Molecular marker related to slash pine paper pulp, DNA fragment, kit and application thereof

By using SNP molecular markers and DNA fragments related to slash pine pulp, early identification of slash pine wood fiber length and assisted breeding were achieved, solving the problems of long breeding cycle and low efficiency of slash pine, and improving breeding selection efficiency and cost-effectiveness.

CN121249953APending Publication Date: 2026-01-02RES INST OF SUBTROPICAL FORESTRY CHINESE ACAD OF FORESTRY
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202511710170.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-20
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

The identification of slash pine pulp properties was delayed, the breeding cycle was long, and the breeding efficiency was low, making it difficult to meet the demand of the pulp market.

Method used

We provide SNP molecular marker S1_641460596, DNA fragments, and kits related to slash pine pulpwood for identifying slash pine wood fiber length, enabling early prediction and assisted breeding through PCR amplification and Sanger sequencing analysis.

Benefits of technology

Rapid and accurate identification of wood fiber length during the seedling stage of slash pine can improve breeding efficiency, reduce costs, and screen out high-quality pulpwood slash pine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The invention discloses a molecular marker related to slash pine paper pulp, a DNA (deoxyribonucleic acid) fragment, a kit and application of the molecular marker, the SNP molecular marker is S1641460596 and is located at the 641460596 site of a slash pine chromosome 1; the polymorphism of the SNP site is G / A, the genotype of the SNP site of the slash pine with the long wood fiber length is GG, and the genotype of the SNP site of the slash pine with the short wood fiber length is GA or AA. The DNA fragment of the gene is located in a Pel1G156900 gene region of a slash pine genome, and the nucleotide sequence of the gene is as shown in SEQ ID NO. 1 or SEQ ID NO. 2. The kit comprises a forward primer and a reverse primer which are used for amplifying the DNA fragment related to the slash pine paper pulp; the nucleotide sequence of the forward primer is as shown in SEQ ID NO.3, and the nucleotide sequence of the reverse primer is as shown in SEQ ID NO.4; the molecular marker, the DNA fragment and the kit are used for related phenotype identification, early prediction, breeding and the like of slash pine paper pulp, and the problems of late identification, long breeding period, low breeding efficiency and the like of existing slash pine paper pulp characters can be solved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular markers and genetic breeding technology for slash pine. Specifically, it relates to molecular markers, DNA fragments, kits, and their applications related to slash pine pulp. Background Technology

[0002] Slash pine ( Pinus elliottii Engelm. var. elliottii Originally from the southeastern United States, slash pine has been introduced and cultivated in my country for over 100 years. It is an important fast-growing timber species and pulp raw material production species in southern my country. Pulpwood traits have always been a major breeding target in the genetic improvement of slash pine. Among them, the wood fiber length index is the most direct phenotypic trait of pulpwood and is a reflection of high-quality slash pine pulpwood.

[0003] The planting area of ​​slash pine in my country is nearly 22 million mu (approximately 1.8 million hectares). It is characterized by rapid growth, long and high-quality fibers, and can continuously provide high-quality raw materials for the paper industry. Therefore, selecting and breeding superior slash pine for pulp is an important guarantee for the healthy development of my country's pulp industry.

[0004] Traditional breeding of slash pine, primarily using conventional hybridization, has made significant progress. However, the long reproductive cycle (15-20 years) and complex genome of slash pine have become bottlenecks affecting the efficiency of conventional breeding, and the selection speed cannot meet the demands of the pulp market. Compared to traditional breeding techniques, molecular marker-assisted breeding allows for early selection of superior lines from the seedling stage, significantly shortening the breeding cycle. This advantage is particularly evident in pine breeding aimed at pulpwood production. Molecular marker-assisted breeding relies on linked markers for the target trait; therefore, identifying molecular markers and candidate genes related to slash pine pulpwood can help increase the yield of pulpwood per tree and reduce costs, which is of great significance for the upgrading and healthy development of the slash pine industrial timber industry. Summary of the Invention

[0005] Therefore, the technical problem to be solved by the present invention is to provide a molecular marker, DNA fragment, reagent kit and its application related to slash pine pulp, so as to solve the problems of late identification of existing slash pine pulp traits, long breeding cycle and low breeding efficiency.

[0006] To solve the above-mentioned technical problems, the present invention provides the following technical solution: The SNP molecular marker associated with slash pine pulp is S1_641460596, located at position 641460596 on chromosome 1 of slash pine. The polymorphism of the SNP site is G / A. The genotype of the SNP site of slash pine with long wood fiber length is GG, and the genotype of the SNP site of slash pine with short wood fiber length is GA or AA.

[0007] The DNA fragment associated with slash pine pulp is located in the Pel1G156900 gene region of the slash pine genome and contains the aforementioned SNP molecular markers associated with slash pine pulp; the nucleotide sequence of the DNA fragment associated with slash pine pulp is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0008] SEQ ID NO.1: CCATCGTAAGCGAAATAAGCGAAAATTTACATATATTCTTTGTACGATAACGCATGTGACTATTTACCATTCTCTTTCGGAACAGCGGGATCTGAACCCACGACCTCCATCACCCCAAGATGGCGCGTTACCAAGCTGCGCCATGCTCCGTTATAACTATCAACCAACATAAAATTGATTCAAGAGGGAATAGTGGATTATCCAAAAATACCACTACTGCGTAAACGAACAGCTTAAGAGTAAGCATTAC GTAATTCTCCGGAATCCACCCTCCAAAAGTAATCCGTTATGAGTATTCCATTGGTGCGAACTTATCCGGAAAAACATACCTGGTGGGCCACGACTAGTCCATAAATAGTTAAAGCTTCCATAAAAGCTAAACTTAGCAGTAAGGTACCTCGTATTTTACCTTCTGCTTCTGGTTGTCTCACAATACCTTCTACAGCTTGGCCCGCAGTAGTGCCCTGGCCAACGCCAGGTCCAATGGAAGCAAGCCCTACA GATAATCCAGCAGCAATAACGGAAGCAGCAGAAATTAAGGGATCCATGGTAATCTCCTCTTACTAAGGTTGGGAAATAGTTGATAATACGACAGTTTCATCTATTGAGTGTTCACCAATGGTAAAATTATGGAACGATTTCTTCCGAACAACTAAGAACAAAAATATTTATTGATGATATCAAAGTGATAATATCAACGATAACGGAGGAGTATCAATAGATGGATAAATAAATATATATATATATCCATATATACAGATATCTTTATTTATCCATCTAGAAACGGTGTAATAATCACCGTTGCTTTTAAAATTACAAAAAAAGGCTTTTTTTCATGAAAAAAGCCCATTGTCCGTTGAGCACCTAAAAGATATGTTATAATAAAATTGAACATCTGCCTCAGATTGACTCCCGTATCATAGTCGCTCTAGTCATAAACTAGAAAATAAAGGGAGAAACGAGTTGAGATATATCTCTCGTAAGTTCACTAATTACTATTGG; SEQ ID NO.2: CCATCGTAAGCGAAATAAGCGAAAATTTACATATATTCTTTGTACGATAACGCATGTGACTATTTACCATTCTCTTTCGGAACAGCGGGATCTGAACCCACGACCTCCATCACCCCAAGATGGCGCGTTACCAAGCTGCGCCATGCTCCGTTATAACTATCAACCAACATAAAATTGATTCAAGAGGGAATAGTGGATTATCCAAAAATACCACTACTGCGTAAACGAACAGCTTAAGAGTAAGCATTACGTAATCTCCGGAATCCACCCTCCAAAAGTAATCCGTTATGAGTATTCCATTGGTGCGAACTTATCCGGAAAAACATACCTGGTGGGCCACGACTAGTCCATAAATAGTTAAAGCTTCCATAAAAGCTAAACTTAGCAGTAAGGTACCTCGTATTTTACCTTCTGCTTCTGGTTGTCTCACAATACCTTCTACAGCTTGGCCCGCAGTAGTGCCCTGGCCAACGCCAGGTCCAATGGAAGCAAGCCCTACA AATAATCCAGCAATAACGGAAGCAGCAGAAATTAAGGGATCCATGGTAATCTCCTCTTACTAAGGTTGGGAAATAGTTGATAATACGACAGTTTCATCTATTGAGTGTTCACCAATGGTAAAATTATGGAACGATTTCTTCCGAACAACTAAGAACAAAAATATTATTGATGATATCAAAGTGATAATATCAACGATAACGGAGGAGTATCAATAGATGGATAAATAAATATATATATATCCATA TATACAGATATCTTTATTTATCCATCTAGAAACGGTGTAATAATCACCGTTGCTTTTAAAATTACAAAAAAAGGCTTTTTTTCATGAAAAAAGCCCATTGTCCGTTGAGCACCTAAAAGATATGTTATAATAAAATTGAACATCTGCCTCAGATTGACTCCCGTATCATAGTCGCTCTAGTCATAAACTAGAAAATAAAGGGAGAAACGAGTTGAGATATATCTCTCGTAAGTTCACTAATTACTATTGG.

[0009] A kit for use with slash pine pulp contains forward and reverse primers for amplifying the aforementioned DNA fragments associated with slash pine pulp; the nucleotide sequence of the forward primer is shown in SEQ ID NO. 3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO. 4.

[0010] SEQ ID NO.3: 5'-TTGCAGTGGTTCTGGAGATG-3'; SEQ ID NO. 4: 5'-GGAACAAACCTGCCAACCTA-3'.

[0011] Application of SNP molecular markers related to slash pine pulp: The above-mentioned SNP molecular markers related to slash pine pulp, the above-mentioned DNA fragments related to slash pine pulp, or the above-mentioned kits related to slash pine pulp can be used to achieve any of the following applications: (1) Used to identify the fiber length phenotype of slash pine wood; (2) Used to achieve early prediction of the fiber length of slash pine wood; (3) Used for the improvement of fiber length phenotype in slash pine wood; (4) Used for molecular marker-assisted breeding of phenotypic phenotype of slash pine wood; (5) Used for screening high-quality pulpwood, slash pine.

[0012] The application of the above-mentioned SNP molecular markers related to slash pine pulp and the method for identifying the fiber length phenotype of slash pine wood include the following steps: Step (1): Extract genomic DNA from the slash pine to be identified; Step (2): Using genomic DNA as a template, perform PCR amplification using the forward primer shown in SEQ ID NO.3 and the reverse primer shown in SEQ ID NO.4 to obtain the target DNA fragment; Step (3): Perform Sanger sequencing analysis and typing on the PCR products, and determine the phenotype of the fiber length of the slash pine wood to be identified based on the genotype of the SNP molecular marker.

[0013] In the application of SNP molecular markers related to slash pine pulp, in step (1), the genomic DNA of the slash pine to be identified was extracted using the TianGen TIANamp Genomic DNA Kit DP305, with the needle tissue as the sample source of genomic DNA.

[0014] In the above application of SNP molecular markers related to slash pine pulp, in step (2), the target DNA fragment is the DNA fragment 500 bp upstream and downstream of the SNP molecular marker S1_641460596; the PCR amplification reaction program is as follows: 94-95℃, 3-5min, 1 cycle for pre-denaturation; 94-95℃, 15-30s, 60-65℃, 40-60s, 30-35 cycles; 60-70℃, 4-6min, 1 cycle for complete extension.

[0015] In the application of the above-mentioned SNP molecular markers related to slash pine pulp, the PCR amplification reaction program in step (2) is as follows: 94℃, 3min, 1 cycle of pre-denaturation; 94℃, 15s, 60℃, 50s extension, 30 cycles; 60℃, 4min, 1 cycle of complete extension.

[0016] In the application of the above-mentioned SNP molecular markers related to slash pine pulp, in step (2), after amplification, the obtained PCR products are detected and recovered by agarose gel electrophoresis; in the agarose gel electrophoresis detection, the concentration of agarose gel is 1.2%; gel recovery is performed using the AxyPrep DNA gel recovery kit.

[0017] In the above application of SNP molecular markers related to slash pine pulp, in step (3), if the genotype of SNP molecular marker S1_641460596 in the target DNA fragment obtained by PCR amplification is GA or AA, then the wood fiber length trait of the slash pine to be identified is short; if the genotype of SNP molecular marker S1_641460596 in the target DNA fragment obtained by PCR amplification is GG, then the wood fiber length trait of the slash pine to be identified is long, and the slash pine to be identified is determined to be a high-quality pulp slash pine.

[0018] The technical solution of the present invention achieves the following beneficial technical effects: 1. The major gene SNP locus for wood fiber length in *Pinus slashensis* identified in this invention is S1_641460596, located at position 641460596 on chromosome 1 of *Pinus slashensis*. The polymorphism of this SNP locus is G / A, contributing 7.06% to the wood fiber length phenotype. This SNP marker was used for auxiliary selection of F1 hybrids from 340 freely pollinated female *Pinus slashensis* plants. The results showed that among individuals with the GG genotype at this locus, 66.7% had wood fiber lengths higher than the population average (2.52 mm); among individuals with the GA genotype, 77.9% had wood fiber lengths lower than the population average (2.52 mm); and among individuals with the AA genotype, 91.3% had wood fiber lengths lower than the population average (2.52 mm). This demonstrates that this marker is effective for auxiliary selection.

[0019] 2. In conventional selection and breeding of slash pine, the identification of pulpwood traits requires approximately 10 years of seedling afforestation, which is time-consuming and labor-intensive. The SNP sites screened in this invention have clearly defined locations, the detection method is convenient and rapid and unaffected by the environment, offering greater targeting, less workload, higher efficiency, and lower cost. Therefore, by detecting SNP sites, identification and auxiliary screening can be carried out during the slash pine seedling stage, greatly saving production costs and improving selection efficiency. In slash pine breeding, the molecular markers and detection methods of this invention can be used to identify high-quality pulpwood slash pine for breeding, improving the selection efficiency of slash pine breeding and accelerating the breeding process. Detailed Implementation

[0020] The 340 F1 hybrids of *Pinus slashani* used in the following examples were all collected and evaluated by the Forest Germplasm Resources Research Group of the Subtropical Forestry Research Institute, Chinese Academy of Forestry, and are preserved in the germplasm resource nursery of Changle Forest Farm, Yuhang District, Hangzhou City, Zhejiang Province. Unless otherwise specified, all experimental materials, reagents, and instruments used in the embodiments of this invention are commercially available; unless otherwise specified, all technical means in the embodiments of this invention are conventional means well known to those skilled in the art.

[0021] 1. Selection and property determination of slash pine pulpwood population In this embodiment, 340 slash pine parent trees were used to create a hybrid F1 population with widely segregated economic traits through free pollination. The F1 population was constructed using a completely randomized block design, with 6 individual trees per plot and 6 replicates, and was preserved in Changle Forest Farm, Yuhang District, Hangzhou City, Zhejiang Province. From 30-year-old slash pine trees, one healthy tree from each family was selected for wood fiber length measurement. The measurement was taken at a trunk diameter of 1.3 m above the ground, resulting in 340 samples of wood fiber length data (i.e., the wood fiber length of 30-year-old slash pine trees as described in this embodiment, in millimeters). The results showed significant differences in wood fiber length among the families, indicating that this trait has quantitative characteristics.

[0022] 2. Development of SNP markers related to pulpwood in slash pine breeding populations 2.1 Population DNA Extraction In July 2024, the slash pine constructed in this embodiment ( Pinus elliottii 340 half-sib families were randomly selected from the breeding population, and one healthy single plant from each family was selected for fresh needle tissue collection. Samples were immediately placed on ice to prevent DNA degradation.

[0023] Total DNA was extracted from slash pine needles using the TianGen TIANamp Genomic DNA Kit DP305 from TIANGEN Biotech Co., Ltd. (Beijing, China) for constructing a DNA library. The extraction process for total DNA from slash pine needles is as follows: (1) Weigh about 100 mg of fresh needle sample and grind it into fine powder in liquid nitrogen.

[0024] (2) Add 500 μL of lysis buffer GP1, shake vigorously to mix, and lyse in a 65℃ water bath for 10 min.

[0025] (3) Collect the supernatant after centrifugation (12,000 rpm, 2 min).

[0026] (4) Add anhydrous isopropanol at a volume ratio of 1:1, mix gently and centrifuge (12,000 rpm, 2 min).

[0027] (5) Discard the supernatant, wash the DNA precipitate twice with 70% ethanol solution, air dry and dissolve in 50 μL TE buffer.

[0028] DNA purity, concentration, and integrity were assessed using Nanodrop, Qubit 2.0, and 1% agarose gel electrophoresis. High-quality samples with OD260 / 280 values ​​between 1.8 and 2.0 and OD260 / 230 > 2.0 were selected for subsequent targeted sequencing.

[0029] 2.2 Probe-targeted capture sequencing High-quality DNA samples were subjected to 51K liquid-phase probe-targeted capture and high-throughput sequencing by Beijing Shengshidai Technology Co., Ltd. The capture and sequencing steps are as follows: Step (1): Use ultrasound to fragment the sample DNA into fragments of approximately 200-350 bp in length.

[0030] Step (2): After repairing the ends and adding an A tail, ligate the sequencing adapter to prepare the sequencing library.

[0031] Step (3): Add a 51K RNA probe designed for conserved and specific sequences of slash pine and loblolly pine for hybridization capture. The probe is biotinylated, and the hybridized double-stranded complex binds to streptavidin magnetic beads to enrich the target sequence.

[0032] Step (4): After eluting the non-specific hybridization fragments, perform PCR amplification to obtain the capture-enriched library.

[0033] Step (5): After library quality testing using Qubit and Agilent 2100, paired-end sequencing (PE150) was performed using the MGI DNBSEQ-T7 platform.

[0034] 2.3 SNP marker identification and genotyping (1) The raw reads captured by the 340 pine probes were filtered using the Trim_galore software to remove the adapter sequences and obtain the clean reads.

[0035] (2) Use BWA software v0.7.17 to construct the slash pine genome index file.

[0036] (3) Using the pine genome v2.1 as the reference sequence, the 340 clean reads of pine obtained were aligned to the reference sequence using BWA software, and sequences that were not aligned were removed.

[0037] (4) SNP identification and filtering using GATK software v4.1.2.0: Identify SNP sites in the sequence and filter them according to the following standards: QualByDepth (QD) > 2.0, FisherStrand (FS) > 30.0, RMSMappingQuality (MQ) > 40.0, MQRankSum > -12.5, ReadPosRankSum > -8.0, SOR > 3.0 to obtain high-quality genotype files. All the software used above is publicly available and free.

[0038] 3. Mining of gene loci and linked SNP loci for the fiber length trait in slash pine wood. Genotype data were imputed using Beagle v5.4 software. A mixed linear model using GEMMA v0.98.1 was used to perform association analysis between the phenotypic data of slash pine wood fiber length and genotype. The first three principal components calculated based on the genotype data were used as covariates in the model. The extreme significance threshold was set to P ≤ 9.4e-07, and the significance threshold was set to P ≤ 1.9e-06. A SNP locus S1_641460596 significantly associated with slash pine wood fiber length was identified, with the related candidate gene Pel1G156900. The phenotypic variation explained by this marker locus was 7.06%, and its genotype was G / A (see Table 1), where G is the reference sequence base and A is the mutant base. The genotype of the SNP locus in slash pine with long wood fiber length is GG, and the genotype of the SNP locus in slash pine with short wood fiber length is GA or AA.

[0039] Table 1. Information on candidate genes and linked SNP molecular markers

[0040] 4. Application of gene loci and linked SNP molecular markers for the fiber length trait of slash pine in slash pine breeding SNP genotyping was performed, and Table 2 shows the genotypes corresponding to the S1_641460596 locus in 340 individual plants. The results showed that among plants with the GG genotype at this locus, 66.7% had wood fiber lengths higher than the population average (2.52 mm); among individuals with the GA genotype, 77.9% had wood fiber lengths lower than the population average (2.52 mm); and among individuals with the AA genotype, 91.3% had wood fiber lengths lower than the population average (2.52 mm). This indicates that the marker is effective in assisted selection. Therefore, the DNA fragments and SNP molecular markers related to the wood fiber length of *Pinus slashfordii* screened in this embodiment can be used to identify the wood fiber length phenotype of *Pinus slashfordii*, or to achieve early prediction of wood fiber length in *Pinus slashfordii*, or for phenotypic improvement of *Pinus slashfordii* wood fiber length or marker-assisted breeding based on the wood fiber length phenotype of *Pinus slashfordii*, or for screening high-quality pulpwood *Pinus slashfordii*.

[0041] Table 2. Average fiber length and genotype data of offspring from 340 half-sib families of Pinus slashii.

[0042]

[0043]

[0044] 5. Methods for determining the fiber length of slash pine wood This embodiment of the method for identifying the fiber length of slash pine wood using gene loci and linked SNP molecular markers includes the following steps: (1) Extracting genomic DNA from the slash pine to be identified; In this embodiment, the slash pine to be identified was selected from 340 F1 generation individuals of the mother plant that were freely pollinated, and the needle tissue was used as the sample source for genomic DNA; The genomic DNA of the slash pine was extracted using the TianGenTIANamp Genomic DNA Kit DP305. (2) Using genomic DNA as a template, the target DNA fragment was amplified by PCR using primers with sequences as shown in SEQ ID NO.3 and SEQ ID NO.4. The target DNA fragment was a DNA fragment of 500 bp upstream and downstream of the SNP molecular marker S1_641460596 (Chr1:641460096-641461096), and the nucleotide sequence of the target DNA fragment was shown in SEQ ID NO.1 or SEQ ID NO.2.

[0045] SEQ ID NO.1: CCATCGTAAGCGAAATAAGCGAAAATTTACATATATTCTTTGTACGATAACGCATGTGACTATTTACCATTCTCTTTCGGAACAGCGGGATCTGAACCCACGACCTCCATCACCCCAAGATGGCGCGTTACCAAGCTGCGCCATGCTCCGTTATAACTATCAACCAACATAAAATTGATTCAAGAGGGAATAGTGGATTATCCAAAAATACCACTACTGCGTAAACGAACAGCTTAAGAGTAAGCATTACGTAATCTCCGGAATCCACCCTCCAAAAGTAATCCGTTATGAGTATTCCATTGGTGCGAACTTATCCGGAAAAACATACCTGGTGGGCCACGACTAGTCCATAAATAGTTAAAGCTTCCATAAAAGCTAAACTTAGCAGTAAGGTACCTCGTATTTTACCTTCTGCTTCTGGTTGTCTCACAATACCTTCTACAGCTTGGCCCGCAGTAGTGCCCTGGCCAACGCCAGGTCCAATGGAAGCAAGCCCTACA GATAATCCAGCAGCAATAACGGAAGCAGCAGAAATTAAGGGATCCATGGTAATCTCCTCTTACTAAGGTTGGGAAATAGTTGATAATACGACAGTTTCATCTATTGAGTGTTCACCAATGGTAAAATTATGGAACGATTTCTTCCGAACAACTAAGAACAAAAATATTTATTGATGATATCAAAGTGATAATATCAACGATAACGGAGGAGTATCAATAGATGGATAAATAAATATATATATATATCCATATATACAGATATCTTTATTTATCCATCTAGAAACGGTGTAATAATCACCGTTGCTTTTAAAATTACAAAAAAAGGCTTTTTTTCATGAAAAAAGCCCATTGTCCGTTGAGCACCTAAAAGATATGTTATAATAAAATTGAACATCTGCCTCAGATTGACTCCCGTATCATAGTCGCTCTAGTCATAAACTAGAAAATAAAGGGAGAAACGAGTTGAGATATATCTCTCGTAAGTTCACTAATTACTATTGG; SEQ ID NO.2: CCATCGTAAGCGAAATAAGCGAAAATTTACATATATTCTTTGTACGATAACGCATGTGACTATTTACCATTCTCTTTCGGAACAGCGGGATCTGAACCCACGACCTCCATCACCCCAAGATGGCGCGTTACCAAGCTGCGCCATGCTCCGTTATAACTATCAACCAACATAAAATTGATTCAAGAGGGAATAGTGGATTATCCAAAAATACCACTACTGCGTAAACGAACAGCTTAAGAGTAAGCATTACGTAATCTCCGGAATCCACCCTCCAAAAGTAATCCGTTATGAGTATTCCATTGGTGCGAACTTATCCGGAAAAACATACCTGGTGGGCCACGACTAGTCCATAAATAGTTAAAGCTTCCATAAAAGCTAAACTTAGCAGTAAGGTACCTCGTATTTTACCTTCTGCTTCTGGTTGTCTCACAATACCTTCTACAGCTTGGCCCGCAGTAGTGCCCTGGCCAACGCCAGGTCCAATGGAAGCAAGCCCTACA AATAATCCAGCAATAACGGAAGCAGCAGAAATTAAGGGATCCATGGTAATCTCCTCTTACTAAGGTTGGGAAATAGTTGATAATACGACAGTTTCATCTATTGAGTGTTCACCAATGGTAAAATTATGGAACGATTTCTTCCGAACAACTAAGAACAAAAATATTATTGATGATATCAAAGTGATAATATCAACGATAACGGAGGAGTATCAATAGATGGATAAATAAATATATATATATCCATA TATACAGATATCTTTATTTATCCATCTAGAAACGGTGTAATAATCACCGTTGCTTTTAAAATTACAAAAAAAGGCTTTTTTTCATGAAAAAAGCCCATTGTCCGTTGAGCACCTAAAAGATATGTTATAATAAAATTGAACATCTGCCTCAGATTGACTCCCGTATCATAGTCGCTCTAGTCATAAACTAGAAAATAAAGGGAGAAACGAGTTGAGATATATCTCTCGTAAGTTCACTAATTACTATTGG; SEQ ID NO.3: 5'-TTGCAGTGGTTCTGGAGATG-3'; SEQ ID NO. 4: 5'-GGAACAAACCTGCCAACCTA-3'.

[0046] The PCR amplification reaction program was as follows: 94℃, 3 min, 1 cycle for pre-denaturation; 94℃, 15 s for denaturation, 60℃, 50 s for extension, 30 cycles; 60℃, 4 min, 1 cycle for complete extension. After amplification, the obtained PCR products were detected and recovered by agarose gel electrophoresis; the concentration of agarose gel in the agarose gel electrophoresis was 1.2%; gel recovery was performed using the AxyPrep DNA Gel Recovery Kit (AxyGEN, Code No. AP-GX-50).

[0047] (3) Perform Sanger sequencing analysis and typing on the PCR products, and determine the phenotype of the wood fiber length of the pine to be identified based on the genotype of the SNP molecular marker. Specifically, if the genotype of the SNP molecular marker S1_641460596 in the target DNA fragment obtained by PCR amplification is GA or AA, then the wood fiber length trait of the pine to be identified is short; if the genotype of the SNP molecular marker S1_641460596 in the target DNA fragment obtained by PCR amplification is GG, then the wood fiber length trait of the pine to be identified is long, and the pine to be identified is determined to be a high-quality pulpwood pine.

[0048] In summary, the identification of the slash pine wood fiber length gene locus and its closely linked molecular markers provided by this invention is based on genome-wide association analysis of the wood fiber length phenotype in an established half-sib slash pine family population. This invention provides a SNP molecular marker regulating slash pine wood fiber length and its corresponding candidate gene, as well as the application of the molecular marker in the identification and breeding of slash pine wood fiber length phenotypes. By detecting SNP molecular marker loci, identification and assisted screening can be performed at the slash pine seedling stage, greatly saving production costs and improving selection efficiency.

Claims

1. SNP molecular markers associated with slash pine pulpwood, characterized in that, The SNP molecular marker is S1_641460596, located at position 641460596 on chromosome 1 of *Pinus slashii*. The polymorphism of the SNP locus is G / A. The genotype of the SNP locus of *Pinus slashii* with long wood fiber length is GG, while the genotype of the SNP locus of *Pinus slashii* with short wood fiber length is GA or AA.

2. A DNA fragment associated with slash pine pulpwood, characterized in that, The SNP molecular marker associated with slash pine pulp is located in the Pel1G156900 gene region of the slash pine genome as described in claim 1; the nucleotide sequence of the DNA fragment associated with slash pine pulp is shown in SEQ ID NO.1 or SEQ ID NO.

2.

3. A reagent kit related to slash pine pulp, characterized in that, It includes a forward primer and a reverse primer for amplifying the DNA fragment associated with slash pine pulp as described in claim 2; the nucleotide sequence of the forward primer is shown in SEQ ID NO. 3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

4.

4. The application of SNP molecular markers related to slash pine pulp, characterized in that, The SNP molecular markers associated with slash pine pulp as described in claim 1, the DNA fragments associated with slash pine pulp as described in claim 2, or the kits associated with slash pine pulp as described in claim 3 can be used to achieve any of the following applications: (1) Used to identify the fiber length phenotype of slash pine wood; (2) Used to achieve early prediction of the fiber length of slash pine wood; (3) Used for the improvement of fiber length phenotype in slash pine wood; (4) Used for molecular marker-assisted breeding of phenotypic phenotype of slash pine wood; (5) Used for screening high-quality pulpwood, slash pine.

5. The application of SNP molecular markers related to slash pine pulp as described in claim 4, characterized in that, The method for identifying the fiber length phenotype of slash pine wood includes the following steps: Step (1): Extract genomic DNA from the slash pine to be identified; Step (2): Using genomic DNA as a template, PCR amplification is performed using the forward primer shown in SEQ ID NO.3 and the reverse primer shown in SEQ ID NO.4 to obtain the target DNA fragment; Step (3): Perform Sanger sequencing analysis and typing on the PCR products, and determine the phenotype of the fiber length of the slash pine wood to be identified based on the genotype of the SNP molecular marker.

6. The application of SNP molecular markers related to slash pine pulp as described in claim 5, characterized in that, In step (1), genomic DNA was extracted from pine needle tissue as the sample source using the TianGen TIANamp Genomic DNA Kit DP305.

7. The application of SNP molecular markers related to slash pine pulp as described in claim 5, characterized in that, In step (2), the target DNA fragment is a DNA fragment 500 bp upstream and downstream of the SNP molecular marker S1_641460596; the PCR amplification reaction program is as follows: 94-95℃, 3-5 min, 1 cycle for pre-denaturation; 94-95℃, 15-30 s, 60-65℃, 40-60 s, 30-35 cycles; 60-70℃, 4-6 min, 1 cycle for complete extension.

8. The application of SNP molecular markers related to slash pine pulp as described in claim 5, characterized in that, In step (2), the PCR amplification reaction program is as follows: 94℃, 3min, 1 cycle for pre-denaturation; 94℃, 15s, 60℃, 50s for extension, 30 cycles; 60℃, 4min, 1 cycle for complete extension.

9. The application of SNP molecular markers related to slash pine pulp as described in claim 8, characterized in that, In step (2), after amplification, the obtained PCR products are detected and recovered by agarose gel electrophoresis; the concentration of agarose gel in the agarose gel electrophoresis detection is 1.2%; the gel is recovered using the AxyPrep DNA Gel Recovery Kit.

10. The application of SNP molecular markers related to slash pine pulp as described in claim 5, characterized in that, In step (3), if the genotype of the SNP molecular marker S1_641460596 in the target DNA fragment obtained by PCR amplification is GA or AA, then the wood fiber length trait of the slash pine to be identified is short. If the genotype of the SNP molecular marker S1_641460596 in the target DNA fragment obtained by PCR amplification is GG, then the wood fiber length trait of the slash pine to be identified is long, and the slash pine to be identified is determined to be a high-quality pulpwood slash pine.

Citation Information

Cited By

  • Method and system for predicting slash pine wood property related traits based on combination of marker pre-selection and genome selection of whole genome association analysis

    CN122024833A