SNP molecular marker combination for identifying gender of torreya grandis and application of SNP molecular marker combination

By developing SNP molecular marker combinations for Torreya grandis and utilizing PCR amplification and sequencing technologies, rapid sex identification of Torreya grandis seedlings was achieved, solving the problems of long breeding cycles and high costs, and improving breeding efficiency and economic benefits.

CN121249958APending Publication Date: 2026-01-02ZHEJIANG FORESTRY UNIVERSITY
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202511752430.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-26
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Existing technologies lack effective means to identify the sex of Torreya grandis plants in the early stages, resulting in long breeding cycles and high costs. Furthermore, the lack of a reasonable allocation of male and female plants limits the efficiency of Torreya grandis cultivation and the progress of genetic breeding.

Method used

A combination of three SNP molecular marker sites, SNP1, SNP2 and SNP3, was developed. By designing specific primers for PCR amplification and sequencing, the sex of Torreya grandis seedlings or asexually propagated seedlings can be rapidly identified. Primer pairs and kits are provided to achieve accurate determination of sex.

Benefits of technology

It has greatly shortened the breeding cycle, saved breeding costs, enabled precise screening and rational allocation of male and female plants, improved pollination efficiency and seed yield, provided a molecular basis for Torreya grandis breeding and cultivation, and supported germplasm resource protection and precision forestry management.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121249958A_ABST
    Figure CN121249958A_ABST
Patent Text Reader

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker combination for identifying the gender of torreya grandis and application of the SNP molecular marker combination in the technical field of molecular identification of plant species. The SNP molecular marker combination comprises three SNP molecular marker sites, namely SNP1 (Single Nucleotide Polymorphism), SNP2 and SNP3 (Single Nucleotide Polymorphism); the SNP1 site is located at the 200th basic group of the nucleotide sequence as shown in SEQ ID NO.1, and the genotype is C or T; the SNP2 site is located at the 200th basic group of the nucleotide sequence as shown in SEQ ID NO.2, and the genotype is C or A; the SNP3 site is located at the 200th basic group of the nucleotide sequence as shown in SEQ ID NO.3, and the genotype is A or G; when SNP1, SNP2 and SNP3 are TCA combinations, the Chinese torreya is male, otherwise, the Chinese torreya is female. By detecting the base difference of the three specific SNP loci, accurate early determination of the gender of the torreya grandis seedlings is realized, so that the breeding period is remarkably shortened, and the breeding cost is reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular identification technology for plant species, specifically to a combination of SNP molecular markers for identifying the sex of Torreya grandis and its application. Background Technology

[0002] Torreya grandis ( Torreya grandis The seeds of Torreya grandis (Chinese nut) are rich in oils and nutrients, possessing high economic and medicinal value. Torreya grandis is a dioecious plant, meaning each plant has only male or female reproductive organs. This biological characteristic places special demands on its cultivation and propagation. A proper male-female ratio is fundamental to ensuring seed yield. However, in actual production, Torreya grandis typically takes more than 10 years to reach sexual maturity and exhibit distinct sex characteristics. This delayed sex manifestation significantly limits its planting efficiency and genetic breeding progress.

[0003] Currently, the sex differentiation mechanism in gymnosperms such as Torreya grandis remains poorly understood, and effective means for early identification of male and female plants are lacking. Traditional methods mainly rely on plant morphological observation or histological examination, which are time-consuming, cumbersome, and have low accuracy. However, with the development of molecular biology techniques, using DNA molecular markers for early plant sex identification has become an important direction in modern breeding. For example, in plants such as Ginkgo biloba, Hops, and Hippophae rhamnoides, studies have used methods such as genome resequencing, SNP screening, GWAS, and K-mer counting to locate sex-related genetic regions and have successfully developed various sex-specific molecular markers such as KASP, CAPS, and InDel. However, due to the large size, high heterogeneity, and complex sex determination mechanism of Torreya grandis, there is currently no systematic report on its sex-determining sites and stable molecular markers. With the release of the Torreya grandis reference genome and the maturity of high-throughput sequencing technology, conducting whole-genome resequencing, sex-related site discovery, and haplotype structure analysis is expected to overcome this research bottleneck.

[0004] Therefore, developing a set of molecular marker discovery technology system for sex differentiation in Torreya grandis will not only help to elucidate the genetic mechanism of its sex differentiation, but also be widely used in early sex screening, germplasm resource evaluation, targeted breeding and cultivation configuration optimization, which has important scientific research significance and industrial value. Summary of the Invention

[0005] The purpose of this invention is to provide a combination of SNP molecular markers for identifying the sex of Torreya grandis and its application, which solves the current technical problem of lacking an effective method for identifying the sex of Torreya grandis.

[0006] The present invention achieves the above objectives through the following technical solutions: The first object of the present application is to provide a SNP molecular marker combination for identifying the sex of Torreya grandis, which comprises three SNP molecular marker sites of SNP1, SNP2 and SNP3. The SNP1 site is located at the 200th base of the nucleotide sequence shown in SEQ ID NO. 1, and the genotype is C or T. The SNP2 site is located at the 200th base of the nucleotide sequence shown in SEQ ID NO. 2, and the genotype is C or A. The SNP3 site is located at the 200th base of the nucleotide sequence shown in SEQ ID NO. 3, and the genotype is A or G. When SNP1, SNP2 and SNP3 are in the combination of TCA, the Torreya grandis is male, otherwise it is female.

[0007] The second object of the present application is to provide a primer pair for amplifying the above-mentioned SNP molecular marker combination for identifying the sex of Torreya grandis, which is used for amplifying the molecular marker combination and is as follows: SNP1_F: GTTCACTCAAAACTTAGGCAAAGATG; SNP1_R: AATCTAGTGGACAATTAGATAATACCATTCT; SNP2_F: CTTCCCAAATTTACCAAATTTCAA; SNP2_R: GTGGATGAGATGTCTTTAGCACATG; SNP3_F: TTTTCAACCTGATGGAGAAAATATGA; SNP3_R: AATGCTTGATCTAACCATCTTTGTAATC.

[0008] The third object of the present application is to provide the application of the above-mentioned molecular marker combination or primer pair in identifying the female and male sex of Torreya grandis at the seedling stage or the stage of asexual propagation seedlings.

[0009] The fourth object of the present application is to provide a kit for identifying the female and male sex of Torreya grandis, which comprises the above-mentioned primer pair.

[0010] The fifth object of the present application is to provide a method for identifying the female and male sex of Torreya grandis by using the above-mentioned molecular marker combination, which comprises the following steps: Step S1, extracting the DNA of Torreya grandis tissue to be detected; Step S2, designing specific primers according to the SNP molecular marker combination, using the DNA of Torreya grandis tissue as a template, and performing PCR amplification by using the designed specific primers to obtain an amplification product; Step S3, sequencing the amplification product, detecting the genotype of the SNP molecular marker site, for quickly identifying the gender of Torreya grandis; When the genotypes of SNP1, SNP2 and SNP3 are TCA combination, the Torreya grandis is male, otherwise, it is female.

[0011] As a further optimization scheme of the present application, the specific primers are: SNP1_F: GTTCACTCAAAACTTAGGCAAAGATG; SNP1_R: AATCTAGTGGACAATTAGATAATACCATTCT; SNP2_F: CTTCCCAAATTTACCAAATTTCAA; SNP2_R: GTGGATGAGATGTCTTTAGCACATG; SNP3_F: TTTTCAACCTGATGGAGAAAATATGA; SNP3_R: AATGCTTGATCTAACCATCTTTGTAATC.

[0012] As a further optimization scheme of the present application, the PCR amplification reaction system is as follows: the total volume of the reaction is 25.0 µL, containing 1.0 µL of template DNA, 1 µL of forward primer and reverse primer respectively, 12.5 µL of DNA polymerase and 9.5 µL of ddH2O.

[0013] As a further optimization scheme of the present application, the PCR amplification reaction condition is as follows: denaturation at 95℃ for 3 min, followed by 35 cycles, each cycle including 95 ℃ for 15 s, 58 ℃ for 15 s and 72 ℃ for 30 s, finally extension at 72 ℃ for 5 min.

[0014] The present application has the following beneficial effects: The sex molecular marker developed by the application can determine the sex by three SNP sites directly at the seedling stage or the asexual propagation seedling stage of torreya grandis, avoids the problem that the sex cannot be identified until the sex matures for more than 10 years in the traditional way, greatly shortens the breeding cycle, and saves the breeding cost. The sex molecular marker developed by the application can be used for accurately screening female and male plants in the breeding and afforestation process, realizing reasonable proportioning, improving pollination efficiency and seed yield, and is a key technical link for improving the economic benefit of torreya grandis. The sex determination region and the candidate functional gene identified by the application provide a molecular basis and theoretical support for further studying the genetic mechanism and the reproductive development regulation network of sex differentiation of torreya grandis, and also have a reference significance for studying the sex determination mechanism of other gymnosperms. The application result can be widely applied to seedling screening, germplasm resource protection and selection, cultivation structure optimization, and precise forestry management, and has good industrial transformation potential and economic benefit. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 Distribution diagram of significant SNP alleles related to sex on chromosome 10 of torreya grandis; Figure 2 Genotype and electrophoresis result diagram of SNP sites under sex grouping of torreya grandis; Figure 3 Comparison diagram of amplification sequences and reference sequences of SNP1 sites of 10 male trees and 10 female trees of torreya grandis; Figure 4 Comparison diagram of amplification sequences and reference sequences of SNP2 sites of 10 male trees and 10 female trees of torreya grandis; Figure 5 Comparison diagram of amplification sequences and reference sequences of SNP3 sites of 10 male trees and 10 female trees of torreya grandis. DETAILED DESCRIPTION

[0016] It is necessary to point out here that the following detailed description is only used to further illustrate the application, and cannot be understood as limiting the protection scope of the application, and the skilled in the art can make some non-essential improvements and adjustments to the application according to the above application content.

[0017] Example 1. Obtaining of SNP molecular marker sites To genotype the SNPs of female and male individuals, first, low-quality resequencing reads were removed using Fastp (v.0.23.2) with default parameters. Then, clean resequencing fragments from 30 female and 30 male samples were aligned to the female reference genome.

[0018] In the process of genome alignment, the female was used as the reference genome, and the CPU-accelerated variant calling tool-Sentieon was used. BWA-MEM and Sort tools were used for alignment and sorting, respectively, and the Sentieon Haplotyper algorithm was used for single-sample variant detection to generate single-sample gVCF files. Finally, the Sentieon Genotyper algorithm was used for joint variant detection of multiple sample gVCF files to obtain the final variant calling results.

[0019] In the aspect of variant screening, GATK was used for preliminary filtering, and the filtering criteria were: OD < 2.0, MO < 40.0, FS > 60.0, QUAL < 30.0, SOR > 3.0, MQRankSum < -12.5, and ReadPosRankSum < -8.0. Then, VCFtools was used to further filter the SNPs in the population, and only SNPs with a minor allele frequency greater than 5%, less than 80% missing data, a read depth greater than 6, and a minimum quality greater than 30 were retained. These SNPs were considered to be high-quality SNPs.

[0020] To identify gender-related candidate gene regions, a GWAS strategy was adopted, and the genomic data of 10 female and 10 male individuals of Torreya grandis were collected and analyzed in Panmugang Base, Lin'an District, Hangzhou City, Zhejiang Province. The GWAS analysis of the gender trait (female and male) was based on high-quality SNPs and analyzed using the female reference genome. We applied the mixed linear model (MLM) and GEMMA software for association analysis and calculated the P value of each SNP. Finally, we set the log10(P value) > 8 as the whole-genome significance threshold, and screened out three potential gender-associated SNP sites: 339372332 (SNP1-SEQ ID NO. 1), 355669871 (SNP2-SEQ ID NO. 2), and 360973569 (SNP3-SEQ ID NO. 3) located on chromosome 10, and the results are shown in Figure 1

[0021] Specific primers were designed based on the sequence differences of the SNP sites, and SNP molecular markers were developed. The nucleotide sequences of the specific primers are as follows: SNP1_F: GTTCACTCAAAACTTAGGCAAAGATG; SEQ ID NO. 4; SNP1_R: AATCTAGTGGACAATTAGATAATACCATTCT; SEQ ID NO. 5; SNP2_F: CTTCCCAAATTTACCAAATTTCAA; SEQ ID NO. 6; ​SNP2_R: GTGGATGAGATGTCTTTAGCACATG; SEQ ID NO. 7; SNP3_F: TTTTCAACCTGATGGAGAAAATATGA; SEQ ID NO. 8; SNP3_R: AATGCTTGATCTAACCATCTTTGTAATC; SEQ ID NO. 9.

[0022] Example 2. Identification of female and male Torreya grandis 1. Sample collection and DNA extraction (1) Sampling and preservation: 10 fresh and tender leaves of female Torreya grandis and 10 fresh and tender leaves of male Torreya grandis were collected in Panmugang base of Lin'an district, Hangzhou city, Zhejiang province, and then frozen in liquid nitrogen and stored in a -80 °C refrigerator; (2) Extraction and preservation of leaf genomic DNA: 100-200 mg of frozen leaf tissue was placed in a 2 ml EP tube containing 2 steel balls, and then ground into fine powder in liquid nitrogen using a sample grinder. The FastPure® Plant DNA Isolation Mini Kit produced by Nuoyuan Company was used to extract DNA, and the specific extraction steps were performed according to the manufacturer's operation instruction. The DNA was stored at -20 °C.

[0023] 2. Amplification According to the following specific primers: SNP1_F: GTTCACTCAAAACTTAGGCAAAGATG; SNP1_R: AATCTAGTGGACAATTAGATAATACCATTCT; SNP2_F: CTTCCCAAATTTACCAAATTTCAA; SNP2_R: GTGGATGAGATGTCTTTAGCACATG; SNP3_F: TTTTCAACCTGATGGAGAAAATATGA; SNP3_R: AATGCTTGATCTAACCATCTTTGTAATC.

[0024] The total DNA of Torreya grandis extracted was used as a template in turn, and the above-mentioned primer pairs were used for PCR amplification.

[0025] PCR amplification system:

[0026] PCR amplification program:

[0027] The PCR product was subjected to agarose gel electrophoresis to verify whether the expected target band was successfully amplified. In order to ensure clear band separation, a 1% agarose gel was used, and the electrophoresis conditions were set at 120V voltage and 20 minutes of electrophoresis time. The electrophoresis buffer containing ethidium bromide was used to stain the gel in the experiment, so as to facilitate the observation of the band under ultraviolet light. After the electrophoresis was completed, it was confirmed that the size of the target band was 400bp, as shown in Figure 2 .

[0028] After the target band was confirmed, the target band in the gel was carefully cut off using a sterile blade, and it was ensured that only the part containing the target fragment was taken out. Then, the EasyPure Gel Reextraction Kit was used to recover the gel according to the manufacturer's operation instruction, including dissolving, purifying and concentrating the DNA, so as to ensure that the recovered PCR product has sufficient purity and concentration, and is suitable for subsequent sequencing analysis.

[0029] After the concentration of the recovered DNA product was determined, it was sent to a sequencing company for first-generation sequencing analysis. In the sequencing process, the standard Sanger sequencing method was used to ensure that accurate and reliable sequence data was obtained. The DNA amplification band pattern and the subsequent sequencing alignment results (Fig. 3) Figure 2 ) can further distinguish the male and female traits of Torreya grandis.

[0030] The obtained sequencing results were imported into the SnapGene software for sequence analysis. Through alignment analysis, the 200th base site was accurately located, and the base information corresponding to the position was viewed. The software clearly showed whether the base at this position in the sequencing result was consistent with the base in the reference sequence, and the results are shown in Figures 3-5 . The 200th base of SNP1 site of all male Torreya grandis is T, the 200th base of SNP2 site is C, and the 200th base of SNP3 site is A, so the feasibility of the molecular marker of the application is verified.

[0031] The combination of the three SNP sites is closely linked or co-segregated with the male and female traits of Torreya grandis, and can be used as a molecular marker for molecular detection of the male and female traits of Torreya grandis. It can also be used for genetic background analysis of Torreya grandis, and for molecular marker assisted selection breeding of the male and female traits of Torreya grandis, and has a broad application prospect.

[0032] The above examples only express several embodiments of the present application, and the description is more specific and detailed, but it cannot be understood as limiting the scope of the patent of the present application. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which are all within the protection scope of the present application.

[0033] SEQUENCE LISTING (this page is not submitted on paper, the sequence listing is submitted electronically via EFS-Web as an ASCII text file) Applicant: ZHEJIANG AGRICULTURAL UNIVERSITY Title: SNP molecular marker combination for identifying torreya grandis gender and application thereof Inventors: WU Jiasheng, GENG Xin, WU Xiaopei, DONG Chuan, LOU Heqiang, JIANG Chenhao, ZHANG Chengjun SEQ ID NO. 1 Type: DNA Source: Torreya grandis Torreya grandis ) GTTCACTCAAAACTTAGGCAAAGATGAACATCCTATCACTTTCATGAGCACAAACTTGAAGGATGCATATTTTAAGTATTACACTTTGGACAAGCATGATTATTCCTTATTTAAGGTTGTGAATAAATTTAAACAATACATTCTCAAAAATAAAGTGCACGCCATCATCCCAGACCTGACTGTGAAGCTTATGCTAGGGTAGAATAAACTAGGAGAACACAGAGGTTGATGGATAGACAAGGTACAATAATATGACCTAGAAATAAAATCTATCAATCTAGTTAGAGGCCAAGGTCTTACTCAATTAACCATTAAAACTGATCGAAGGATCACAAAGGTGAATTTAGATCAATCAAAAATGTTATAGTAAGAATGGTATTATCTAATTGTCCACTAGATT SEQ ID NO. 2 Type: DNA Source: Torreya grandis Torreya grandis ) CTTCCCAAATTTACCAAATTTCAAAGTAAGGAGGATCCCCAATAACACCTAAGAGCATTTATGAATACATGCGATCTAATTACCTATGATGATTCTCTTCTACTCTAAACCTTCCTTGTGTCTTTAGTGGGACCCACATTGGAATGGTATAGTTCCATCACTAGACACTCCCTCTTTTCTTTTGCCCAACTTGTTAAAACTTTCTTGGACCATTTTACCATAAAAATATCCAAACATTTATCCATAATCGATTTATATTTTGTTCATAAATTTGAGGATGATCTCATTGTCAATTTTATTGTTCGTTGGAGAGGGTTGTTTAACCAAATATCCTTCTCTTTACCCTTACCAAATTAATTGAATTTTTTTCTTGGGCATGTGCTAAAGACATCTCATCCAC SEQ ID NO. 3 Type: DNA Source: Torreya grandis Torreya grandis ) TTTTCAACCTGATGGAGAAAATATGAAATAAAATGAATCTAGAGGTGGCCAATTGACCTTGAAGGTGTTTTGAACTTGTTTATCGCTCTCCCAGGGTCCTCGTCATCCATTTTATATGTACTGCCACTTGTATGGATAGACCTAATTCTAGGTTTTCTACAAATTTTGATGTGAATTGCAAATACAGAGGGGAATTGGTGAATGAAATCCATTAAAATAGGTCTATAGGGACTTTTTATAAATCTCCATACCCATATCTCACCATGGTTGTATATGAAAATCTTTCTATTAGATCATCCATCCTAGTCAGTCTTGAACAACACAGTGAGAAGCCAAAGTGATTGTCAAAGATTGGAAGTGAGTGTAGAGATGGATTACAAAGATGGTTAGATCAAGCATT.

Claims

1. A combination of SNP molecular markers for identifying the sex of Torreya grandis, characterized in that, The SNP molecular marker combination includes three SNP molecular marker sites: SNP1, SNP2, and SNP3. The SNP1 site is located at the 200th base of the nucleotide sequence shown in SEQ ID NO. 1, and the genotype is C or T; The SNP2 site is located at the 200th base of the nucleotide sequence shown in SEQ ID NO. 2, and the genotype is C or A; SNP3 is located at the 200th base of the nucleotide sequence shown in SEQ ID NO. 3, and the genotype is A or G. When SNP1, SNP2, and SNP3 form a TCA combination, the Torreya grandis is male; otherwise, it is female.

2. Primer pairs for amplifying the SNP molecular marker combination for identifying the sex of Torreya grandis as described in claim 1, characterized in that, The primer pair used to amplify the molecular marker combination is: SNP1_F: GTTCACTCAAAACTTAGGCAAAGATG; SNP1_R:AATCTAGTGGACAATTAGATAATACCATTCT; SNP2_F: CTTCCCAAATTTACCAAATTTCAA; SNP2_R: GTGGATGAGATGTCTTTAGCACATG; SNP3_F:TTTTCAACCTGATGGAGAAAATATGA; SNP3_R: AATGCTTGATCTAACCATCTTTGTAATC.

3. The application of the molecular marker combination as described in claim 1 or the primer pair as described in claim 2 in identifying the sex of Torreya grandis seedlings or asexually propagated seedlings.

4. A reagent kit for identifying the sex of Torreya grandis, characterized in that, Includes the primer pair as described in claim 2.

5. A method for identifying the sex of Torreya grandis using the molecular marker combination described in claim 1, characterized in that, Includes the following steps: Step S1: Extract DNA from the Torreya grandis tissue to be tested; Step S2: Design specific primers based on SNP molecular marker combinations, use Torreya grandis tissue DNA as a template, and perform PCR amplification using the designed specific primers to obtain amplification products; Step S3: Sequencing the amplified products to detect the genotype of the SNP molecular marker sites for rapid identification of the sex of Torreya grandis. When the genotypes of SNP1, SNP2, and SNP3 are TCA combinations, the Chinese torreya is male; otherwise, it is female.

6. The method according to claim 5, characterized in that, The specific primers are: SNP1_F: GTTCACTCAAAACTTAGGCAAAGATG; SNP1_R:AATCTAGTGGACAATTAGATAATACCATTCT; SNP2_F: CTTCCCAAATTTACCAAATTTCAA; SNP2_R: GTGGATGAGATGTCTTTAGCACATG; SNP3_F:TTTTCAACCTGATGGAGAAAATATGA; SNP3_R: AATGCTTGATCTAACCATCTTTGTAATC.

7. The method according to claim 5, characterized in that, The PCR amplification reaction system is as follows: the total reaction volume is 25.0 µL, containing 1.0 µL template DNA, 1 µL each of forward and reverse primers, 12.5 µL DNA polymerase and 9.5 µL ddH2O.

8. The method according to claim 5, characterized in that, The PCR amplification reaction conditions are as follows: denaturation at 95℃ for 3 min, followed by 35 cycles, each cycle consisting of 95℃ for 15 s, 58℃ for 15 s and 72℃ for 30 s, and finally extension at 72℃ for 5 min.

Citation Information

Patent Citations

  • Specific primers and screening method for EST-SSR (Express Sequence Tag-Simple Sequence Repeat) marker of torreya grandis transcriptome sequence

    CN107287288A

  • Specific molecular marker TGMI001 applied to sex determination of torreya grandis at seedling stage

    CN108165652A

  • Molecular marker primer combination for rapid high-throughput identification of sex traits of torreya grandis and application thereof

    CN111304356A

  • Genetics of gender discrimination in date palm

    US20140208449A1

  • SNP molecular marker for identification of sex of osteoglossum bicirrhosum, and use thereof

    WO2022134451A1