Locusta migratoria BTB transcription factor LOCMI00260 and application thereof

By using the locust BTB transcription factor LOCMI00260 and dsRNA interference technology, the problems of environmental pollution and drug resistance in the control of locusts by traditional chemical agents were solved, and the effects of improving diapause rate and reducing locust plague risk were achieved.

CN121249680APending Publication Date: 2026-01-02HEBEI UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511513670.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-22
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Traditional chemical agents have problems in controlling locusts, such as environmental pollution, rapid development of pesticide resistance in pests, and inability to intervene in the diapause stage of eggs, resulting in poor locust control effects.

Method used

By using the locust BTB transcription factor LOCMI00260 and its encoded dsRNA, RNAi technology was used to reduce the expression level of the locust BTB transcription factor LOCMI00260 in locusts, interfere with its diapause regulation, and increase the diapause rate of locust embryos.

Benefits of technology

It significantly improves the diapause rate of locusts, reduces the number of nymphs, delays hatching time, extends generation interval, reduces the risk of disaster, and reduces environmental pollution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses a method for regulating and controlling migratory locust embryo diapause by a BTB transcription factor LOCMI00260 and application of the method. According to the present invention, the full length of the BTB transcription factor LOCMI00260 is cloned from migratory locust, the specific double-stranded RNA interference sequence fragment dsRNA of the BTB transcription factor LOCMI00260 is developed, and the dsRNA of the BTB transcription factor LOCMI00260 is introduced into the migratory locust egg by using the microinjection method; the result shows that the migratory locust BTB transcription factor LOCMI00260 can improve the diapause rate of migratory locust. The invention provides a new means and thought for migratory locust prevention and treatment.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a Locusta migratoria BTB transcription factor LOCMI00260 and application thereof. BACKGROUND

[0002] Locusta migratoria Locustamigratoria is the most widely distributed and harmful locust in China, which can gather into a swarm and cause disaster. The important prerequisite for locust disaster outbreak is that a large number of eggs are hatched at the same time, nymphs molt at the same time, and adults mate and lay eggs at the same time, forming “concentrated population pressure”. A single locust disaster outbreak can affect millions of hectares of farmland and pasture, causing huge economic losses. Traditional locust disaster control mainly relies on chemical pesticides, which has the advantages of quick effect, but also has many disadvantages such as environmental pollution, rapid development of pest resistance, and killing of natural enemies. Moreover, traditional chemical agents can only kill nymphs or adults, and cannot interfere with the egg diapause process. Therefore, it is urgent to develop environmentally friendly, target-specific and sustainable green control technology.

[0003] Diapause refers to the physiological phenomenon that insects actively suspend embryonic development when environmental conditions are not suitable for growth and development. The initiation, maintenance and release of Locusta migratoria diapause directly determine the development synchrony, density accumulation and disaster risk of Locusta migratoria population, and it is closely related to the outbreak rhythm of locust disaster. When the environmental conditions are suitable, Locusta migratoria is in a non-diapause state, and the population density reaches a threshold value, which will form a locust disaster. Therefore, regulating the embryonic diapause of Locusta migratoria has become a potential new way to fundamentally control its population size and curb the outbreak of locust disaster.

[0004] BTB domain (broad-complex, tramtrack, bric-à-brac, also known as POZ domain) is a highly conserved protein-protein interaction module, which was first identified in the N-terminal of Drosophila transcription factors (bric-à-brac, tramtrack and broad complex), and was named BTB domain due to its initials. Almost at the same time, Bardwell and Treisman independently found that this sequence also exists in poxvirus proteins and multiple zinc finger proteins (such as ZID, GAGA and ZF5), and named it POZ domain. Subsequent studies have shown that BTB and POZ are actually the same motif, so they are combined into BTB / POZ domain. BTB / POZ proteins can be involved in pattern formation of antennal proximal-distal axis, morphogenesis of adult ovary, eye development cell fate determination, control of sexual dimorphism characteristics, and establishment and homeostatic maintenance of germ stem cell niche cells. For example, studies have shown that LmBTBD6 protein regulated by LmEcR-LmHR39-mediated 20E signaling pathway is involved in wing development regulation during the transformation from 5th instar to adult. SUMMARY

[0005] The application aims to provide a locust BTB transcription factor LOCMI00260 and its application in improving the diapause rate of locusts, so as to provide a new means and idea for further understanding the regulation mechanism of locust embryonic diapause and for locust control.

[0006] The application adopts the following technical solutions: The application first provides a locust BTB transcription factor LOCMI00260, which is composed of 1290 nucleotides, and the nucleotide sequence is shown in SEQ ID NO: 1.

[0007] Further, the amino acid sequence of the protein encoded by the BTB transcription factor LOCMI00260 is shown in SEQ ID NO: 2, which comprises one BTB domain and three ANK domains.

[0008] The application also provides the application of the above-mentioned BTB transcription factor LOCMI00260 and the protein encoded thereby in any one of the following (1)-(4): (1) controlling locusts; (2) preparing a product for controlling locusts; (3) improving the diapause rate of locusts; (4) preparing a product for improving the diapause rate of locusts.

[0009] The application also provides a method for improving the diapause rate of locusts, which comprises the step of reducing the expression amount of the BTB transcription factor LOCMI00260 in locusts, so as to improve the diapause rate of locusts; the nucleotide sequence of the BTB transcription factor LOCMI00260 is shown in SEQ ID NO: 1.

[0010] Further, the method for reducing the expression amount of the BTB transcription factor LOCMI00260 in locusts is to introduce a substance for inhibiting the expression of the BTB transcription factor LOCMI00260 in locusts into the body of locusts.

[0011] Further, the introduction mode is injection.

[0012] The application also provides a dsRNA for inhibiting the expression of the BTB transcription factor LOCMI00260 in locusts, which is a double-stranded RNA composed of the nucleotide shown in SEQ ID NO: 3 and the nucleotide shown in SEQ ID NO: 4.

[0013] The above-mentioned method for improving the diapause rate of locusts or the dsRNA can be applied to control locusts or improve the diapause rate of locusts.

[0014] The application has the beneficial effects of: The application first clones the Locusta migratoria BTB transcription factor LOCMI00260 from Locusta migratoria, predicts the domain of the Locusta migratoria BTB transcription factor LOCMI00260, designs primers, and artificially synthesizes dsRNA for interfering with the Locusta migratoria BTB transcription factor LOCMI00260. The dsRNA is introduced into Locusta migratoria by injection, and RNAi is performed on the Locusta migratoria BTB transcription factor LOCMI00260. The results show that the Locusta migratoria BTB transcription factor LOCMI00260 has the function of improving the diapause rate of Locusta migratoria.

[0015] During the peak of Locusta migratoria oviposition, the application of human intervention to improve the diapause rate of Locusta migratoria embryos will cause a large number of eggs to enter diapause and fail to hatch on time, resulting in a sharp decrease in the number of nymphs and an insufficient population size of adult Locusta migratoria. Even if some eggs break diapause, the hatching time will be delayed, resulting in a lengthening of the “generation interval” and directly cutting off the foundation of “population exponential growth”. Moreover, although diapausing Locusta migratoria eggs have certain stress resistance, diapause is not “indefinite survival”, and after breaking diapause in advance or delaying, their adaptability to the environment will decrease significantly, thereby increasing the mortality rate. Ultimately, the population size of Locusta migratoria is reduced fundamentally, and the risk of Locusta migratoria disaster is reduced. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 Prediction of the domain of the Locusta migratoria BTB transcription factor LOCMI00260.

[0017] Figure 2 Expression amount of the Locusta migratoria BTB transcription factor LOCMI00260 in non-diapause eggs and diapause eggs of Locusta migratoria on the 6th to 13th day.

[0018] Figure 3 Detection of the diapause rate of Locusta migratoria eggs after interfering with the Locusta migratoria BTB transcription factor LOCMI00260. DETAILED DESCRIPTION

[0019] The following examples facilitate a better understanding of the application, but do not limit the application.

[0020] In the following examples, the experimental methods used are conventional methods unless otherwise specified. In the following examples, the materials, reagents, etc. used are commercially available unless otherwise specified. In the following examples, five biological replicates were set up, with 5 eggs per biological replicate, and the results were averaged.

[0021] The insect source used in the following examples was the Oriental migratory locust (Locusta migratoryensis) with diapause ability from Huanghua City, Cangzhou City, Hebei Province, which had been continuously reared in the laboratory for more than 5 generations. Before the 3rd instar, the locusts were reared under a photoperiod of 12 L:12 D and a temperature of 28°C. After the 3rd instar, they were reared under both diapause-inducing photoperiods (8 L:16 D) and non-diapause-inducing photoperiods (16 L:8 D) at a temperature of 28°C. They were fed fresh wheat seedlings. The eggs laid were incubated at a temperature of 25°C.

[0022] In the following embodiments, the equipment and materials are sourced as follows: PCR instrument purchased from BIO-RAD, model: T100; microplate centrifuge purchased from TIANGEN, model: OSE-MP25; real-time PCR instrument purchased from BIO-RAD, model: CFX 384 Touch; automated grinder purchased from Beijing Hede, catalog number: N9548R; low-temperature centrifuge purchased from Eppendorf, model: 5424R; optical coherence chromatography (OCT) purchased from Thorlabs, catalog number: TEL210C1; cDNA synthesis kit purchased from Promega, catalog number: M1705; Oligo(dT) 15 Primers purchased from Promega, catalog number: C110A; real-time PCR kit purchased from abm, catalog number: G891; RACE kit purchased from Takara, catalog number: 634858; quantitative sealing film purchased from BIO-RAD, catalog number: MSB1001; 1.8 1.5 mL external spiral cryopreservation tubes were purchased from Thermo (catalog number: 375418); 1.5 mL EP tubes were purchased from BGI Genomics (catalog number: BHY02S1CA-S); KOD high-fidelity enzyme was purchased from TOYOBO (catalog number: KMM-201); RNA isolation reagent was purchased from Aibosen (catalog number: RA0102); gel extraction kit was purchased from Jianshi Biosciences (catalog number: Td407-200); Taq DNA polymerase was purchased from Kangrun Biosciences (catalog number: A002-100). pEASY - The Blunt Zero Cloning Kit was purchased from TransGen, catalog number: CB501; the T7 in vitro transcription kit was purchased from Promega, catalog number: P1700; anhydrous ethanol, isopropanol, glycerol and other reagents were all domestically produced analytical alcohols.

[0023] Example 1: Acquisition and domain prediction of locust BTB transcription factor LOCMI00260 1. Extraction of total RNA from locusts RNA was extracted from locust tissue samples using RNA separation reagents. The specific steps are as follows: Add 1 mL of TRIzol extraction buffer to a 1.5 mL RNase-Free centrifuge tube. Add 5 locust eggs to each tube, along with 2 grinding beads. Grind the eggs in a pre-chilled automatic grinder until fully ground. After incubating at room temperature for 5-10 min, centrifuge at 12,000 g for 10-15 min at 4°C. Transfer the supernatant to a new 1.5 mL RNase-Free centrifuge tube, add 200-300 μL of chloroform, and shake vigorously for 30-60 s. Incubate at room temperature for 3-5 min. Centrifuge at 12,000 g for 15 min at 4°C, and transfer approximately 400 μL of the upper aqueous phase to a new 1.5 mL RNase-Free centrifuge tube. Add an equal volume of isopropanol (400 μL), mix by inversion, and incubate at -20°C overnight to precipitate. Centrifuge at 12,000 g for 10 min at 4°C and discard the supernatant. Suspend the RNA at the bottom of the tube in 1 mL of 75% ethanol (prepared with DEPC-treated water) and centrifuge at 8,000 g for 5 min at 4°C. Discard the supernatant and centrifuge at 8,000 g for 1 min at 4°C. Aspirate any remaining liquid with a pipette tip and allow the tube to air dry. Add 20–50 μL of DEPC-treated water and allow to dissolve completely at room temperature. Then, aspirate 1 μL of the solution to determine the RNA concentration and total RNA integrity.

[0024] 2. Reverse transcription (1) Total RNA was reverse transcribed into cDNA using the M-MLV Reverse Transcriptase in vitro reverse transcription kit. Refer to the kit instructions for the reverse transcription steps. The resulting cDNA was diluted 10-fold with RNase-Free water, mixed well, and stored at -20°C for later use. (2) Synthesize RACE cDNA using the SMARTer RACE 5' / 3' Kit. Refer to the kit instructions for the reverse transcription steps. Dilute the first-strand cDNA synthesis product to 110 μL using Tricine-EDTA Buffer, mix well, and store at -20°C for later use.

[0025] 3. Obtaining the locust BTB transcription factor LOCMI00260 (1) Primer design Based on the locust transcriptome obtained previously, the LOCMI00260 sequence was obtained, and the primers designed are as follows: LOCMI00260-F1:ATGTCCTTCGGAAGCATTACGTG; LOCMI00260-R1: CTACCTCGGTGTCAGTATCTGCAGC; LOCMI00260-F2:GCGATTCTGTAGTTATGTCGTTGTC; LOCMI00260-F3:GGAAGGCCAAGGATAGCAGC.

[0026] (2) PCR reaction Using locust cDNA as a template, PCR amplification was performed using primers F1 / R1, F2 / UPM, and F3 / UPM to obtain PCR products.

[0027] The PCR amplification system was as follows: 25 μL of 2×PCR Buffer for KOD FX, 3 μL each of F1 and R1 (or 1 μL of F2 and F3, 5 μL of UPM), 2 μL of cDNA synthesis product, and RNase-Free water to make up to 50 μL.

[0028] PCR reaction procedure: 94℃ pre-denaturation for 5 min, 98℃ pre-denaturation for 30 s, 60℃ annealing for 30 s, 68℃ extension for 0.5-5 min, 68℃ reaction for 10 min to terminate PCR, store at 4℃ until removed. A total of 35 cycles of denaturation, annealing, and extension were performed. PCR products were detected by 2% agarose gel electrophoresis.

[0029] (3) PCR product recovery, transformation and sequencing (3-1) Perform electrophoresis on a 2% agarose gel prepared by TAE. When the target band is well separated, cut off the gel block containing the target band with a blade and place it into a 1.5 mL centrifuge tube. Then, use a gel extraction kit to recover and purify the target band. The recovery and purification process should be performed according to the kit instructions.

[0030] (3-2) Ligation of PCR products after recovery pEASY- Blunt Zero vector was used to obtain the recombinant vector. The ligation system was as follows: 100 ng of DNA was recovered via gel extraction. pEASY- 1 μL of Blunt Zero Vector was mixed with 3 μL of RNase-Free water to form a total system of 5 μL. After centrifugation, the mixture was incubated at 25°C for 20 min in a PCR instrument.

[0031] (3-3) Preparation and transformation of competent cells After removing the competent cells from the -80℃ freezer, place them on ice for 10 min. In a clean bench, add 5 μL of ligation product to 50 μL of competent cells, gently tap to mix, and immediately place in ice for 20-30 min. Heat shock in a 42℃ metal bath for 30-90 s, then quickly place on ice to cool for 2 min. Add 300 μL of antibiotic-free LB liquid medium to each tube and shake at 200 rpm for 60 min at 37℃. Spread 250 μL of bacterial culture evenly on LB solid medium containing Kana using a spreader and incubate upside down at 37℃ for about 16 h.

[0032] (3-4) Bacterial PCR Single colonies were selected and the bacterial culture was verified by PCR using M13F / R primers.

[0033] The PCR reaction system consisted of 20 μL of bacterial culture, 10 μL of 2×Buffer, 1 μL of M13F, 1 μL of M13R, 0.5 μL of Taq enzyme, and 5.5 μL of ddH2O.

[0034] The PCR reaction conditions were as follows: 95℃ for 3 min; 95℃ for 30 s, 60℃ for 30 s, 72℃ for 90 s, 35 cycles; 72℃ for 10 min; stored at 4℃.

[0035] Positive clones were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing and analysis of the sequencing results. The cloned UTR sequence and CDS were assembled together, and the ORF was predicted using ORFfinder (https: / / www.ncbi.nlm.nih.gov / orffinder / ).

[0036] The results showed that a DNA fragment of 1290 bp was obtained by PCR amplification, and its nucleotide sequence is shown in SEQ ID NO:1. The gene shown in sequence 1 was named locust BTB transcription factor LOCMI00260.

[0037] 4. Is the locust LOCMI00260 a predictor of BTB transcription factors? Since most BTB transcription factors are transcription factors, the nucleotide sequence of the locust BTB transcription factor LOCMI002601290 bp was translated into 429 amino acids, as shown in SEQ ID NO:2. TF prediction was performed using AnimalTFDB v4.0 (https: / / guolab.wchscu.cn / AnimalTFDB4 / # / TF_Predict), and the results showed that LOCMI00260 is a transcription factor; therefore, LOCMI00260 belongs to the BTB transcription factor family.

[0038] 5. Prediction of the LOCMI00260 domain of BTB transcription factor The domains of the 429 amino acids in the locust BTB transcription factor LOCMI00260 were predicted using the SMART website (https: / / smart.embl.de / ).

[0039] The results are as follows Figure 1 As shown, LOCMI00260 contains one BTB domain and three ANK domains, with the BTB domain being mostly transcription factors.

[0040] Example 2: Expression level of BTB transcription factor LOCMI00260 in locust eggs 1. Sampling of non-diapause eggs and diapause eggs of locusts on days 6-13. It is known that the initiation of diapause in locust eggs occurs during relatively low-temperature treatment, and this initiation process precedes the embryonic transformation stage. To clarify the specific time point at which LOCMI00260 exhibits differential expression in diapause eggs (eggs laid by locust mothers under diapause-induced photoperiod of 8 L:16 D) and non-diapause eggs (eggs laid by locust mothers under non-diapause-induced photoperiod of 16 L:8 D), diapause and non-diapause eggs were simultaneously incubated in a 25°C incubator. Embryos were observed under OCT on day 6 of incubation. Therefore, samples were taken from both non-diapause and diapause eggs at 25°C starting on day 6 and continuing until day 13, the day before embryonic transformation, i.e., continuous sampling from day 6 to day 13.

[0041] 2. Expression level of BTB transcription factor LOCMI00260 in locusts on days 6-13 in non-diapause eggs and diapause eggs. Total RNA was extracted from locust eggs, and cDNA was synthesized using a reverse transcription kit. The expression level of the locust BTB transcription factor LOCMI00260 was detected. The RP49 gene was used as an internal control gene. Primer sequences are as follows: LOCMI00260-F5: TTCGGAGTGGACCCCAACAC; LOCMI00260-R5:GCACGTGGTCCTGTCTATAATATCT; RP49-F1:CGTAAACCGAAGGGAATTGA; RP49-R1:GAAGAAACTGCATGGGCAAT.

[0042] Using BlasTaq TMQuantitative analysis of locust BTB transcription factor LOCMI00260 using 2×qPCR Master Mix was performed using a 10 μL BlasTaq assay. TM The reaction mixture was prepared using 5 μL of 2×qPCR Master Mix, 0.3 μL each of forward and reverse primers, 2.4 μL of RNase-Free water, and 2 μL of template DNA. PCR was then performed using a real-time quantitative PCR instrument following a program of 95℃ pre-denaturation for 10 min, 95℃ denaturation for 15 s, 70℃ annealing for 20 s, and 60℃ extension for 20 s, for a total of 40 cycles. A melting curve was established at 65℃-95℃ for 15 s. Data were read using the Bio-Rad CFX software CFXManager, and analyzed using 2- ΔΔct The relative expression level of the BTB transcription factor LOCMI00260 in locusts was calculated using a method.

[0043] The results are as follows Figure 2 As shown in the figure, the expression level of the locust BTB transcription factor LOCMI00260 did not differ significantly between non-diapause eggs and diapause eggs on days 6-9 after hatching. However, on days 10-13, the expression level of LOCMI00260 in non-diapause eggs was significantly higher than that in diapause eggs.

[0044] Example 3: Synthesis of dsRNA of locust BTB transcription factor LOCMI00260 and its application in locust control. I. Synthesis of dsRNA Uses T7 RiboMAX TM The Express RNAi System kit is used to synthesize dsRNA. The specific steps are as follows: 1. Synthesis of dsRNA primers Primers were designed based on the cloned locust BTB transcription factor LOCMI00260 fragment to amplify the target fragment of 325 bp. A T7 promoter was introduced at the 5' end of the primers. The primer sequences are as follows: LOCMI00260-F4:TAATACGACTCACTATAGGATCCGGCATGGTGCAATTGGACG; LOCMI00260-R4: TAATACGACTCACTATAGGTCGGGGTTGGAACCGCTGCTATC.

[0045] 2. Preparation of DNA template Using bacterial culture containing the locust BTB transcription factor LOCMI00260 fragment (the bacterial culture containing the recombinant vector in Example 1) as a template, PCR amplification was performed using LOCMI00260-F4 and LOCMI00260-R4 to obtain the target fragment containing the T7 promoter sequence.

[0046] The 50μL PCR reaction system is as follows: 4μL bacterial culture, 25μL 2×PCR Buffer for KOD FX, 3μL each of F4 and R4, and 15μL RNase-Free water.

[0047] The PCR reaction conditions were as follows: 94℃ for 5 min; 98℃ for 30 s, 60℃ for 30 s, 68℃ for 30 s, 35 cycles; 68℃ for 10 min; stored at 4℃.

[0048] The PCR products were electrophoresed on a 2% agarose gel prepared by TAE. When the target band was well separated, the DNA fragments in the gel were recovered, and the concentration of the target DNA was detected by a micro spectrophotometer. The recovered concentration should be greater than 125 ng / μL.

[0049] 3. Synthesis of dsRNA of locust BTB transcription factor LOCMI00260 Uses T7 RiboMAX TM The Express RNAi System kit transcribed the recovered DNA in vitro to synthesize dsRNA of locust BTB transcription factor LOCMI00260, and detected the dsRNA concentration using a micro spectrophotometer. The dsRNA concentration was then adjusted to a 0.5 μg / μL dsRNA solution (solvent: RNase-free water).

[0050] The dsRNA of locust BTB transcription factor LOCMI00260 obtained in this invention is a double-stranded RNA, consisting of a sense strand and an antisense strand. The nucleotide sequence of its sense strand is shown in SEQ ID NO:3, and the nucleotide sequence of its antisense strand is shown in SEQ ID NO:4.

[0051] The dsRNA of the locust BTB transcription factor LOCMI00260 can also be obtained through artificial synthesis. The dsRNA of the locust BTB transcription factor LOCMI00260 is named dsLOCMI00260.

[0052] 4. dsRNA of control GFP The control GFP dsRNA was synthesized according to the above method and named dsGFP. The solution was also adjusted to 0.5 μg / μL. The control GFP dsRNA is a double-stranded RNA, composed of a sense strand and an antisense strand. The nucleotide sequence of its sense strand is shown in SEQ ID NO:5, and the nucleotide sequence of its antisense strand is the reverse complementary sequence of the sequence shown in SEQ ID NO:6. The primers for synthesizing GFP dsRNA are as follows: GFP-F1: TAATACGACTCACTATAGGCACAAGTTCAGCGTGTCCG; GFP-R1: TAATACGACTCACTATAGGGTTCACCTTGATGCCGTTC.

[0053] II. Application of dsRNA in the control of locusts 1. Experimental Methods dsRNA was introduced into locust eggs. The specific steps were as follows: Non-diapause eggs incubated at 25℃ for 9 days were selected. A microinjection device was used to inject dsLOCMI00260 into the micropores of the locust eggs at a volume of 23 nL and a concentration of 0.5 μg / μL. After injection, the eggs were returned to 25℃ for incubation (interference group). The control group was injected with dsGFP. 24 h later, the morphology of the injected locust eggs was observed and recorded using OCT, and samples were taken (5 eggs / biological replicate × 5 biological replicates) to facilitate subsequent qPCR detection of interference efficiency.

[0054] 2. Real-time quantitative PCR Total RNA was extracted from locust eggs, and cDNA was synthesized using a reverse transcription kit. The expression level of the locust transcription factor LOCMI00260 was then detected. The RP49 gene was used as an internal control gene.

[0055] The results are as follows Figure 3 As shown in Figure A, dsLOCMI00260 successfully interfered with the expression of LOCMI00260 in the ovarian tissue of locusts.

[0056] 3. Statistics on locust diapause rate Locust eggs injected with dsLOCMI00260 or dsGFP were incubated at 25°C. OCT was used to observe the eggs from day 15 to day 25, recording the number of non-diapause eggs and the number of diapause eggs, and calculating the diapause rate. The diapause rate is equal to the number of diapause eggs divided by the sum of the number of diapause eggs and the number of non-diapause eggs.

[0057] The results are as follows Figure 3As shown in Figure B, after successfully interfering with the expression of LOCMI00260, the diapause rate of locust eggs was significantly higher than that of the control group, indicating that LOCMI00260 is involved in the regulation of locust embryo diapause, and the diapause rate of locust embryos increases when the transcription level of LOCMI00260 decreases.

Claims

1. BTB transcription factor LOCMI00260, characterized in that, The nucleotide sequence of the BTB transcription factor LOCMI00260 is shown in SEQ ID NO:

1.

2. The BTB transcription factor LOCMI00260 according to claim 1, characterized in that, The amino acid sequence of the protein encoded by the BTB transcription factor LOCMI00260 is shown in SEQ ID NO:2, and it contains one BTB domain and three ANK domains.

3. The use of the BTB transcription factor LOCMI00260 and its encoded protein as described in claim 1 in any one of the following (1)-(4): (1) Control of locusts; (2) Prepare products for the prevention and control of locusts; (3) Improve the diapause rate of locusts; (4) Prepare products that improve the diapause rate of locusts.

4. A method for improving the diapause rate of locusts, comprising the step of reducing the expression level of BTB transcription factor LOCMI00260 in locusts, thereby improving the diapause rate of locusts; the nucleotide sequence of said BTB transcription factor LOCMI00260 is shown in SEQ ID NO:

1.

5. The method according to claim 4, characterized in that, The method for reducing the expression level of BTB transcription factor LOCMI00260 in locusts is to introduce a substance that inhibits the expression of BTB transcription factor LOCMI00260 in locusts into the locust body.

6. The method according to claim 5, characterized in that, The method of introduction is injection.

7. A dsRNA that inhibits the expression of the BTB transcription factor LOCMI00260 in locusts, characterized in that, The dsRNA that inhibits the expression of the BTB transcription factor LOCMI00260 in locusts is a double-stranded RNA composed of the nucleotides shown in SEQ ID NO:3 and SEQ ID NO:

4.

8. The application of the method of claim 4 or the dsRNA of claim 7 in the prevention and control of locusts or in improving the diapause rate of locusts.