in the cultivation of plant strains with low-temperature tolerance.
[0012] The third technical solution of this invention is a method for improving the low-temperature tolerance of plants, by overexpressing the aforementioned... OsbZIP65 Genes or the levels of their encoded proteins can be increased to improve a plant's tolerance to low temperatures.
[0013] The fourth technical solution of this invention is a method for cultivating new rice varieties with strong low-temperature resistance, by overexpressing the...OsbZIP65 Genes or the levels of their encoded proteins can be increased to improve a plant's tolerance to low temperatures.
[0014] Based on the above technical solution, the present invention has the following technical effects:
[0015] This invention focuses on rice anti-reverse transcription factors OsbZIP65 Functional analysis of overexpression and gene editing. Japonica rice type. OsbZIP65 Low temperature during the seedling stage induced upregulation of expression; transgenic experiments showed that overexpression... OsbZIP65 The genetically modified rice showed increased tolerance to low temperatures and decreased MDA content; however, its gene-edited lines showed increased sensitivity to low temperatures and increased MDA content. In summary, this suggests... OsbZIP65 It participates in low-temperature stress response and has important potential application value in the genetic improvement of rice germplasm resources. Attached Figure Description
[0016] Figure 1 For ABA and cold stress OsbZIP65 Expression was induced by exposing two-week-old seedlings to ABA (100 μM) and cold stress (4°C) to analyze expression levels in aboveground and belowground tissues. Here, A represents the low-temperature treatment. OsbZIP65 Relative expression levels in the aboveground parts, B represents low-temperature treatment. OsbZIP65 Relative expression levels in the underground portion, C represents ABA treatment. OsbZIP65 Relative expression levels in the aboveground parts, D represents ABA treatment. OsbZIP65 The relative expression level of the underground part.
[0017] Figure 2 for OsbZIP65 Screening for low-temperature tolerance in homozygous lines during the seedling stage. In the figure, A represents the low-temperature stress screening diagram; B represents the expression level of the transgenic lines; C represents the survival rate after low-temperature treatment; and D represents the malondialdehyde (MDA) content.
[0018] Figure 3 for bzip65 Screening for low-temperature tolerance in mutant seedlings. In the figure, A represents the low-temperature stress screening; B represents the survival rate after low-temperature treatment; and C represents the malondialdehyde (MDA) content.
[0019] Figure 4 pCambia1300-221- OsbZIP65 -Flag plasmid map.
[0020] Figure 5 For pYLCRISPR-Cas9- bzip65 Plasmid map. Detailed Implementation
[0021] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.
[0022] Unless otherwise specified, all methods used in this invention are conventional methods. For detailed steps, please refer to: *Molecular Cloning: A Laboratory Manual* (Sambrook, J., Russell, David W., *Molecular Cloning: A Laboratory Manual*, 3rd edition). rd (edition, 2001, NY, Cold Spring Harbor). All primers used were synthesized by Beijing Qingke Biotechnology Co., Ltd.
[0023] The embodiments of the present invention provide OsbZIP65 Application of genes or their encoded proteins in improving the cold tolerance of plants.
[0024] In some specific implementation schemes, the OsbZIP65 The nucleotide sequence of the gene is shown in SEQ ID NO.1.
[0025] In some specific implementation schemes, the overexpression of the OsbZIP65 Genes or the levels of their encoded proteins can be increased to improve a plant's tolerance to low temperatures.
[0026] In some specific implementations, the plant includes rice.
[0027] The embodiments of the present invention also provide OsbZIP65 Genes or containing OsbZIP65 Application of gene recombinant vectors, expression cassettes, transgenic cell lines, or recombinant bacteria in the cultivation of plant strains with low-temperature tolerance.
[0028] In some specific implementations, the recombinant vector, expression cassette, transgenic cell line, or recombinant bacteria is used for overexpression of the [specific expression]. OsbZIP65 Genes or increase the level of the proteins they encode.
[0029] This invention also provides a method for improving the low-temperature tolerance of plants, by overexpressing the aforementioned... OsbZIP65 Genes or the levels of their encoded proteins can be increased to improve a plant's tolerance to low temperatures.
[0030] In some specific implementation schemes, the OsbZIP65 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the plant includes rice.
[0031] This invention also provides a method for cultivating new rice varieties with strong low-temperature resistance, by overexpressing the aforementioned...OsbZIP65 Genes or the levels of their encoded proteins can be increased to improve a plant's tolerance to low temperatures.
[0032] In some specific implementation schemes, the use of containing OsbZIP65 Recombinant gene vectors, expression cassettes, transgenic cell lines, or recombinant bacteria OsbZIP65 The gene is overexpressed.
[0033] Example 1
[0034] OsbZIP65 Low temperature stress-induced expression profile
[0035] OsbZIP65 The CDS sequence is shown in SEQ ID NO.1.
[0036] SEQ ID NO.1:
[0037] Two-week-old wild-type rice seedlings of Zhonghua 11 were subjected to low temperature and ABA stress treatments. Samples were taken from the control at room temperature and from the synchronous low temperature (4℃) and ABA treatments, respectively. RNA was extracted, and real-time quantitative PCR results showed that the RNA was generated during the seedling stage. OsbZIP65Roots showed significant downregulation induced by low temperature at 6 h, followed by rapid upregulation induced by ABA treatment at 12 h. Figure 1 The primers used for Realtime PCR are shown in Table 1.
[0038] Table 1 Primers used for Real-time PCR
[0039]
[0040] Example 2
[0041] Acquisition of stress-resistance genes
[0042] 1 OsbZIP65 Gene cloning and vector construction
[0043] Obtain the gene coding sequence from the Rice Genome Annotation Network (http: / / rice.plantbiology.msu.edu / ), design a 5' primer starting from the ATG coding start site of this gene, and a 3' primer at the stop codon.
[0044] Table 2 Primers used for vector construction
[0045]
[0046] Note: 65::Flag: pCambia-1300-221- OsbZIP65 -Flag;ko- bzip65 pYLCRISPR-Cas9- bzip65 .
[0047] 1) OsbZIP65 Construction of overexpression vectors
[0048] Total RNA was extracted from flower 11 during the seedling stage, and cDNA was obtained by reverse transcription. The cDNA was then amplified by RT-PCR using the primers listed in Table 2. OsbZIP65 The full-length CDS fragment of the gene is 543 bp in size; additional primers were added during amplification. Xba I and Sal I restriction site. PCR amplification product is ligated to the enzyme... Xba I and Kpn The vector plasmid pCambia1300-221-Flag, digested with enzyme I, was transformed into E. coli by heat shock. E.coli DH5α was used to select positive clones, and the overexpression plasmid pCambia1300-221-Flag- was obtained. OsbZIP65 ( Figure 4 ).
[0049] 2) OsbZIP65 Construction of gene editing vectors
[0050] use Bsa pYLCRISPR-Cas9-gxy was digested with a single enzyme, and the approximately 16 kb vector band was recovered by electrophoresis and gel extraction. Specific target primers were designed using CRISPR-GE (http: / / skl.scau.edu.cn / ), and primers were modified and annealed in a PCR instrument. The PCR product and the purified vector product were ligated using T4 DNA ligase. Subsequently, the constructed vector was transformed into competent cells using the heat shock method and cultured at 37°C for 12-16 h. Wearing orange-yellow goggles, the plates were illuminated with a 450nm blue light flashlight, and single colonies without fluorescence were circled with a marker (fluorescent single colonies were incompletely digested empty vectors). The gene-editing plasmid pYLCRISPR-Cas9-gxy was obtained. bzip65 ( Figure 5 ).
[0051] Table 3. Enzyme digestion system of overexpression vector pCambia1300-221-Flag
[0052]
[0053] Table 4. Enzyme digestion reaction system of gene editing vector pYLCRISPR-Cas9-gxy
[0054]
[0055] Example 3
[0056] 1. The Acquisition of Genetically Modified Rice
[0057] The expression vector obtained in Example 2 was transformed into rice using Agrobacterium-mediated transformation, as follows:
[0058] 1) Transformation of Agrobacterium
[0059] The recombinant vector plasmid obtained in Example 2 above was transformed into Agrobacterium AGL1 strain.
[0060] 2) Obtaining rice callus infection and positive transgenic rice
[0061] Select mature ZH11 rice seeds, remove the husks, and pour them into 50mL centrifuge tubes pre-filled with 75% ethanol in a clean bench. Sterilize for 1 min, then discard the ethanol. Rinse once with sterile water, discard the ethanol, then add 30% NaClO for 20 min of sterilization. Discard the NaClO and rinse 5-6 times with sterile water. Absorb excess water from the seeds with sterile filter paper, transfer them to induction medium, 20-25 seeds per plate, and incubate at 32°C under light for about 8 days. The incubated seeds are then ready for subsequent Agrobacterium infection and transformation. Agrobacterium infection and selection culture: In a clean bench, streak Agrobacterium containing the target gene vector onto plates containing 50 μg / mL Kan + 20 μg / mL Rif. Incubate at 28°C in the dark for 2 days until single colonies appear. Using a pipette, scrape the activated Agrobacterium from the plate into a suspension medium and incubate at 28°C with shaking at 200 rpm for approximately 3 hours (OD600 = 0.1-0.2). Select callus tissue (good callus condition, bright yellow color, round and firm texture, with a particle diameter of approximately 3 mm) and place it in a 100 mL sterile Erlenmeyer flask. Add an appropriate amount of Agrobacterium suspension medium (ensuring sufficient contact between the bacterial solution and the material), and incubate at room temperature for 10 minutes, shaking 3-5 times during the incubation period. Discard the bacterial solution, place the callus tissue on sterile filter paper to absorb excess bacterial solution, and then transfer it to a solid co-culture medium lined with a layer of sterile filter paper. Incubate at 26°C in the dark for 3 days. After 3 days of incubation, use a 1 mL pipette tip to transfer the callus from the co-culture medium into a sterilized Erlenmeyer flask, rinse 3-5 times with sterile water, and then rinse with sterile water containing 500 mg / L carbenicillin. After discarding the sterile water, transfer the callus tissue to sterile filter paper and air dry it in a laminar flow hood for about 30 minutes. After the callus has dried, transfer it to a selection medium containing 50 mg / L hygromycin B for selection culture at 32°C in the dark for about 3-4 weeks to obtain resistant callus tissue.
[0062] After about one month of screening, bright yellow positive calluses will appear. At this time, the positive calluses can be picked and transferred to differentiation medium for differentiation and regeneration. Sixteen positive calluses are placed on each differentiation dish and cultured under light at 28-30°C. Generally, green spots will appear on the calluses after about 10 days, and seedlings will differentiate after another 10 days. When the differentiated seedlings grow to about 2-3 cm and have a distinct root system, they can be transferred to rooting medium and cultured under sterile light at 28-30°C to obtain stable T0 generation transgenic plants. Leaves of 2-3 cm length are cut from individual T0 generation overexpression plants, and DNA is extracted using the CTAB method. Using the DNA as a template, the primer sequences are bZIP65-F: 5' CCTTCCTCTATATAAGGAAGTT 3', bZIP65-R: 5' AGATCAGTTTCTGTACCAGTGC 3'. Plants amplifying a 590 bp DNA fragment are considered positive transgenic plants. Leaves of 2-3 cm length from T0 generation gene-edited plants were harvested from individual plants, and DNA was extracted using the CTAB method. Using the DNA as a template, the primer sequences used were bzip65-F: 5' GACCACCATATTCTACAAAATACTTCTCAT3' and bzip65-R: 5'ATCCATAAAGCAAACTAATTAAAGCTAGG3'. The target fragment was amplified and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing analysis, and the sequencing results were compared.
[0063] Example 4
[0064] Identification of low-temperature tolerance in seedlings of transgenic T3 generation plants
[0065] The japonica rice variety Zhonghua 11 (ZH11) was used. Seeds were surface-sterilized with 70% ethanol for 3 minutes, rinsed with distilled water, and soaked in water at 28°C in the dark for 2 days. Germinated seeds were then transferred to an IRRI hydroponic growth system under controlled conditions (14 hours of light, 10 hours of darkness, 28°C, and 70% humidity).
[0066] Overexpressing T2 generation positive transgenic rice seeds were harvested, soaked in water for 3 days to induce germination, and then screened for resistance using 50 mg / L hygromycin. Simultaneously, non-transgenic rice Zhonghua 11 was used as a control. After 7 days of screening, all control plants died. The number of resistant seedlings and dead seedlings was counted, and the resistance segregation ratio of the transgenic lines was analyzed. Lines with a segregation ratio of approximately 3:1 between resistant and non-resistant seedlings were selected, indicating the acquisition of transgenic lines with single-site insertion. Single-copy lines were propagated, and T3 generation transgenic lines were screened again with hygromycin; lines producing only resistant seedlings were considered homozygous. The above-mentioned single-copy and homozygous T3 generation transgenic lines were then nutrient-treated with IRRI nutrient solution from the International Rice Research Institute (IRRI). www.irri.orgAfter two weeks of cultivation under normal conditions (light intensity: 2500 lux, 15 h light / 9 h dark, 28 ± 2℃), the seedlings were placed at 4℃ (light intensity: 2500 lux, 15 h light / 9 h dark) for 4 days of low-temperature treatment, and then cultured at room temperature for another 8 days. The number of surviving seedlings was counted using non-transgenic Zhonghua 11 as a control. Alternatively, after two weeks of cultivation in IRRI nutrient solution under normal conditions (light intensity: 2500 lux, 15 h light / 9 h dark, 28 ± 2℃), the mutant plants were placed at 4℃ (light intensity: 2500 lux, 15 h light / 9 h dark) for 4 days of low-temperature treatment, and then cultured at room temperature for another 6 days. The survival rate was also counted using non-transgenic Zhonghua 11 as a control.
[0067] The results of low-temperature screening of genetically modified rice are as follows: Figure 2 and 3 As shown, survival rate was assessed by checking whether seedlings had grown new leaves; seedlings with new leaves were considered alive. The survival rate (surviving seedlings / total number of selected seedlings × 100%) was used to represent the transgenic plants' tolerance to low temperatures. Overexpression lines showed significantly higher survival rates after low-temperature treatment than wild-type ZH11, while knockout lines showed significantly lower survival rates after low-temperature treatment than ZH11.
[0068] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. OsbZIP65 The application of genes or their encoded proteins in improving the cold tolerance of plants, characterized by: The OsbZIP65 The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the plant is rice.
2. The application according to claim 1, characterized in that, Overexpression of the OsbZIP65 gene or increasing the level of the protein encoded thereby, increases the low temperature tolerance of the plant.
3. OsbZIP65 Genes or containing OsbZIP65 The application of recombinant gene vectors, expression cassettes, transgenic cell lines, or recombinant bacteria in cultivating cold-resistant plant varieties is characterized by, The OsbZIP65 The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the plant is rice.
4. The application according to claim 3, characterized in that, The recombinant vector, expression cassette, transgenic cell line, or recombinant bacteria are used for overexpression of the [specification / material]. OsbZIP65 Genes or increase the level of the proteins they encode.
5. A method for improving the low-temperature tolerance of plants, characterized in that, Overexpression OsbZIP65 The gene may increase the level of the protein it encodes, thereby improving the plant's ability to withstand low temperatures; The OsbZIP65 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the plant is rice.
6. A method for cultivating new rice varieties with strong low-temperature resistance, characterized in that, Overexpression OsbZIP65 The gene or the level of its encoded protein can be increased to improve the plant's cold tolerance; OsbZIP65 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
7. The method according to claim 6, characterized in that, Utilizing OsbZIP65 Recombinant gene vectors, expression cassettes, transgenic cell lines, or recombinant bacteria OsbZIP65 The gene is overexpressed.
Citation Information
Patent Citations
Application of rice transcription factor bZIP65 in improving nitrogen utilization efficiency of plants
CN119464363A
Rice sheath blight resistance related gene OsbZIP65 and application thereof
CN119932042A