Preparation method and application of recombinant pig for expressing human HLA-B*15: 02 gene

Abstract

The invention discloses a preparation method and application of a recombinant pig for expressing a human-derived HLA-B * 15: 02 gene. The invention provides a recombinant pig which is obtained by inserting a human HLA-B * 15: 02 gene into genome DNA (Deoxyribose Nucleic Acid) of the pig. The recombinant pig can be used as a pig model for screening drugs causing immune-mediated adverse reactions. The invention provides application of the recombinant pig in preparation of a pig model. The pig model is used for mechanism research of the immune-mediated adverse drug reaction or used for assisting establishment of a diagnostic standard of the immune-mediated adverse drug reaction or used for screening markers of the immune-mediated adverse drug reaction or used for research and development of drugs with the immune-mediated adverse drug reaction as indications. The invention has application and popularization values for related research and clinic of immune-mediated adverse reactions.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and relates to a preparation method of a recombinant pig expressing a human HLA-B*15:02 gene and application thereof. BACKGROUND

[0002] Adverse drug reactions (ADRs) are adverse events caused by the inherent biological effects of drugs. According to statistics, about several hundred thousand people die every year due to ADRs. ADRs are a major public health problem affecting patient health. Immune-mediated adverse drug reactions (IM-ADRs) account for about 20% of all ADRs, and are a type of serious and unpredictable adverse reactions in clinical practice, with medical costs much higher than the predictable 80%. IM-ADRs are rare but have obvious clinical phenotypes, involving multiple tissues and organs such as skin, liver, and bone marrow, and can be fatal in severe cases. For example, drug rash with eosinophilia and systemic symptoms (DRESS), acute generalized pustulosis, Stevens-Johnson syndrome / toxic epidermal necrosis (SJS / TEN), and drug-induced liver injury (DILI), with a mortality rate ranging from 7.6% to 50%. There are more than 100 drugs that have been clearly associated with IM-ADRs, involving aromatic anticonvulsants, antibacterial drugs, antiretroviral drugs, some non-steroidal anti-inflammatory drugs, and immunotherapy drugs. The severity of immune-mediated adverse drug reactions is closely related to the quality of life of patients, and early prediction of drugs that may cause adverse reactions will help improve the quality of life of patients and maximize the benefits of drugs.

[0003] Due to limited understanding of the mechanism of IM-ADRs, it is difficult to predict IM-ADRs in clinical practice. In recent years, with the development of pharmacogenomics, a large number of studies have suggested that human leukocyte antigen (HLA) alleles are strongly associated with the occurrence of IM-ADRs. HLA, also known as human leukocyte antigen, is a gene that encodes the major histocompatibility complex (MHC). MHC is a group of cell surface proteins that can bind to foreign molecules to be recognized by corresponding T cells, and then induce an immune response. HLA polymorphism has the potential to predict IM-ADRs, and has become an important immunopharmacological biomarker.

[0004] The genetic polymorphisms closely related to IM-ADRs are mainly located in the HLA-B gene locus, and the common ones are HLA-B*15:02, HLA-B*58:01, HLA-B*57:01, HLA-B*13:0 and HLA-B*35:01, etc. Among them, HLA-B*15:02 is the most widely studied and the most affected drug polymorphism, with a mutation frequency of up to 10%-15% in Asian populations. FDA, CPIC and other instructions or clinical guidelines emphasize that HLA-B*15:02 detection should be performed before using carbamazepine in Asian regions to reduce the incidence of SJS / TEN. In addition to carbamazepine, HLA-B*15:02 is also related to adverse reactions of other drugs such as oxcarbazepine, phenytoin sodium, lamotrigine, etc. Recently, it has also been reported that patients with DRESS induced by anti-infective drug ceftazidime and patients with DILI induced by anti-parasitic drug albendazole all carry HLA-B*15:02, suggesting that there may be other drugs affected by HLA-B*15:02 that induce IM-ADRs to be further discovered. Therefore, predicting drugs that can be affected by HLA-B*15:02 to induce IM-ADRs is a difficult problem to be solved, which will help to provide safe and precise drug reference for clinical practice.

[0005] HLA-B*15:02-mediated IM-ADRs has low incidence, severe condition, difficulty in obtaining patient samples, and lack of safety evaluation animal models. These problems lead to the inability to prevent the disease, the difficulty in conducting mechanism research, and the inability to find specific diagnostic indicators. Therefore, constructing an animal model of the disease is the key to solving the above problems.

[0006] The current mainstream approach is to construct humanized transgenic animals using mice as models. The research team of Yangming University in Taiwan, China, was the first to construct the world's first HLA-B*15:02 humanized transgenic mouse, but no obvious phenotype was observed after feeding the mouse carbamazepine. Among other common model animals, non-mammals such as fruit flies and zebrafish have low similarity to humans, cannot simulate the drug administration process, and cannot be repeatedly sampled; dogs have high difficulty in gene editing and somatic cell cloning; non-human primates have high cost, high difficulty in gene editing and somatic cell cloning, and are not suitable as models for IM-ADRs. Pig is one of the most common mammals, and compared with rodents, pigs are more similar to humans in physiology, and compared with primates, pigs have the characteristics of fast growth, low construction cost, and low difficulty in gene editing, so pigs are the best candidate model animal for simulating HLA-B*15:02-mediated IM-ADRs. Currently, there is no report on the use of HLA-B*15:02 humanized transgenic pigs to explore IM-ADRs.

[0007] In summary, the development of a transgenic pig model expressing humanized HLA-B*15:02 mutations and the use of this model to simulate IM-ADRs of drugs to demonstrate that the humanized HLA-B*15:02 transgenic pig model can be used as a new tool for drug safety evaluation will provide a convenient adverse reaction evaluation platform for marketed drugs and new drugs to be marketed, which has important significance for IM-ADR prediction, prevention and treatment. SUMMARY

[0008] The purpose of the present application is to provide a method for preparing a recombinant pig expressing a human HLA-B*15:02 gene and its application.

[0009] The present application provides the application of a recombinant pig, which is a recombinant pig obtained by inserting a human HLA-B*15:02 gene or a DNA molecule having a human HLA-B*15:02 gene into the genomic DNA of a pig, for (a1) or (a2): (a1) the application of a recombinant pig in screening drugs causing immune-mediated adverse reactions; (a2) the application of a recombinant pig as a pig model; the use of the pig model is for screening drugs causing immune-mediated adverse reactions.

[0010] The present application also provides the application of a recombinant pig in preparing a pig model; the recombinant pig is a recombinant pig obtained by inserting a human HLA-B*15:02 gene or a DNA molecule having a human HLA-B*15:02 gene into the genomic DNA of a pig; the use of the pig model is for (b1) or (b2) or (b3) or (b4): (b1) for the mechanism research of immune-mediated drug adverse reactions; (b2) for assisting in establishing the diagnostic criteria of immune-mediated drug adverse reactions; (b3) for screening markers of immune-mediated drug adverse reactions; (b4) for the development of drugs for the indication of immune-mediated drug adverse reactions.

[0011] The present application also provides a method for preparing a recombinant pig, comprising the following steps: (1) preparing a recombinant cell; the recombinant cell is a recombinant cell obtained by inserting a human HLA-B*15:02 gene or a DNA molecule having a human HLA-B*15:02 gene into the genomic DNA of a pig cell; (2) using somatic cell nuclear transfer technology to prepare a cloned pig from the recombinant cell, which is a recombinant pig. The use of the recombinant pig is for (d1) or (d2): (d1) screening drugs causing immune-mediated adverse reactions; (d2) as a pig model for screening drugs causing immune-mediated adverse reactions.

[0012] The present application also provides a method for preparing a pig model, comprising the following steps: preparing a pig model by giving a recombinant pig a drug-induced immune-mediated adverse reaction; the recombinant pig is a recombinant pig obtained by inserting a human HLA-B*15:02 gene or a DNA molecule having a human HLA-B*15:02 gene into the genomic DNA of a pig.

[0013] The present application also provides the use of the pig model prepared by the method, for (b1) or (b2) or (b3) or (b4):

[0014] (b1) mechanism research of immune-mediated adverse drug reactions;

[0015] (b2) assisting in establishing diagnostic criteria for immune-mediated adverse drug reactions;

[0016] (b3) screening markers of immune-mediated adverse drug reactions;

[0017] (b4) developing drugs for indications of immune-mediated adverse drug reactions.

[0018] The present application also provides the use of a recombinant cell or a substance for preparing a recombinant cell in preparing a recombinant pig; the recombinant cell is a recombinant cell obtained by inserting a human HLA-B*15:02 gene or a DNA molecule having a human HLA-B*15:02 gene into the genomic DNA of a pig cell. The substance for preparing a recombinant cell is a human HLA-B*15:02 gene-related biological material. The use of the recombinant pig is (d1) or (d2): (d1) screening drugs causing immune-mediated adverse reactions; (d2) as a pig model for screening drugs causing immune-mediated adverse reactions.

[0019] The present application also provides the use of a recombinant cell or a substance for preparing a recombinant cell in preparing a pig model; the recombinant cell is a recombinant cell obtained by inserting a human HLA-B*15:02 gene or a DNA molecule having a human HLA-B*15:02 gene into the genomic DNA of a pig cell. The substance for preparing a recombinant cell is a human HLA-B*15:02 gene-related biological material. The use of the pig model is (b1) or (b2) or (b3) or (b4): (b1) mechanism research of immune-mediated adverse drug reactions; (b2) assisting in establishing diagnostic criteria for immune-mediated adverse drug reactions; (b3) screening markers of immune-mediated adverse drug reactions; (b4) developing drugs for indications of immune-mediated adverse drug reactions.

[0020] The present application also provides use of a substance for preparing a recombinant cell in the preparation of a recombinant pig or a pig model; the substance for preparing a recombinant cell is a human HLA-B*15:02 gene related biological material, a plasmid expressing sgRNA, and a plasmid expressing Cas9 protein; the recombinant pig is a recombinant pig obtained by inserting a human HLA-B*15:02 gene or a DNA molecule having a human HLA-B*15:02 gene into the genomic DNA of a pig. The use of the recombinant pig is as follows (d1) or (d2): (d1) screening of drugs causing immune-mediated adverse reactions; (d2) as a pig model for screening drugs causing immune-mediated adverse reactions. The use of the pig model is as follows (b1) or (b2) or (b3) or (b4): (b1) for mechanism research of immune-mediated adverse drug reactions; (b2) for assisting the establishment of diagnostic criteria for immune-mediated adverse drug reactions; (b3) for screening markers of immune-mediated adverse drug reactions; (b4) for the development of drugs for the indication of immune-mediated adverse drug reactions.

[0021] The present application also provides use of a substance for preparing a recombinant cell in the preparation of a recombinant pig or a pig model; the substance for preparing a recombinant cell is a human HLA-B*15:02 gene related biological material, a plasmid expressing sgRNA, and a plasmid expressing Cas9 protein; the recombinant pig is a recombinant pig obtained by inserting a human HLA-B*15:02 gene or a DNA molecule having a human HLA-B*15:02 gene into the genomic DNA of a pig. The use of the recombinant pig is as follows (d1) or (d2): (d1) screening of drugs causing immune-mediated adverse reactions; (d2) as a pig model for screening drugs causing immune-mediated adverse reactions. The use of the pig model is as follows (b1) or (b2) or (b3) or (b4): (b1) for mechanism research of immune-mediated adverse drug reactions; (b2) for assisting the establishment of diagnostic criteria for immune-mediated adverse drug reactions; (b3) for screening markers of immune-mediated adverse drug reactions; (b4) for the development of drugs for the indication of immune-mediated adverse drug reactions.

[0022] Any of the above-mentioned human HLA-B*15:02 gene related biological materials is any of the following (c1) to (c6):

[0023] (c1) a human HLA-B*15:02 gene;

[0024] (c2) a DNA molecule having a human HLA-B*15:02 gene;

[0025] (c3) an expression cassette expressing a human HLA-B*15:02 gene;

[0026] (c4) a DNA molecule having the expression cassette of (c3);

[0027] (c5) a recombinant vector having a human HLA-B*15:02 gene;

[0028] (c6) a recombinant vector having the expression cassette of (c3).

[0029] The drug screened for the immune-mediated adverse reaction in any of the above can be a new drug (i.e. a substance unknown in the prior art) or an old drug (i.e. a drug having more than one indication in the prior art, but the prior art does not know whether it can cause an immune-mediated adverse reaction).

[0030] The recombinant pig in any of the above is a recombinant pig obtained by inserting a human HLA-B*15:02 gene or a DNA molecule having a human HLA-B*15:02 gene into a COL1A1 safe harbor site in the genomic DNA of the pig.

[0031] The recombinant cell in any of the above is a recombinant cell obtained by inserting a human HLA-B*15:02 gene or a DNA molecule having a human HLA-B*15:02 gene into a COL1A1 safe harbor site in the genomic DNA of the pig cell.

[0032] Specifically, the insertion site in any of the above is a COL1A1 safe harbor site.

[0033] Specifically, the insertion site in any of the above is between the upstream homology arm and the downstream homology arm in the genomic DNA. The upstream homology arm is shown in SEQ ID NO: 4 at positions 1-381. The downstream homology arm is shown in SEQ ID NO: 4 at positions 5524-6661.

[0034] As an example, the method for preparing a recombinant cell is as follows: co-transfecting a pig cell with a human HLA-B*15:02 gene-related biological material, a plasmid expressing sgRNA, and a plasmid expressing Cas9 protein to obtain a recombinant cell.

[0035] Specifically, the human HLA-B*15:02 gene in any of the above is a gene encoding human HLA-B*15:02.

[0036] Specifically, the human HLA-B*15:02 is shown in SEQ ID NO: 1.

[0037] Specifically, the coding strand of the human HLA-B*15:02 gene is shown in SEQ ID NO: 2.

[0038] Specifically, the expression cassette expressing the human HLA-B*15:02 gene is shown in SEQ ID NO: 4 (template strand) at positions 673-3530.

[0039] Specifically, the DNA molecule with the human HLA-B*15:02 gene is shown in SEQ ID NO: 4 at positions 382-5523.

[0040] Specifically, the DNA molecule with the human HLA-B*15:02 gene is shown in SEQ ID NO: 4 at positions 1-6661.

[0041] Specifically, the DNA molecule with the human HLA-B*15:02 gene has a COL1A1 safe harbor insertion site 5' end porcine genome region at one end and a COL1A1 safe harbor insertion site 3' end porcine genome region at the other end. The COL1A1 safe harbor insertion site 5' end porcine genome region is shown in SEQ ID NO: 4 at positions 1-381. The COL1A1 safe harbor insertion site 3' end porcine genome region is shown in SEQ ID NO: 4 at positions 5524-6661.

[0042] Specifically, the recombinant vector is shown in SEQ ID NO: 4.

[0043] Specifically, the sgRNA-expressing plasmid is a plasmid expressing the sgRNA shown in SEQ ID NO: 5. As an example, the sgRNA-expressing plasmid is prepared as follows: take the plasmid pKG-U6gRNA, perform enzyme digestion with the restriction enzyme BbsI, and recover the vector skeleton (a linear large fragment of about 3 kb). Synthesize COL1A1-g3-S and COL1A1-g3-A respectively, then mix and anneal to obtain a double-stranded DNA molecule with sticky ends. Link the double-stranded DNA molecule with sticky ends and the vector skeleton to obtain the plasmid pKG-U6gRNA(COL1A1-g3).

[0044] As an example, the Cas9 protein is a protein encoded by nucleotides at positions 1037-5161 in SEQ ID NO: 2 in patent application 202010084343.6. As an example, the Cas9 protein-expressing plasmid is plasmid pKG-GE3. Plasmid pKG-GE3 is a circular plasmid, as shown in SEQ ID NO: 2 in patent application 202010084343.6.

[0045] As an example, the method for preparing the recombinant cell is as follows: the donor plasmid, the plasmid pKG-U6gRNA (COL1A1-g3) and the plasmid pKG-GE3 are co-transfected into the pig cell, cultured, and then the EGFP positive cells are screened by FACS, which are the recombinant cells.

[0046] As an example, the method for preparing the recombinant cell is as follows: the donor plasmid, the plasmid pKG-U6gRNA (COL1A1-g3) and the plasmid pKG-GE3 are co-transfected into the pig cell, cultured, and then the EGFP positive cells are screened by FACS, which are the recombinant cells.

[0047] Specifically, the ratio is as follows: 200,000 pig cells: 1.3 μg donor plasmid: 0.8 μg plasmid pKG-U6gRNA (COL1A1-g3): 0.9 μg plasmid pKG-GE3.

[0048] Specifically, the pig cell is a pig fibroblast cell.

[0049] Specifically, the pig cell is a pig primary fibroblast cell.

[0050] Specifically, the pig is a Bama mini pig.

[0051] Specifically, the immune-mediated adverse drug reaction is any one of the following: Stevens-Johnson syndrome / toxic epidermal necrolysis, drug hypersensitivity syndrome, urticaria, acute generalized pustulosis or drug-induced liver injury.

[0052] Specifically, the immune-mediated adverse reaction is manifested as skin and mucosal inflammation and / or immune response.

[0053] Specifically, the immune-mediated adverse reaction is manifested as: nasal cracking and / or mouth inflammation and swelling and / or periorbital swelling and / or lower eyelid ulceration and / or hind limb redness and swelling and / or hind foot cracking with red patches and / or facial skin inflammation and swelling.

[0054] Specifically, the immune-mediated adverse reaction is manifested as: an increase in the content of white blood cells and / or an increase in the content of neutrophils and / or a decrease in the content of lymphocytes and / or an increase in the content of intermediate cells in the blood compared with before administration. The intermediate cells are composed of monocytes, eosinophils and basophils.

[0055] Specifically, the immune-mediated adverse reaction is manifested as: a decrease in the content of albumin and / or an increase in the content of glutamic-oxalacetic transaminase and / or a decrease in the content of cholinesterase and / or a decrease in the content of glucose and / or an increase in the content of globulin in the blood compared with before administration.

[0056] Specifically, the blood is peripheral blood.

[0057] Specifically, the recombinant pig expresses the human HLA-B*15:02 gene in the heart and / or liver and / or spleen and / or lung and / or lymph node and / or skin and / or kidney and / or adrenal gland and / or pancreas and / or thymus and / or small intestine and / or cecum and / or large intestine.

[0058] Specifically, the immune-mediated adverse reaction is embodied as any one or any combination of ① to ⑦: ① regional necrosis of skin tissue, accompanied by inflammatory cell infiltration, subcutaneous fat cell necrosis, hemorrhage, and accompanied by a small amount of lymphocyte infiltration; ② in lung tissue, alveolar cavity is abnormally large, alveolar wall is obviously thickened, there are multiple inflammatory cell infiltration foci, and accompanied by hemorrhage; ③ mononuclear cell infiltration foci appear in liver tissue, hepatocytes are slightly swollen, and liver sinusoids are narrowed; ④ cortex and medulla of lymph nodes are enlarged, germinal center is reactive hyperplasia, and hemorrhage; ⑤ in kidney tissue, glomerulus appears congestion, atrophy, and accompanied by plasma protein exudation; ⑥ necrosis and hemorrhage of small intestinal villi appear in small intestinal tissue, accompanied by inflammatory cell infiltration; ⑦ bone marrow cells are significantly reduced.

[0059] The immune-mediated adverse reaction is embodied in that the content of gamma-interferon in the heart is 100 pg / mg or more and / or the content of gamma-interferon in the skin is 100 pg / mg or more and / or the content of gamma-interferon in the muscle is 50 pg / mg or more and / or the content of gamma-interferon in the thymus is 50 pg / mg or more and / or the content of apoptosis-related factor ligand in the heart is 100 pg / mg or more and / or the content of apoptosis-related factor ligand in the liver is 100 pg / mg or more and / or the content of apoptosis-related factor ligand in the kidney is 100 pg / mg or more and / or the content of apoptosis-related factor ligand in the adrenal gland is 50 pg / mg or more and / or the content of apoptosis-related factor ligand in the skin is 50 pg / mg or more and / or the content of apoptosis-related factor ligand in the thymus is 50 pg / mg or more and / or the content of perforin in the heart is 100 ng / mg or more and / or the content of perforin in the liver is 50 ng / mg or more and / or the content of perforin in the kidney is 50 ng / mg or more and / or the content of perforin in the thymus is 25 ng / mg or more and / or the content of granulysin in the heart is 10 ng / mg or more and / or the content of granulysin in the liver is 40 ng / mg or more and / or the content of granulysin in the kidney is 40 ng / mg or more and / or the content of granulysin in the adrenal gland is 10 ng / mg or more and / or the content of granulysin in the skin is 10 ng / mg or more and / or the content of granulysin in the thymus is 20 ng / mg or more and / or the content of granzyme B in the heart is 3000 pg / mg or more and / or the content of granzyme B in the liver is 1500 pg / mg or more and / or the content of granzyme B in the adrenal gland is 1500 pg / mg or more and / or the content of granzyme B in the skin is 3000 pg / mg or more and / or the content of granzyme B in the thymus is 4500 pg / mg or more.

[0060] The present application has application popularization value for developing drugs avoiding immune-mediated adverse reactions. The present application has application popularization value for the related mechanism research and clinical drug development of immune-mediated adverse reactions. BRIEF DESCRIPTION OF DRAWINGS

[0061] Figure 1 It is a structural schematic diagram of plasmid pKG-HLA-B*15:02.

[0062] Figure 2 It is a genomic level recombination identification of HLA-B*15:02 mutant cloned pigs.

[0063] Figure 3 It is a genomic level recombination identification of HLA-B cloned pigs.

[0064] Figure 4Transcriptional level expression analysis of cloned pigs for HLA-B*15:02.

[0065] Figure 5 Transcriptional level expression analysis of cloned pigs for HLA-B.

[0066] Figure 6 Protein expression analysis of cloned pigs for HLA-B*15:02.

[0067] Figure 7 Protein expression analysis of cloned pigs for HLA-B.

[0068] Figure 8 Body weight change graph of HLA-B*15:02 cloned pigs (K22, K29 and K31) from birth to adulthood.

[0069] Figure 9 Body length change graph of HLA-B*15:02 cloned pigs (K22, K29 and K31) from birth to adulthood.

[0070] Figure 10 Body temperature change graph of HLA-B*15:02 cloned pigs (K22, K29 and K31) from birth to adulthood.

[0071] Figure 11 Body weight change graph of HLA-B cloned pigs (K93, K112 and K113) from birth to adulthood.

[0072] Figure 12 Body length change graph of HLA-B cloned pigs (K93, K112 and K113) from birth to adulthood.

[0073] Figure 13 Body temperature change graph of HLA-B cloned pigs (K93, K112 and K113) from birth to adulthood.

[0074] Figure 14 Appearance change of HLA-B*15:02 cloned pigs and HLA-B cloned pigs after administration of carbamazepine.

[0075] Figure 15 Blood routine test results of HLA-B*15:02 cloned pigs and HLA-B cloned pigs before and after administration of carbamazepine.

[0076] Figure 16 Blood biochemical test results of HLA-B*15:02 cloned pigs and HLA-B cloned pigs before and after administration of carbamazepine.

[0077] Figure 17Detection of gene transcription level and protein expression level in each tissue of the pig cloned for HLA-B*15:02.

[0078] Figure 18 Detection of gene transcription level and protein expression level in each tissue of the pig cloned for HLA-B.

[0079] Figure 19 The result chart of hematoxylin-eosin staining of each tissue of the pig cloned for HLA-B*15:02 and the pig cloned for HLA-B after administration of carbamazepine.

[0080] Figure 20 The result of inflammatory factor content of the pig cloned for HLA-B*15:02 and the pig cloned for HLA-B and the WT control pig after administration of carbamazepine.

[0081] Figure 21 The change of immune-related gene expression level of the pig cloned for HLA-B*15:02 and the pig cloned for HLA-B before and after administration of carbamazepine.

[0082] Figure 22 The change of immune cell quantity and type of the pig cloned for HLA-B*15:02 before and after administration of carbamazepine.

[0083] Figure 23 The change of immune cell quantity and type of the pig cloned for HLA-B before and after administration of carbamazepine. DETAILED DESCRIPTION

[0084] The application will be further described in conjunction with the specific embodiments. The examples provided below are only for the purpose of illustrating the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the application.

[0085] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. In the following examples, the materials, reagents, etc. used are commercially available, unless otherwise specified. In the following examples, the quantitative tests are set up with three repeated experiments, and the results are averaged, unless otherwise specified. In the examples, the significance of the difference is indicated by asterisks, one asterisk (*) indicates that the P value is less than 0.05, two asterisks (**) indicates that the P value is less than 0.01, and three asterisks (***) indicates that the P value is less than 0.001. Cell culture conditions: 37℃, 5% CO2, 5% O2 in a constant temperature incubator. Carbamazepine (single tablet specification 200mg): Novartis, trade name Daili Du. TCM-199 culture medium: Sigma, product catalog number M4530. In the test, the test animals are bred and fed under the same conditions.

[0086] The pig primary fibroblasts used in the examples were prepared from the ear tissue of a newborn Bama mini-pig. The method for preparing the pig primary fibroblasts was as follows: ① 0.5 g of pig ear tissue was obtained, the hair and bone tissue were removed, and then the tissue was immersed in 75% alcohol for 30-40 s, then washed with PBS buffer containing 5% (v / v) Penicillin-Streptomycin (Gibco) for 5 times, and then washed with PBS buffer once; ② the tissue was cut into small pieces with scissors, and then digested with 5 mL of 0.1% collagenase solution (Sigma) at 37°C for 1 h, then centrifuged at 500g for 5 min, and the supernatant was discarded; ③ the precipitate was resuspended with 1 mL of complete culture medium, and then plated into a 10 cm diameter cell culture dish containing 10 mL of complete culture medium and sealed with 0.2% gelatin (VWR), and cultured until the cells covered about 60% of the bottom of the dish; ④ after step ③ was completed, the cells were digested with trypsin and collected, and then resuspended in complete culture medium.

[0087] The complete culture medium (% by volume): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio).

[0088] The pig oocyte in vitro maturation medium (IVM medium) contained 0.1 mg / mL pyruvic acid, 0.1 mg / mL cysteine hydrochloride, 10 ng / mL epidermal growth factor, 10% (v / v) pig follicular fluid (i.e. follicular fluid), 75 mg / mL penicillin, 50 mg / mL streptomycin, 10 IU / mL equine chorionic gonadotropin (eCG), and 10 IU / mL human chorionic gonadotropin (hCG), and the rest was TCM-199 medium.

[0089] The plasmid pKG-GE3 is a circular plasmid, as shown in SEQ ID NO: 2 in the patent application 202010084343.6. In SEQ ID NO: 2 in the patent application 202010084343.6, the nucleotides 395-680 constitute a CMV enhancer, the nucleotides 682-890 constitute an EFla promoter, the nucleotides 986-1006 encode a nuclear localization signal (NLS), the nucleotides 1016-1036 encode a nuclear localization signal (NLS), the nucleotides 1037-5161 encode a Cas9 protein, the nucleotides 5162-5209 encode a nuclear localization signal (NLS), the nucleotides 5219-5266 encode a nuclear localization signal (NLS), the nucleotides 5276-5332 encode a self-cleavage polypeptide P2A (the amino acid sequence of the self-cleavage polypeptide P2A is “ATNFSLLKQAGDVEENPGP”, and the cleavage position for self-cleavage is between the first and second amino acid residues from the C-terminus), the nucleotides 5333-6046 encode an EGFP protein, the nucleotides 6056-6109 encode a self-cleavage polypeptide T2A (the amino acid sequence of the self-cleavage polypeptide T2A is “EGRGSLLTCGDVEENPGP”, and the cleavage position for self-cleavage is between the first and second amino acid residues from the C-terminus), the nucleotides 6110-6703 encode a Puromycin protein (referred to as Puro protein), the nucleotides 6722-7310 constitute a WPRE sequence element, the nucleotides 7382-7615 constitute a 3’LTR sequence element, and the nucleotides 7647-7871 constitute a bGH poly(A) signal sequence element. In SEQ ID NO: 2 in the patent application 202010084343.6, the nucleotides 911-6706 form a fusion gene, expressing a fusion protein. Due to the presence of the self-cleavage polypeptide P2A and the self-cleavage polypeptide T2A, the fusion protein spontaneously forms three proteins: a protein with the Cas9 protein, a protein with the EGFP protein, and a protein with the Puro protein.

[0090] The pKG-U6gRNA vector, i.e., the plasmid pKG-U6gRNA, is a circular plasmid, as shown in SEQ ID NO: 3 in the patent application 202010084343.6. In SEQ ID NO: 3 in the patent application 202010084343.6, the nucleotides 2280-2539 constitute a hU6 promoter, and the nucleotides 2558-2637 are used for transcription to form a gRNA backbone. When used, a DNA molecule with a length of about 20 bp (a target sequence binding region used for transcription to form a gRNA) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in cells to obtain a gRNA.

[0091] Example 1, Preparation of recombinant cells

[0092] I. Construction of HLA-B*15:02 mutant Donor vector

[0093] The pKG-HLA-B*15:02 Donor vector is a plasmid pKG-HLA-B*15:02.

[0094] The plasmid pKG-HLA-B*15:02 is a circular plasmid, the full sequence is shown as SEQ ID NO: 4, and the structural schematic diagram is shown as Figure 1 In SEQ ID NO: 4, the nucleotides from 673 to 3530 constitute the HLA-B*15:02 gene expression cassette (template strand), and the nucleotides from 3850 to 5231 constitute the EGFP gene expression cassette (coding strand). In SEQ ID NO: 4, the nucleotides from 673 to 1245 constitute the EF1a Poly(A) signal, the nucleotides from 1252 to 2340 constitute the HLA-B*15:02 gene (template strand), and the nucleotides from 2353 to 3530 constitute the human hEF1a promoter. In SEQ ID NO: 4, the nucleotides from 3850 to 4179 constitute the SV40 promoter, the nucleotides from 4217 to 4933 constitute the EGFP gene, and the nucleotides from 5110 to 5231 constitute the SV40 Poly(A) signal. In SEQ ID NO: 4, the nucleotides from 3774 to 3807 constitute loxP, and the nucleotides from 5276 to 5309 constitute loxP, both of which are the same direction loxP. In SEQ ID NO: 4, the nucleotides from 1 to 381 are the 5' end porcine genome region of the COL1A1 safe harbor insertion site (left homologous arm), the nucleotides from 382 to 582 are Insulator 1, the nucleotides from 3537 to 3737 are Insulator 3, the nucleotides from 5323 to 5523 are Insulator 2, and the nucleotides from 5524 to 6661 are the 3' end porcine genome region of the COL1A1 safe harbor insertion site (right homologous arm).

[0095] The coding strand of the HLA-B*15:02 gene is shown as SEQ ID NO: 2. The HLA-B*15:02 gene encodes HLA-B*15:02. HLA-B*15:02 is a mutant form of wild-type HLA-B, and HLA-B*15:02 is shown as SEQ ID NO: 1.

[0096] II. Construction of HLA-B wild type Donor vector

[0097] pKG-HLA-B Donor vector, i.e., plasmid pKG-HLA-B.

[0098] Plasmid pKG-HLA-B is a circular plasmid. The difference between plasmid pKG-HLA-B and plasmid pKG-HLA-B*15:02 is only that the DNA segment shown in SEQ ID NO: 4 at positions 1252-2340 is replaced by the DNA molecule shown in SEQ ID NO: 3. The DNA molecule shown in SEQ ID NO: 3 is the HLA-B gene (template strand).

[0099] The coding strand of the HLA-B gene is shown as the reverse complement of SEQ ID NO: 3. The HLA-B gene encodes wild-type HLA-B. Wild-type HLA-B is also referred to as HLA-B, as shown in NCBI Reference Sequence: NP_005505.2 (27-APR-2025).

[0100] III. Preparation of COL1A1 safe harbor site gRNA recombinant vector

[0101] Plasmid pKG-U6gRNA was digested with restriction enzyme BbsI, and the vector backbone (a linear large fragment of about 3 kb) was recovered. COL1A1-g3-S and COL1A1-g3-A were synthesized respectively, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends and the vector backbone were ligated to obtain plasmid pKG-U6gRNA(COL1A1-g3). Plasmid pKG-U6gRNA(COL1A1-g3) expresses sgRNA shown in SEQ ID NO: 5 COL1A1-g3 .

[0102] COL1A1-g3-S and COL1A1-g3-A are both single-stranded DNA molecules.

[0103] COL1A1-g3-S: caccGCAGTCTCAGCAACCACTGA;

[0104] COL1A1-g3-A: aaacTCAGTGGTTGCTGAGACTGC.

[0105] IV. Co-transfection and EGFP-FACS screening of positive cells

[0106] The donor plasmid is plasmid pKG-HLA-B*15:02 or plasmid pKG-HLA-B, respectively. The exogenous target gene fragment in plasmid pKG-HLA-B*15:02 is named HLA-B*15:02 fragment, which is the DNA segment shown in SEQ ID NO: 4 at positions 382-5523. The exogenous target gene fragment in plasmid pKG-HLA-B is named HLA-B fragment. Compared with the HLA-B*15:02 fragment, the difference of the HLA-B fragment is only that the DNA segment shown in SEQ ID NO: 4 at positions 1252-2340 is replaced by the DNA molecule shown in SEQ ID NO: 3. The functions of plasmid pKG-GE3 and plasmid pKG-U6gRNA(COL1A1-g3) are to make a DNA double-strand break at the target site (COL1A1 safe harbor site) in the pig genomic DNA to improve the rate of homologous recombination. The donor plasmid homologously recombines with the pig genomic DNA to insert the exogenous target gene fragment between the COL1A1 left homologous arm and the COL1A1 right homologous arm in the pig genomic DNA.

[0107] The donor plasmid, plasmid pKG-U6gRNA(COL1A1-g3) and plasmid pKG-GE3 are co-transfected into pig primary fibroblasts. The ratio is about 200,000 pig primary fibroblasts: 1.3 μg donor plasmid: 0.8 μg plasmid pKG-U6gRNA(COL1A1-g3): 0.9 μg plasmid pKG-GE3; that is, the molar ratio of the three plasmids is 1:3:1, respectively. Co-transfection is performed by electroporation, using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon TMtransfection system electroporator (parameter settings: 1450V, 10ms, 3 pulses). After completing the electroporation, the surviving cells are collected and expanded, and then cultured for 8 days, and then EGFP positive cells are screened by FACS.

[0108] When the donor plasmid is plasmid pKG-HLA-B*15:02, the ratio of EGFP positive cells screened by FACS is 11.73%, and all the positive cells are collected and named 1# recombinant cells.

[0109] When the donor plasmid is plasmid pKG-HLA-B, the ratio of EGFP positive cells screened by FACS is 17.57%, and all the positive cells are collected and named 2# recombinant cells.

[0110] The 1# recombinant cells and the 2# recombinant cells are respectively passaged and expanded.

[0111] Example 2, production of cloned pigs based on somatic cell nuclear transfer technology

[0112] I. Oocyte in vitro maturation culture

[0113] Fresh adult sow ovaries were collected from slaughterhouse (ovaries from Duroc-Landrace-Yorkshire three-way cross sows), and stored in 37℃ preheated sterile saline containing 75 mg / mL penicillin and 50 mg / mL streptomycin, and transported to the laboratory in a 37℃ constant temperature transport box, and the transportation time was not more than 4 hours.

[0114] The ovaries were washed 3 times with 37℃ preheated D-PBS buffer to remove blood and impurities, and the ovaries were cut into 5-8 mm 3 pieces using a sterile scalpel blade to expose the follicles. Using an 18G needle and a 10 mL syringe (negative pressure ≤20 kPa), the cumulus-oocyte complexes (COCs) were extracted from follicles with a diameter of 3-8 mm, and an average of 15-25 COCs could be obtained from each ovary. COCs with at least three layers of dense cumulus cells and uniform cytoplasm were selected for subsequent experiments.

[0115] The IVM medium was pre-equilibrated at 38.5℃ in a 5% CO2 incubator for ≥2 hours. The COCs were washed 3 times with the equilibrated IVM medium. A 4-well cell culture plate was taken, 500 μL of IVM medium and 50 COCs were added to each well, covered with 400 μL of mineral oil (Sigma, M8410), and cultured in a 38.5℃, 5% CO2, saturated humidity incubator for 40-44 hours. The cumulus cells spread out and the first polar body was discharged as a sign of maturation. 300-400 COCs were cultured for each implantation.

[0116] II. Preparation of HLA-B*15:02 cloned pigs

[0117] HLA-B*15:02 cloned pigs, i.e. cloned pigs with HLA-B*15:02 gene integrated into COL1A1 safe harbor site in genomic DNA.

[0118] 1. Somatic cell nuclear transfer (SCNT)

[0119] The nuclear donor cell was 1# recombinant cell obtained in Example 1.

[0120] After completion of Step 1, the mature oocyte was transferred to TCM-199 medium containing 7.5 pg / mL cytochalasin B for 10 minutes to inhibit cytoskeletal activity. Then the oocyte was fixed with the polar body at the 12 o'clock position, and the protruding nucleus and polar body were removed in Tyrode lactate-pyruvate albumin medium using a sharp-tipped microinjection needle (about 20 pm in diameter). The nuclear donor cell was suspended in fusion medium after trypsin digestion, and a single nuclear donor cell with a diameter of 10-15 pm and a full shape with an intact membrane was injected into the perivitelline space of the enucleated oocyte to ensure that the donor cell membrane was in close contact with the oocyte plasma membrane. Then, using an embryo cell fusion instrument (ET3, Fujihira Industry), the nuclear donor cell and the recipient oocyte were electrically fused in fusion medium with a direct current pulse of 1.5 kV / cm for 30 ps. The fused cells were cultured in PZM-3 medium for 2 h to allow the nuclear reprogramming. Then, the fused cells were transferred to the activation medium, activated with a single pulse of 1.5 kV / cm for 100 ps, and then sequentially soaked in 5 mM ionomycin aqueous solution for 5 minutes and 2 mM 6-DMAP aqueous solution for 4 hours for activation. Then the reconstructed embryo was placed in PZM-3 medium and cultured in an incubator at 38.5°C, 5% CO2, 5% O2, 90% N2, and saturated humidity. Most of the reconstructed embryos can be used for subsequent embryo transfer after 6 h of culture after activation.

[0121] Tyrode lactate-pyruvate albumin medium: containing 5 mM sodium lactate, 0.5 mM sodium pyruvate, 0.5% fat-free BSA, 10 mM HEPES, 0.3% (g / 100 ml) polyvinylpyrrolidone, 0.1 pg / mL demecolcine, 10 pg / mL cytochalasin B, and the rest of Tyrode's solution.

[0122] Fusion medium: containing 0.25 M D-sorbitol, 0.05 mM Mg(C2H3O2)2, 20 mg / mL BSA, and 0.5 mM HEPES [acid-free], and the rest of water.

[0123] Activation medium: containing 0.25 M D-sorbitol, 0.01 mM Ca(C2H3O2)2, 0.05 mM Mg(C2H3O2)2, and 0.1 mg / mL BSA, and the rest of water.

[0124] PZM-3 medium (50 mL): contains 0.108 mM NaCl, 0.01 mM KCl, 0.35 mM KH2PO4, 0.40 mM MgSO4, 25.07 mM NaHCO3, 0.20 mM Na-pyruvate, 2.00 mM Ca-(lactate)2, 1.00 mM L-glutamine*, 5.00 mM hypotaurine*, 1 mL BME essential amino acid (50x)*, 0.5 mL MEM non-essential amino acid (100x)*, and the rest is ultrapure water; the marked ingredients are added before use.

[0125] 2. Embryo transfer

[0126] Eight 9-month-old sows in estrus were selected as surrogate sows, and 300-350 reconstructed embryos cultured for 6 h after activation were transplanted into the oviducts of the surrogate sows. About 25 days after embryo transfer, the pregnancy was examined using an ultrasonic scanner (HS-101V, Honda Electronics, Japan), and it was confirmed whether the recipient sows were pregnant. Among the eight surrogate sows, five were pregnant. The cloned pigs were born about 115 days after embryo transfer. A total of nine cloned pigs were produced from the five successfully pregnant surrogate sows, numbered K22, K23, K26, K27, K29, K30, K31, K35, and K36, which were the candidate HLA-B*15:02 cloned pigs.

[0127] III. Preparation of HLA-B cloned pigs

[0128] HLA-B cloned pigs, i.e., cloned pigs in which the HLA-B gene is integrated into the COL1A1 safe harbor site in the genomic DNA.

[0129] The nuclear donor cell was 2# recombinant cell obtained in Example 1.

[0130] The other steps were the same as in Step 2.

[0131] A total of ten cloned pigs were produced from the five successfully pregnant surrogate sows, numbered K43, K44, K45, K46, K92, K93, K110, K111, K112, and K113, which were the candidate HLA-B cloned pigs.

[0132] Example 3, genomic level identification and expression analysis of humanized genes in cloned pigs

[0133] I. Genomic level identification of humanized HLA-B*15:02 gene / humanized HLA-B gene in cloned pigs

[0134] 1. Genomic level detection of HLA-B*15:02 cloned pigs

[0135] The test animals were the cloned pigs numbered K22, K23, K26, K27, K29, K30, K31, K35, and K36 obtained in Example 2.

[0136] 0.5 g of ear tissue of the test animals was cut using tissue forceps, genomic DNA was extracted, and PCR amplification was performed using specific primer pairs (the primer pairs were: a primer pair consisting of HLAB-Lr-JDF98 and HLAB-Lr-JDR2563, a primer pair consisting of HLAB-Rr-JDF2222 and HLAB-Rr-JDR3614, and a primer pair consisting of HLAB-wt-JDF1503 and HLAB-wt-JDR1983), followed by electrophoresis. Pig primary fibroblasts were used as a wild type control (WT).

[0137] The primer pair consisting of HLAB-Lr-JDF98 and HLAB-Lr-JDR2563 was used to identify whether the 5' end (left arm) of the pig COL1A1 safe harbor insertion site HLA-B*15:02 expression frame was successfully recombined (the target fragment size was 2466 bp, and the presence of an amplification product of about 2466 bp indicated successful recombination); the primer pair consisting of HLAB-Rr-JDF2222 and HLAB-Rr-JDR3614 was used to identify whether the 3' end (right arm) of the pig COL1A1 safe harbor insertion site HLA-B*15:02 expression frame was successfully recombined (the target fragment size was 1393 bp, and the presence of an amplification product of about 1393 bp indicated successful recombination); and the primer pair consisting of HLAB-wt-JDF1503 and HLAB-wt-JDR1983 was used to identify whether the pig COL1A1 safe harbor site HLA-B*15:02 expression frame was homozygous or heterozygous (the genomic DNA of the wild type control could be amplified to a fragment of 454 bp, and the recombined cells could not be amplified due to the large size of the exogenous insertion fragment; thus, if no amplification product was present, the cell was homozygous for the insertion of the HLA-B*15:02 expression frame; and if a 454 bp amplification product was present, the cell was heterozygous for the insertion of the HLA-B*15:02 expression frame or was wild type and did not have the HLA-B*15:02 expression frame inserted).

[0138] The electropherogram is shown in FIG. 1. K22 and K23 were homozygous for the insertion of the HLA-B*15:02 expression frame, and K26, K29, K30, K31, K35, and K36 were heterozygous for the insertion of the HLA-B*15:02 expression frame. Figure 2

[0139] 2. Genomic level detection of HLA-B cloned pigs ​

[0140] The test animals were the cloned pigs numbered K43, K44, K45, K46, K92, K93, K110, K111, K112, and K113 obtained in Example 2.

[0141] The ear tissue of 0.5 g of the test animals was cut using tissue forceps, genomic DNA was extracted, and PCR amplification was performed using specific primer pairs (the primer pairs were: a primer pair consisting of HLAB-Lr-JDF98 and HLAB-Lr-JDR2563, a primer pair consisting of HLAB-Rr-JDF4244 and HLAB-Rr-JDR7210, and a primer pair consisting of HLAB-wt-JDF1503 and HLAB-wt-JDR1983), followed by electrophoresis. Pig primary fibroblasts were used as a wild type control (WT).

[0142] The primer pair consisting of HLAB-Lr-JDF98 and HLAB-Lr-JDR2563 was used to identify whether the 5' end (left arm) HLA-B expression cassette of the pig COL1A1 safe harbor insertion site was successfully recombined (the target fragment size was 2466 bp, and the presence of an amplification product of about 2466 bp indicated successful recombination); the primer pair consisting of HLAB-Rr-JDF4244 and HLAB-Rr-JDR7210 was used to identify whether the 3' end (right arm) HLA-B expression cassette of the pig COL1A1 safe harbor insertion site was successfully recombined (the target fragment size was 2967 bp, and the presence of an amplification product of about 2967 bp indicated successful recombination); and the primer pair consisting of HLAB-wt-JDF1503 and HLAB-wt-JDR1983 was used to identify whether the HLA-B expression cassette inserted at the pig COL1A1 safe harbor site was homozygous or heterozygous (the genomic DNA of the wild type control could be amplified to a fragment of 454 bp, and the recombined cells could not be amplified due to the large size of the exogenous insertion fragment; thus, if no amplification product was present, the cells were homozygous for the insertion of the HLA-B expression cassette; and if a 454 bp amplification product was present, the cells were heterozygous for the insertion of the HLA-B expression cassette or were wild type).

[0143] The electrophoretogram is shown in FIG. 2. K92, K112, and K113 were homozygous for the insertion of the HLA-B expression cassette, and K44, K93, and K110 were heterozygous for the insertion of the HLA-B expression cassette. Figure 3

[0144] HLAB-Lr-JDF98: CCCAAGGTCTCAGGGCCTAAA;

[0145] HLAB-Lr-JDR2563: ATCTTGGTTCATTCTCAAGCCTC.

[0146] ​HLAB-Rr-JDF2222: GGACGTGAGCGTTGTGAAAGA;

[0147] HLAB-Rr-JDR3614: CACACGGTGGAACCACAATC.

[0148] HLAB-wt-JDF1503: CCTCCCTGGGGTCCATAGAA;

[0149] HLAB-wt-JDR1983: GAAGGTGAGGAGCGTGTTGA.

[0150] HLAB-Rr-JDF4244: TCTGAGGCGGAAAGAACCAG;

[0151] HLAB-Rr-JDR7210: CACGAGCACCCACGTACC.

[0152] II. Expression analysis of humanized HLA-B*15:02 gene / humanized HLA-B gene in cloned pigs

[0153] The test animals were HLA-B*15:02 cloned pigs (cloned pigs numbered K22, K29, K30, K31, K35, K36 obtained in Example 2) or HLA-B cloned pigs (cloned pigs numbered K93, K112, K113 obtained in Example 2) or Bama miniature pigs (wild type, not genetically engineered, denoted as WT, as a control).

[0154] 1. Transcription level detection

[0155] About one week after birth, 0.5 g of ear tissue of the test animals was cut using tissue forceps, total RNA was extracted, and cDNA was obtained by reverse transcription. The cDNA was used as a template to detect the relative expression level of the humanized gene (i.e. HLA-B*15:02 gene or HLA-B gene) by fluorescent quantitative PCR (calculated according to 2 -ΔΔCt

[0156] The primers for detecting the humanized gene were as follows:

[0157] hHLAB-qF: ATGGCGAGGACCAAACTCAG;

[0158] hHLAB-qR: CACAACTGCTAGGACAGCCA.

[0159] The primers for detecting the β-actin gene were as follows:

[0160] ​β-actin-F: CACGCCATCCTGCGTCTGGA;

[0161] β-actin-R: AGCACCGTGTTGGCGTAGAG.

[0162] Data were analyzed by GraphPad Prism statistical software, expressed as (mean ± standard deviation), and analyzed by independent sample t test. The results are shown in Figure 4 and Figure 5 . -ΔΔCt The results showed that the expression of HLA-B*15:02 gene in 6 HLA-B*15:02 cloned pigs was significantly higher than that of the control, and the homozygous cloned pigs had higher expression than the heterozygous cloned pigs. The above results showed that the HLA-B*15:02 gene had a high degree of expression in HLA-B*15:02 cloned pigs. -ΔΔCt The results showed that the expression of HLA-B gene in 3 HLA-B cloned pigs was significantly higher than that of the control, and the homozygous cloned pigs had higher expression than the heterozygous cloned pigs. The above results showed that the HLA-B gene had a high expression level in HLA-B cloned pigs.

[0163] 2. Protein level detection

[0164] About a week after birth, 0.5g of ear tissue of the test animals was cut off using tissue forceps, total protein was extracted, and then Western blotting was performed. The primary antibody was anti-HLA-B monoclonal antibody (Huabio, dilution ratio 1:1000), and the secondary antibody was HRP-labeled Mouse secondary antibody (Sigma, dilution ratio 1:10000). β-Tubulin was used as an internal reference, and the relative abundance of humanized protein (i.e. HLA-B*15:02 or HLA-B) was analyzed by ImageJ software.

[0165] The results are shown in Figure 6 and Figure 7 . Figure 6 and Figure 7Figure 6 shows the results of Western blotting. The upper panel is a Western blotting diagram, and the lower panel is a graph of the relative abundance of humanized protein. All 6 HLA-B*15:02 cloned pigs expressed human HLA-B*15:02, and the homozygous cloned pig numbered K22 had the highest gray value of the HLA-B*15:02 band (the protein expression level after quantification was about 6), and no corresponding protein band was observed in the control pigs (the gray value was 0, i.e., the protein expression level was 0), indicating that the inserted HLA-B*15:02 gene was successfully expressed in the cloned pigs. All 3 HLA-B cloned pigs expressed human HLA-B protein, and no corresponding protein band was observed in the control pigs (the gray value was 0, i.e., the protein expression level was 0), indicating that the inserted HLA-B gene was successfully expressed in the HLA-B cloned pigs.

[0166] Example 4: Cloned pigs as model pigs can simulate immune-mediated adverse drug reactions

[0167] Carbamazepine-induced SJS / TEN is closely related to HLA-B*15:02, and has been written into various clinical guidelines, with an OR value as high as 1357. In this example, the inventors used carbamazepine as an example to verify the effect of HLA-B*15:02 cloned pigs as SJS / TEN models. The immune system of pigs begins to develop after birth, and matures and functions around 42 days after weaning.

[0168] I. Drug administration

[0169] Information of HLA-B*15:02 cloned pig (cloned pig numbered K22 obtained in Example 2): born on 2023-09-01, female. Drug administration started on 2023-12-19; drug administration process: 2023-12-19 to 2024-1-5, once a day, 400 mg each time; 2024-1-6 to 2024-3-19, twice a day, 400 mg each time; 2024-3-20 to 2024-4-24, twice a day, 600 mg each time.

[0170] Information of HLA-B*15:02 cloned pig (cloned pig numbered K29 obtained in Example 2): born on 2023-09-19, female. Drug administration started on 2023-12-19; drug administration process: 2023-12-19 to 2023-12-23, once a day, 200 mg each time.

[0171] Information of HLA-B*15:02 clone pig (clone pig numbered K31 obtained in Example 2): born on 2023-09-19, female. Start of administration on 2023-12-19; administration process: 400 mg per administration once a day from 2023-12-19 to 2024-1-5; 400 mg per administration twice a day from 2024-1-6 to 2024-2-25; 2024-2-26 to 2024-3-3, 7 days of drug withdrawal; 400 mg per administration twice a day from 2024-3-4 to 2024-3-26; 600 mg per administration twice a day from 2024-3-27 to 2024-4-24.

[0172] Information of HLA-B clone pig (clone pig numbered K93 obtained in Example 2): born on 2024-10-01, female. Start of administration on 2025-01-05; administration process: 400 mg per administration once a day from 2025-01-05 to 2025-01-18; 400 mg per administration twice a day from 2025-1-19 to 2025-03-29; 600 mg per administration twice a day from 2025-03-30 to 2025-04-20.

[0173] Information of HLA-B clone pig (clone pig numbered K112 obtained in Example 2): born on 2024-10-12, female. Start of administration on 2025-01-05; administration process: 400 mg per administration once a day from 2025-01-05 to 2025-01-11; 400 mg per administration twice a day from 2025-1-12 to 2025-04-05; 600 mg per administration twice a day from 2025-04-06 to 2025-04-20.

[0174] Information of HLA-B clone pig (clone pig numbered K113 obtained in Example 2): born on 2024-10-12, female. Start of administration on 2025-01-05; administration process: 400 mg per administration once a day from 2025-01-05 to 2025-01-9.

[0175] Administration refers to administration of carbamazepine. When administered once, it is administered with feed at 8:30 in the morning. When administered twice, it is administered with feed at 8:30 in the morning and at 16:30 in the afternoon, respectively.

[0176] II. Phenotype after administration of carbamazepine

[0177] 1. Growth and changes in body weight, body length and body temperature before and after administration

[0178] The changes of body weight, body length and body temperature of HLA-B*15:02 cloned pigs and HLA-B cloned pigs during growth and subsequent administration were recorded continuously, and the results are shown in Figures 8-13 The results show that the body weight, body length and body temperature of HLA-B*15:02 cloned pigs and HLA-B cloned pigs remain stable after birth for 6 months, and there is no obvious growth, which is consistent with the growth rule of wild type Bama mini-pigs. And the administration of carbamazepine has no obvious effect on the body weight, body length and body temperature of cloned pigs. It shows that the cloned pigs can survive and grow normally, and the changes of basic parameters are not different from wild type Bama mini-pigs, and the basic physiological characteristics are not changed.

[0179] 2, Appearance changes after administration of carbamazepine

[0180] The HLA-B*15:02 cloned pig numbered K29 developed skin and mucosa inflammation and immune response after 5 days of administration, and the specific symptoms were: obvious cracking of the nose; mouth inflammation and swelling; periorbital swelling and lower eyelid ulceration; hind limb redness and swelling; hind foot cracking with red patches; facial skin inflammation and redness; all parameters were checked on December 24, 2023, and the pig was sacrificed. The HLA-B*15:02 cloned pig numbered K31 developed periorbital skin ulceration after 69 days of continuous administration, and recovered spontaneously after one week of drug withdrawal (from February 26, 2024 to March 3, 2024). The HLA-B*15:02 cloned pig numbered K22 did not develop any abnormal phenotype during the entire administration process. The results show that the HLA-B*15:02 cloned pigs developed similar phenotypes to human SJS / TEN after administration of carbamazepine.

[0181] The HLA-B cloned pig numbered K93, the HLA-B cloned pig numbered K112 and the HLA-B cloned pig numbered K113 all did not develop any abnormal phenotype during the entire administration process.

[0182] The organ phenotype photos of HLA-B*15:02 cloned pig (numbered K29) and HLA-B cloned pig (numbered K113) at time point 1 (before the first administration) and time point 2 (5 days after the first administration) are shown in Figure 14 . Figure 14 In the table, CBZ(-) represents time point 1, and CBZ(+) represents time point 2.

[0183] 3, Changes of physiological and biochemical indexes after administration of carbamazepine

[0184] At time point 1 (before the first administration) and time point 2 (5 days after the first administration), the peripheral blood of HLA-B*15:02 cloned pig (numbered K29) and HLA-B cloned pig (numbered K113) was collected, and blood routine and blood biochemical indexes were detected by blood biochemical instrument. The results are shown inFigure 15 (before represents before administration, after represents after administration) and Figure 16 (before represents before administration, after represents after administration).

[0185] Figure 15 The leukocyte (WBC) content, neutrophil (NEUT) content, lymphocyte (LYM) content, monocyte (MON) content, eosinophil (EOS) content, and basophil (BAS) content of the HLA-B*15:02 cloned pig and the HLA-B cloned pig were significantly changed before and after administration.

[0186] Figure 16 The results show that, compared with before administration, the albumin (ALB) content, cholinesterase (CHS) content, and glucose (GLU) content in the blood of the HLA-B*15:02 cloned pig decrease after administration, and the aspartate aminotransferase (AST) content increases, which indicates that the liver synthesis ability decreases, the liver cells are damaged, and the heart is also damaged. Figure 16 The results show that, compared with before administration, the globulin (GLO) content in the blood of the HLA-B*15:02 cloned pig increases after administration, which indicates that the immune response in the body is enhanced. Compared with before administration, the above indicators of the HLA-B cloned pig change little after administration.

[0187] III. Expression analysis of humanized genes in various tissues of cloned pigs

[0188] At time point 2 (5 days after the first administration), the HLA-B*15:02 cloned pig (numbered K29) and the HLA-B cloned pig (numbered K113) were dissected, and the heart, liver, spleen, lung, lymph node, muscle, skin, kidney, adrenal gland, pancreas, thymus, small intestine, cecum, and large intestine were taken out, respectively, to extract total RNA and total protein. Control pigs (indicated by BC6 or NC) were set, i.e., 3-month-old wild-type Bama sows.

[0189] Total RNA was taken, and cDNA was obtained by reverse transcription. The cDNA was used as a template to detect the relative expression level of the humanized HLA-B gene (i.e., the HLA-B*15:02 gene or the HLA-B gene) by fluorescence quantitative PCR (2 -ΔΔC t method). The data were analyzed by GraphPad Prism statistical software, and the results were expressed as (mean ± standard deviation), and independent sample t test was used for statistical analysis.

[0190] The primers for detecting the humanized HLA-B gene are as follows:

[0191] hHLAB-qF: ATGGCGAGGACCAAACTCAG;

[0192] hHLAB-qR: CACAACTGCTAGGACAGCCA.

[0193] The primers for detecting the GAPDH gene are as follows:

[0194] GAPDH-qF: GGTCGGAGTGAACGGATTTG;

[0195] GAPDH-qR: CCATTTGATGTTGGCGGGAT.

[0196] Total protein was taken for immunoblotting. β-Tubulin and GAPDH were used as internal references, and GST protein was added as an external reference for correcting sample loading errors. The relative expression amount of HLA-B protein was analyzed by ImageJ software.

[0197] The results of the HLA-B*15:02 cloned pig are shown in Figure 17 .2 -ΔΔCt The results show that HLA-B*15:02 is stably expressed in multiple tissue organs of the HLA-B*15:02 cloned pig.

[0198] The results of the HLA-B cloned pig are shown in Figure 18 .2 -ΔΔCt The results show that HLA-B is stably expressed in multiple tissue organs of the HLA-B cloned pig.

[0199] Four, organ damage after administration of carbamazepine

[0200] At time point 2 (5 days after the first administration), the HLA-B*15:02 cloned pig (numbered K29) and the HLA-B cloned pig (numbered K113) were dissected, respectively, and each tissue organ was taken to make paraffin sections (4 μm thick), and then hematoxylin-eosin staining was performed. Under a light microscope, the cell nucleus was blue, and the cytoplasm and collagen fibers were pink.

[0201] The results are shown in Figure 19The skin tissue of the HLA-B*15:02 cloned pig (numbered K29) appeared regional necrosis, accompanied by inflammatory cell infiltration, and subcutaneous adipocyte necrosis, hemorrhage, and a small amount of lymphocyte infiltration; in the lung tissue, the alveolar cavity was abnormally large, the alveolar wall was obviously thickened, there were multiple inflammatory cell infiltration foci, and accompanied by hemorrhage; the liver tissue appeared small mononuclear cell infiltration foci, hepatocytes were slightly swollen, and liver sinusoids were narrowed; the lymph node appeared cortex, medulla enlargement, germinal center reactive hyperplasia, and hemorrhage; in the kidney tissue, the glomerulus appeared congestion, atrophy, and accompanied by plasma protein exudation; in the small intestine tissue, the small intestinal villi appeared necrosis, hemorrhage, and accompanied by inflammatory cell infiltration; the bone marrow cells were obviously reduced. This shows that the HLA-B*15:02 cloned pig fed with carbamazepine has multiple organ damage. The HLA-B cloned pig (numbered K113) has no abnormality in each tissue.

[0202] V. Inflammatory factor content after feeding carbamazepine

[0203] At time point 2 (5 days after the first administration), the HLA-B*15:02 cloned pig (numbered K29) and the HLA-B cloned pig (numbered K113) were respectively dissected, and each tissue organ was taken to detect the contents of granulysin, IFN-gamma, granzyme B, perforin and FasL. A control pig (denoted as WT) was set: a 3-month-old wild-type Bama miniature sow, continuously administered for 5 days, administered carbamazepine once a day (morning 8:30 with feed), each time administered 400 mg, and then dissected.

[0204] Pig granulysin (GNLY) ELISA detection kit: Jianglai Biological, item number JL54068. Pig IFN-gamma (IFN-gamma) ELISA detection kit: Jianglai Biological, item number JL11792. Pig granzyme B (Gzms-B) ELISA detection kit: Jianglai Biological, item number JL29036. Pig perforin 1 (PF1) ELISA detection kit: Jianglai Biological, item number JL23591. Pig FasL (FASL) ELISA kit: Jianglai Biological, item number JL18043.

[0205] The results are shown in Figure 20. Higher levels of interferon-gamma were detected in the heart, skin, muscle, and thymus of HLA-B*15:02 cloned pigs. Higher levels of granulysin were detected in the heart, liver, kidney, adrenal gland, skin, and thymus of HLA-B*15:02 cloned pigs. Higher levels of granzyme B were detected in the heart, liver, spleen, lung, adrenal gland, skin, and thymus of HLA-B*15:02 cloned pigs. Higher levels of perforin were detected in the heart, liver, kidney, and thymus of HLA-B*15:02 cloned pigs. Higher levels of apoptosis-associated factor ligand were observed in the heart, liver, kidney, adrenal gland, skin, and thymus of HLA-B*15:02 cloned pigs. The above results suggest that the content of inflammatory factors increases after HLA-B*15:02 cloned pigs are fed with carbamazepine.

[0206] Six, expression of immune-related genes after feeding carbamazepine (RNA-seq)

[0207] Peripheral blood of HLA-B*15:02 cloned pigs (numbered K29) and HLA-B cloned pigs (numbered K113) was collected at time point 1 (before the first administration) and time point 2 (5 days after the first administration). Peripheral blood was taken, blood cells were collected, and total RNA was extracted. The total RNA was taken, rRNA was removed, and then a library was constructed. After the library passed quality control, sequencing was performed (using the Illumina NovaSeq platform, PE150 mode, data volume ≥10 Gb / sample). After the data was downloaded, low-quality sequences were filtered using FastQC quality control, HISAT2 / Bowtie2 was used to align the pig reference genome (Sscrofa11.1), StringTie was used for transcript quantification, and finally DESeq2 was used to screen differential expression genes (|log2FC|≥1, FDR<0.05).

[0208] The results are shown in Figure 21 . The original data quality control results showed that the reliability of each sequencing base of each sample was high, Q20>90% and Q30>80%, there was no obvious AT, GC separation phenomenon in the sequencing data, the distribution of Clean reads on the reference gene was in line with the actual situation, and the coverage of Clean reads on the transcript was not obviously biased, with good repeatability, indicating that the sequencing results of RNA-seq passed quality control and met the expectations. The differential analysis results showed that compared with before administration, a large number of immune-related genes were up-regulated in HLA-B*15:02 cloned pigs after administration (such as CD207, GZMB, ISG12A, IL2, CXCL10, etc.); compared with before administration, the related genes in HLA-B cloned pigs did not appear to be up-regulated.

[0209] Seven, single-cell sequencing analysis of changes in immune cell quantity and type before and after feeding carbamazepine

[0210] Peripheral blood of HLA-B*15:02 cloned pig (No. K29) and HLA-B cloned pig (No. K113) were collected at time point 1 (before the first administration) and time point 2 (5 days after the first administration). Peripheral blood samples were collected, PBMC cells were extracted, a library was constructed using SeekOne DD single cell library construction kit (Cat. No. SD-LibV2), and a barcoded cDNA library was generated. The cDNA library was subjected to PCR amplification (program: 98℃ for 30 seconds; 15 cycles: 98℃ for 10 seconds, 65℃ for 30 seconds, 72℃ for 1 minute; 72℃ for 5 minutes) using SeekOne DD premixed amplification reagent (containing high-fidelity DNA polymerase), and then the amplification product was purified using AMPure XP magnetic beads. After quality inspection, Illumina NovaSeq 6000 platform was used for double-end sequencing (PE150), and the data output was ≥50,000 reads / cell. SeekOne DD matching analysis software (SeekAnalysis v2.3) was used for raw data quality control, low-quality sequences (Q30>90%) were filtered; PCR repeats and sequencing errors were corrected based on CB / UMI, a single cell gene expression matrix was generated; PBMC subgroups were identified by UMAP clustering analysis, and pig-specific surface marker genes were labeled.

[0211] Results are shown in Figure 22 and Figure 23 . All single cell raw data met the quality control standards. Cell filtration index threshold was set: (1) single cell gene number was 200; (2) UMI was greater than 500; (3) mitochondrial proportion was less than 5%, and cells that did not meet the requirements were screened out. Marker genes of various cells were determined from published pig single cell sequencing literature, and cell clusters were clustered and manually annotated. The cell clustering results showed that, compared with before administration, the number of cytotoxic CD8 + T lymphocytes in HLA-B*15:02 cloned pigs decreased significantly after administration, the number of DNT cells increased, and it was also observed that a part of B cells differentiated into plasma cells, and it was speculated that the significant decrease of CD8 + T lymphocytes may be related to their migration to target organs; compared with before administration, the cell types of HLA-B cloned pigs did not change much.

[0212] In summary, all results show that HLA-B*15:02 cloned pigs fed with carbamazepine exhibit similar adverse reaction phenotypes to human patients, and can be used as a large animal model for studying immune-mediated adverse reactions of drugs. Further, the HLA-B*15:02 cloned pigs prepared by the present application can be used for further research in the field of biological medicine, such as drug screening, safety evaluation and mechanism of adverse reaction development.

[0213] The application has been described in detail. Those skilled in the art will understand that they can make modifications and alterations to this application without departing from the spirit and scope of the application. Although this application presents specific examples, it is to be understood that further modifications can be made. In general, the principles of the application are intended to be included in any alteration, modification or improvement to the application, including changes made outside the scope of the disclosure herein using conventional techniques known in the art. Some of the essential features can be applied within the scope of the following claims.

Claims

1. Use of a recombinant pig for (al) or (a2): (al) screening of drugs causing immune-mediated adverse reactions; (a2) use of the recombinant pig as a pig model; wherein the recombinant pig is a pig into whose genome DNA a human HLA-B*15:02 gene or a DNA molecule having a human HLA-B*15:02 gene has been inserted; and wherein the pig model is used for screening of drugs causing immune-mediated adverse reactions.

2. Use of a recombinant pig for preparing a pig model; wherein the recombinant pig is a pig into whose genome DNA a human HLA-B*15:02 gene or a DNA molecule having a human HLA-B*15:02 gene has been inserted; and wherein the pig model is used for (bl) or (b2) or (b3) or (b4): (bl) mechanism study of immune-mediated adverse drug reactions; (b2) assisting establishment of diagnostic criteria for immune-mediated adverse drug reactions; (b3) screening of markers for immune-mediated adverse drug reactions; (b4) development of drugs for indications of immune-mediated adverse drug reactions.

3. A method for preparing a recombinant pig, comprising the following steps: (1) preparing a recombinant cell; wherein the recombinant cell is a cell into whose genome DNA a human HLA-B*15:02 gene or a DNA molecule having a human HLA-B*15:02 gene has been inserted; and (2) preparing a cloned pig, i.e. a recombinant pig, from the recombinant cell by somatic cell nuclear transfer.

4. A method for preparing a pig model, comprising the following steps: causing an immune-mediated adverse reaction in a recombinant pig by administering a drug to the pig, i.e. the pig model; wherein the recombinant pig is a pig into whose genome DNA a human HLA-B*15:02 gene or a DNA molecule having a human HLA-B*15:02 gene has been inserted.

5. Use of the pig model prepared by the method of claim 4 for (bl) or (b2) or (b3) or (b4): (bl) mechanism study of immune-mediated adverse drug reactions; (b2) assisting establishment of diagnostic criteria for immune-mediated adverse drug reactions; (b3) screening of markers for immune-mediated adverse drug reactions; (b4) development of drugs for indications of immune-mediated adverse drug reactions.

6. Use of a recombinant cell or a substance for preparing a recombinant cell for preparing a recombinant pig; wherein the recombinant cell is a cell into whose genome DNA a human HLA-B*15:02 gene or a DNA molecule having a human HLA-B*15:02 gene has been inserted; and wherein the substance for preparing a recombinant cell is a human HLA-B*15:02 gene related biological material; and wherein the human HLA-B*15:02 gene related biological material is any one of (cl) to (c6): (cl) a human HLA-B*15:02 gene; (c2) a DNA molecule having a human HLA-B*15:02 gene; (c3) an expression cassette expressing a human HLA-B*15:02 gene; (c4) a vector containing a human HLA-B*15:02 gene; (c5) a cell expressing a human HLA-B*15:02 gene; and (c6) a cell containing a DNA molecule having a human HLA-B*15:02 gene. ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ (c4) a DNA molecule having the expression cassette of (c3); (c5) a recombinant vector having a human HLA-B*15:02 gene; (c6) a recombinant vector having the expression cassette of (c3); The recombinant pig is a recombinant pig obtained by inserting a human HLA-B*15:02 gene or a DNA molecule having a human HLA-B*15:02 gene into the genomic DNA of a pig.

7. Use of a recombinant cell or a substance for preparing a recombinant cell in the preparation of a pig model; The recombinant cell is as described in claim 6; The substance for preparing a recombinant cell is as described in claim 6; The use of the pig model is as follows (b1) or (b2) or (b3) or (b4): (b1) for mechanism research of immune-mediated adverse drug reactions; (b2) for assisting in establishing diagnostic criteria for immune-mediated adverse drug reactions; (b3) for screening markers of immune-mediated adverse drug reactions; (b4) for developing drugs for indications of immune-mediated adverse drug reactions.

8. Use of a substance for preparing a recombinant cell in the preparation of a recombinant pig or a pig model; The substance for preparing a recombinant cell is a human HLA-B*15:02 gene related biological material, a plasmid expressing sgRNA, and a plasmid expressing Cas9 protein; the human HLA-B*15:02 gene related biological material is as described in claim 6; The recombinant pig is a recombinant pig obtained by inserting a human HLA-B*15:02 gene or a DNA molecule having a human HLA-B*15:02 gene into the genomic DNA of a pig; The use of the pig model is as follows (b1) or (b2) or (b3) or (b4): (b1) for mechanism research of immune-mediated adverse drug reactions; (b2) for assisting in establishing diagnostic criteria for immune-mediated adverse drug reactions; (b3) for screening markers of immune-mediated adverse drug reactions; (b4) for developing drugs for indications of immune-mediated adverse drug reactions.

9. Use of a substance for preparing a recombinant cell in the preparation of a recombinant pig or a pig model; The substance for preparing a recombinant cell is a pig cell, a human HLA-B*15:02 gene related biological material, a plasmid expressing sgRNA, and a plasmid expressing Cas9 protein; the human HLA-B*15:02 gene related biological material is as described in claim 6; The recombinant pig is a recombinant pig obtained by inserting a human HLA-B*15:02 gene or a DNA molecule having a human HLA-B*15:02 gene into the genomic DNA of a pig; The use of the pig model is as follows (b1) or (b2) or (b3) or (b4): (b1) for mechanism research of immune-mediated adverse drug reactions; (b2) for assisting in establishing diagnostic criteria for immune-mediated adverse drug reactions; (b3) for screening markers of immune-mediated adverse drug reactions; (b4) for developing drugs for indications of immune-mediated adverse drug reactions.

10. The method or use of any one of claims 1 to 9, wherein: The immune-mediated adverse drug reactions are any of the following: Stevens-Johnson syndrome / toxic epidermal necrolysis, drug hypersensitivity syndrome, urticaria, acute generalized pustulosis, or drug-induced liver injury. The immune-mediated adverse drug reactions are any of the following: Stevens-Johnson syndrome / toxic epidermal necrolysis, drug hypersensitivity syndrome, urticaria, acute generalized pustulosis, or drug-induced liver injury.

Images