Application of ZmNAL4 gene or encoded protein thereof in regulation and control of leaf morphology and plant height of plant

Abstract

The invention belongs to the technical field of molecular genetics, and particularly relates to an application of a ZmNAL4 gene or an encoded protein thereof in regulation and control of leaf morphology and plant height of a plant. The analysis of the expression mode of the flavin monooxygenase gene ZmNAL4 in amphiphilic and transgenic plants shows that the leaf width of an overexpression strain is increased by 13.2% and the plant height is increased by 14.8% compared with that of a gene editing strain, and the leaf area and the plant height of an arabidopsis overexpression plant are obviously higher than those of a wild plant, so that the ZmNAL4 has a positive regulation effect on the leaf width; interaction protein analysis identifies that density-tolerant response factors Zmfdx1 and Zmfdx2 and leaf included angle candidate genes ZmPDHE1 and ZmNAL4 interact with each other; plant endogenous hormone analysis shows that the ZmNAL4 regulates and controls the leaf form and the plant height by influencing an auxin signal and a brassinolide path; gene resources and theoretical basis are provided for research on density-tolerant plant types with reasonable leaf widths of corn, and the method has important significance on density-tolerant high-yield breeding.

Description

Technical Field

[0001] This invention belongs to the field of molecular genetics technology, and specifically relates to the regulation of plant leaf morphology and plant height. Background Technology

[0002] Leaf configuration has a significant impact on light energy utilization in the maize canopy, planting density, and grain yield. Among these, leaf width, as a key morphological indicator, can influence planting density and yield by regulating leaf morphology and plant type. A suitable leaf width for a densely planted maize plant type is beneficial for improving the ideal plant type, increasing the leaf area index, reducing the shade avoidance response of plants, minimizing competition among individuals, and increasing the overall yield under dense planting conditions.

[0003] The core path to improving maize yield lies in overcoming the synergistic limitations of planting density and varietal tolerance to high density. Leaves are the primary organs for light capture and photosynthesis in maize, and are a major component of the ideal plant architecture for high-density tolerant maize. Leaf structure plays a crucial role in enhancing canopy photosynthesis, planting density, yield, and stress resistance. As a typical C4 high-light-efficiency crop, maize can achieve efficient capture and distribution of canopy light resources through the plasticity of leaf morphology. Therefore, leaf width is one of the main indicators affecting leaf morphology: while narrow leaves can increase light transmittance, they are limited by the light energy absorption threshold per unit leaf area, easily leading to insufficient photosynthetic "source" supply; while wide-leaved plants are prone to shade avoidance syndrome (SAS) under dense planting conditions, affecting photosynthetic efficiency. Therefore, the ideal leaf width phenotype needs to establish a dynamic balance between light capture capacity and light energy conversion efficiency, which promotes the final yield of maize. Therefore, analyzing the genetic regulatory network of leaf width is of great significance for improving plant architecture and increasing yield.

[0004] However, the genetic and molecular mechanisms controlling this trait remain largely unknown. Exploring maize leaf width genes and elucidating their molecular mechanisms will help elucidate the genetic regulatory network of maize leaf width, providing a theoretical basis and molecular breeding targets for optimizing planting density, increasing yield, and cultivating varieties with ideal plant types. Patent 201810108676.0 discloses a gene controlling maize leaf width. ZmNL4 And it was made public. ZmNL4An InDel locus within the gene is significantly associated with the maize leaf width trait. Molecular markers developed based on this InDel locus are used to screen for maize leaf width, and methods to reduce plant leaf width are employed through genetic engineering mutations of the ZmNL4 protein or its isoform protein. Existing research indicates that leaf width is synergistically regulated by multiple genes, but significant gaps remain in the identification and functional verification of specific key genes. This mechanistic ambiguity directly limits the precise selection of targets in molecular breeding, making it difficult for traditional breeding methods to achieve breakthroughs in plant architecture improvement efficiency. Summary of the Invention

[0005] To address the above problems, this invention proposes a... ZmNAL4 Application of genes or their encoded proteins in regulating plant leaf morphology and plant height.

[0006] The technical solution of this invention is implemented as follows: This application focuses on maize genes. ZmNAL4 Functional analysis, as a regulatory factor with unknown function, reveals the system's findings. ZmNAL4 Identifying the biological mechanisms regulating leaf development, combined with interaction network analysis to pinpoint key targets, will help reveal the genetic regulatory network for wide leaf formation in maize and elucidate the molecular basis of narrow leaf development. This will provide important genetic resources and theoretical support for germplasm innovation and plant type improvement breeding in densely planted maize.

[0007] On the one hand, the present invention provides ZmNAL4 Application of genes or their encoded proteins in regulating plant leaf morphology and plant height.

[0008] Preferably, the plant is maize or Arabidopsis thaliana; the leaf morphology is the width of the plant leaf.

[0009] Preferably, the above regulation is overexpression. ZmNAL4 Genes that increase leaf width and plant height; knockout ZmNAL4 Genes reduce leaf width and plant height.

[0010] Overexpression vectors were constructed using homologous recombination, and primers were designed by selecting SmaI and SacI double restriction sites. ZmNAL4 -UbiF and ZmNAL4 -UbiR, to sequence the correct T- ZmNAL4 Using plasmids as templates, PCR products were detected by electrophoresis and then recovered via gel extraction. The Ubi circular vector was digested with SmaI and SacI restriction endonucleases. The digestion products were detected by electrophoresis and then recovered via gel extraction. Homologous recombination of the target gene fragment with the linearized vector was performed. The resulting recombinant product was transformed into dH5α competent cells, and single clones were selected for colony PCR. Plasmids were extracted from the bacterial colonies with correct sequencing results to obtain Ubi- ZmNAL4 Overexpression vector.

[0011] Using Cas9- ZmNAL4 Normal working solution concentration of F1 / R1 primers (10 µM), Cas9- ZmNAL4 The F2 / R2 primers should be diluted to 0.05 µM before use. PCR amplification is performed using the pCBC-MT1T2 plasmid as a template. After amplification, the PCR products are detected by agarose gel electrophoresis and then recovered. E. coli transformation is performed, single clones are picked and identified by colony PCR. Correctly sequenced colonies are amplified, plasmids are extracted, and stored at -20℃ for later use. pBUE411- ZmNAL4 The fusion expression vector was used to transform Agrobacterium (EHA105) competent cells. After the bacterial culture was identified as correct, maize genetic transformation was performed.

[0012] Preferably, the above ZmNAL4 The gene's Gene ID in NCBI is LOC103652784.

[0013] Preferably, the amino acid sequence of the encoded protein is shown in SEQ ID No. 1.

[0014] Secondly, the present invention also provides a method for cultivating transgenic plants, characterized by the following steps: (1) If construct ZmNAL4 Gene overexpression vectors, when transferred into plants via Agrobacterium-mediated transformation, can produce transgenic plants with increased leaf width and plant height. (2) If the knockout is constructed ZmNAL4 When the CRISPR / Cas9 gene editing vector is transferred into plants via Agrobacterium-mediated transformation, transgenic plants with reduced leaf width and plant height are obtained.

[0015] Ubi- ZmNAL4 After transferring Agrobacterium competent cells and confirming the bacterial culture was correct, maize genetic transformation was performed. Ubi- ZmNAL4 After introducing Agrobacterium competent cells and confirming the bacterial culture was correct, Arabidopsis thaliana genetic transformation was performed.

[0016] Preferably, the above ZmNAL4 The gene's Gene ID in NCBI is 103652784.

[0017] Preferably, the plant is maize or Arabidopsis thaliana.

[0018] After screening, 13 were finally selected. ZmNAL4 Overexpression of T3 positive transgenic lines and 5 ZmNAL4The gene-edited T3-positive transgenic lines were obtained. Measurements showed that the average leaf width of the overexpressing maize lines was 8.6 cm, while the average leaf width of the CRISPR / Cas9 gene-edited maize lines was 7.6 cm, representing a 13.2% increase in average leaf width compared to the CRISPR / Cas9 gene-edited lines. Simultaneously, the average plant height of the overexpressing lines was 168.6 cm, while the average plant height of the gene-edited lines was 146.8 cm, representing a 14.8% increase in average plant height compared to the gene-edited lines.

[0019] Gene ZmNAL4 Overexpression significantly promoted leaf expansion and plant height increase, while CRISPR / Cas9-mediated gene editing may have disrupted its function, leading to a weakened phenotype. These results indicate that the gene... ZmNAL4 It positively regulates maize leaf width and also affects traits such as plant height, providing a basis for analyzing the biological function of this gene and its application in plant type improvement.

[0020] After obtaining homozygous T3 generation Arabidopsis seeds, they were planted, and their phenotypes were measured and compared with wild-type Arabidopsis. Measurements revealed that the leaf area of ​​the overexpressing line was significantly higher than that of the wild-type Arabidopsis, indicating the presence of the overexpressed gene. ZmNAL4 This leads to increased leaf area and plant height in Arabidopsis thaliana, indicating that the genes... ZmNAL4 It can positively regulate the size of Arabidopsis thaliana leaves.

[0021] Endogenous hormone analysis showed that the contents of auxin and brassinolide (BL, 6DCS) were closely related to changes in leaf morphology. (The text then abruptly shifts to a seemingly unrelated topic: "Constructing 1304-...") ZmNAL4 After the binary expression vector was transformed into Arabidopsis thaliana, the target gene was found to... ZmNAL4 The main expression sites in Arabidopsis thaliana are leaves, young roots, calyx, and stigma. Intracellular expression analysis revealed... ZmNAL4 It is mainly expressed in mitochondria. Cross-sections and longitudinal sections of leaf cells from F2 broad-leaved and narrow-leaved plants revealed that the leaf cells of the broad-leaved plants had a larger area and were more loosely arranged, with an average size 15.97% larger than those of the narrow-leaved plants. These results indicate that... ZmNAL4 Genes positively regulate leaf width by controlling the expression level of mRNA.

[0022] The present invention has the following beneficial effects: 1. The present invention proposes ZmNAL4 The gene is located on chromosome 4 of maize. The cloned CDS sequence is 1605 bp in length and encodes 534 amino acids. ZmNAL4The protein is stable, resistant to degradation, and belongs to the hydrophilic protein family. It encodes a flavin-containing monooxygenase (FMO). This gene belongs to the YUCCA branch of the FMO family. A total of 18 FMO genes have been identified at the whole-genome level in maize, distributed on all but chromosome 5. ZmFMOs Genes are relatively conserved during evolution.

[0023] 2. This application concerns genes. ZmNAL4 Analysis of the gene's expression patterns in both parents and transgenic plants showed that it positively regulates the width of maize leaves; in Arabidopsis, it was also mainly expressed in leaves, young roots, calyx, and stigma. Analysis of endogenous plant hormones revealed that changes in the levels of auxin (IAA) and brassinolide (BL, 6DCS) were closely related to changes in leaf morphology, indicating that leaf morphology and plant height are regulated through the auxin signaling pathway; subcellular localization results showed... ZmNAL4 It is located in the mitochondria.

[0024] 3. This application utilizes transgenic and knockout technologies to construct overexpression and CRISPR / Cas9 gene editing vectors. Genetic complementation verification in maize revealed that the overexpression lines had a 13.2% greater leaf width and a 14.8% greater plant height than the gene-edited lines. Furthermore, the leaf area and plant height of the Arabidopsis overexpression plants were significantly higher than those of the wild-type plants, proving... ZmNAL4 It plays a positive regulatory role in leaf width.

[0025] 4. This application identified the density tolerance response factors Zmfdx1 (GRMZM2G122337) and Zmfdx2 (GRMZM2G048313), as well as a candidate gene for leaf angle, through interaction protein analysis. ZmPDHE1 (GRMZM2G043198) and ZmNAL4 interaction. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0027] Figure 1 for ZmNAL4 Gene PCR amplification.

[0028] Figure 2 for ZmNAL4 Gene sequence differences.

[0029] Figure 3This study describes the dynamic development of leaf width and length in both parents.

[0030] Figure 4 for ZmNAL4 Expression analysis at different stages in leaves, roots, stems, shoot apical meristem (SAM), and grains.

[0031] Figure 5 The leaf phenotype and hormone content of the parents and F2 broad-leaved and narrow-leaved plants.

[0032] Figure 6 pCAMBIA-1304- ZmNAL4 Construction of binary expression vectors.

[0033] Figure 7 For the target gene ZmNAL4 Tissue-specific expression.

[0034] Figure 8 Longitudinal (left) and transverse (right) sections of leaf cells from F2 broad-leaved and narrow-leaved plants.

[0035] Figure 9 for ZmNAL4 The subcellular localization results are shown in the figure.

[0036] Figure 10 For Ubi- ZmNAL4 Overexpression vector construction.

[0037] Figure 11 Construction of CRISPR / Cas gene editing vectors.

[0038] Figure 12 for ZmNAL4 Construction of decoy expression vectors.

[0039] Figure 13 for ZmNAL4 Statistical graph of leaf width and plant height of overexpressing and knockout plants.

[0040] Figure 14 for ZmNAL4 Genetically transformed lines, of which OE is an overexpression line and CR is a CRISPR / Cas9 gene-edited transgenic line.

[0041] Figure 15 for ZmNAL4 The size of transgenic Arabidopsis plants and their leaves.

[0042] Figure 16 for ZmNAL4 Comparison of leaf area between overexpressing Arabidopsis thaliana and wild-type Arabidopsis thaliana.

[0043] Figure 17 for ZmNAL4 Interacting yeast plaques obtained by screening yeast libraries.

[0044] Figure 18 Electrophoresis image for PCR identification of interacting yeast plaques obtained through screening.

[0045] Figure 19 for ZmNAL4 and fdx1 , fdx1 and PDHE1 Figure showing the results of yeast two-hybrid interaction.

[0046] Figure 20 for ZmNAL4 and fdx1 The results of the BiFc interaction are shown in the figure.

[0047] Figure 21 for ZmNAL4 and PDHE1 The results of the BiFc interaction are shown in the figure.

[0048] Figure 22 for ZmNAL4 and fdx2 The BiFcc interaction results are shown in the figure. Detailed Implementation

[0049] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0050] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0051] Plant materials: The maize materials were the narrow-leaf mutant line NL409 (foreign germplasm) and the domestic germplasm improvement line WB665, which were cultured in an artificial climate long-day incubator (28℃, 16 h light / 8 h dark). Several disease-free and intact maize seedling leaves were harvested, rinsed with distilled water to remove surface dirt, placed in sterile centrifuge tubes, put into a small liquid nitrogen tank, and stored in a laboratory freezer at -80℃.

[0052] The primer sequences used in this application are shown in Table 1.

[0053] Table 1 Primer sequences used in this application Data was processed using Excel 2010, charts were created using Graphpad Pism 9.5 and Origin 2022, and SPSS 22 was used to analyze whether there were significant differences in the data. Statistical analysis was performed using... t test,* p ≤0.05 and ** p ≤0.01 indicates significance.

[0054] Example 1: ZmNAL4 Gene cloning and bioinformatics analysis (1) ZmNAL4 The gene clone was downloaded from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ) for corn. ZmNAL4 The CDS sequence of the gene (LOC103652784) was obtained, and specific primers were designed according to the basic principles of primer design as follows: ZmNAL4 -cdsF:CAGCCACACGCACTTTTTTTT; ZmNAL4 -cdsR:ACATTCGCCACAGTTTCATTA.

[0055] The obtained plant cDNA was used as a template for amplification and recovery. The electrophoresis result of the obtained PCR product was consistent with the prediction, being 1605 bp. Figure 1 A). After recovering the target band, it was ligated into the T vector, identified by bacterial culture PCR, and the sequencing results are as follows. Figure 1 As shown in B.

[0056] (2) DH5α competent cell transformation and bacterial culture detection Two μL of positive monoclonal bacterial culture was used as a template for bacterial culture PCR identification. The reaction system is shown in Table 2. Bacterial cultures with bright bands and correct size were selected and sent to the company for sequencing. After the sequencing results were correct, 15-30 μL of bacterial culture was taken for amplification and plasmid extraction. The remaining bacterial culture was added to glycerol and stored at -80℃.

[0057] Table 2. Bacterial PCR system (25 μL) The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 20 s, 60℃ annealing for 20 s, 72℃ extension for 45 s, 35 cycles, and 72℃ final extension for 5 min.

[0058] (3) Extraction of plasmids Plasmid extraction was performed using Omega Bio-Tek's EZNA. ®Plasmid Mini Kit I plasmid rapid extraction kit.

[0059] (4) ZmNAL4 Bioinformatics analysis of gene families The whole genome sequences, amino acid sequences, and genome annotation files of gene families such as maize and Arabidopsis were downloaded from the NCBI database (www.ncbi.nlm.nih.gov). Bioinformatics software was used for prediction and analysis. Preliminary analysis of the genomes of both parents and F2 segregating individuals... ZmNAL4 Sequence differences ( Figure 2 In the figure, F2N represents narrow-leaved segregating plants from the F2 population, and F2W represents broad-leaved segregating plants. The results showed that the target gene... ZmNAL4 The gene is 1605 bp in size, encodes 543 amino acids, and contains 4 exons. In the mutant line NL409, the coding region of this gene is missing 8 bases, which is consistent with the genotype of narrow-leaved segregating plants in the F2 population; while the gene sequence of WB665 is consistent with the genotype of broad-leaved plants in the F2 population.

[0060] Example 2: ZmNAL4 Gene expression analysis Plant materials: Roots, stems (coleoptiles), leaves, apical meristem (SAM), and seeds from NL409 and WB665 plants at the 3-17 leaf stage were selected for expression pattern analysis. Leaves from the parents (NL409, WB665) and F2 isolates at the 7-leaf and 9-leaf stages were selected for phenotypic measurements and endogenous hormone content determination. Leaf length was measured from the base of the ligule to the leaf tip, and leaf width was measured at the widest point of the leaf. GUS staining analysis was performed on Arabidopsis seedlings at the seedling and flowering stages. Paraffin sections were prepared from 9-leaf stage maize leaves from F2 isolates. The Arabidopsis thaliana variety used in the experiment was the Columbia ecotype.

[0061] Strains and vectors: Strains: Agrobacterium competent cells GV3101; Vectors: pCAMBIA-1304 binary expression vector.

[0062] 1. ZmNAL4 Spatiotemporal expression pattern analysis of genes Real-time quantitative PCR was performed according to the instructions for Hieff qPCR SYBR Green Master Mix (No Rox) (Yisheng Biotechnology, 11201ES08), using cDNA from different tissue samples at different time points as templates. ZmNAL4 -qF and ZmNAL4-qR was used as primer for qRT-PCR. To normalize the measured gene expression levels, the internal reference gene was maize 18S rRNA (LOC111590468). The primer sequences 18sF and 18sR are shown in Table 1, and the reaction system is shown in Table 3. Table 3. Quantitative PCR system (20 μL) The reaction program was 95℃ for 3 min, 95℃ for 10 s, and 60℃ for 15 s, with fluorescence signal acquisition performed (for a total of 42 cycles). When analyzing quantitative data, a relative quantification method is used, specifically: ① ΔCt Calibration sample = Sample gene - Internal reference gene; ② ΔCt Test sample = Sample gene - Internal reference gene; ③ ΔCt = ΔCt Calibration Samples - ΔCt The sample to be tested; ④ Relative expression level = 2 -ΔΔCt .

[0063] Analysis of target genes ZmNAL4 Phenotypic changes in leaf width and leaf length of maize parents at the 4-17 leaf stage were observed. Figure 3 The leaf width of NL409 stabilized at the 10-leaf stage, while that of WB665 stabilized at the 13-leaf stage. From the 4-leaf stage onwards, the leaf width of WB665 was greater than that of NL409, and the difference gradually increased. Before the 11-leaf stage, the leaf length of NL409 was consistently greater than that of WB665. After the 11-leaf stage, the leaf length of WB665 was longer than that of NL409, but the overall difference was not significant.

[0064] Combined with target gene ZmNAL4 Spatiotemporal expression patterns in roots, stems, leaves, and shoot apical meristems (SAM) of maize parents at the 3-17 leaf stage ( Figure 4 ), discover the target gene ZmNAL4 The gene is expressed in all of the above organs or tissues, but with significant differences. The highest expression level is found in leaves, followed by roots and stems, while the lowest expression level is found in the shoot apex meristem. ZmNAL4 Expression levels were low in female ears at the 17-leaf stage before pollination (17c), peaked 7 days after pollination (7z), and then declined continuously. Target gene ZmNAL4 The expression levels of the broad-leaved parent WB665 were significantly higher than those of the narrow-leaved parent NL409 in different materials, at different stages, and in different parts of the plant, and the expression trends were basically consistent in the two materials. During the 3-7 leaf stage, the expression levels in the leaves... ZmNAL4 The expression level gradually increased, and the difference between the parents WB665 and NL409 gradually increased; during the 7-14 leaf stage, ZmNAL4The expression level remained high in the broad-leaved parent WB665, gradually decreasing after the 14-leaf stage, and decreasing after the 7-leaf stage. ZmNAL4 The expression level in the narrow-leaved parent NL409 decreased rapidly and remained at a low level after the 10-leaf stage. These results indicate... ZmNAL4 Genes positively regulate leaf width by controlling the expression level of mRNA.

[0065] 2. Analysis of endogenous hormone levels The content of endogenous hormones in plants was determined using a one-step sandwich enzyme-linked immunosorbent assay (ELISA) with double antibodies. The kit was provided by Shanghai Jingkang Biotechnology Co., Ltd. ELISA results were calculated using logit curves. The x-axis of the curve represents the natural logarithm of each concentration (ng / mL) of the hormone standard, and the y-axis represents the logit value of each concentration.

[0066] Analysis of leaf phenotypes (leaf width, leaf length, leaf area) of the parents and F2 broad-leaved and narrow-leaved plants revealed a positive and significant correlation between leaf width and leaf area in the parents and F2 segregated plants. Figure 5 Analysis of the changes in the content of plant endogenous hormones indole-3-acetic acid (IAA), gibberellic acid (GA), jasmonic acid (JA), and three subtypes of brassinolide (BL, CS, and 6DCS) in parental and F2 segregating plants revealed that the changes in the content of IAA, BL, and 6DCS were closely related to leaf morphology. Figure 5 The IAA content in broad-leaved parent plants WB665 and F2 was higher than that in narrow-leaved plants NL409 and F2. The changes in BL and 6DCS content were consistent with the changes in IAA hormone content.

[0067] 3. Constructing a binary expression carrier The plant binary expression vector pCAMBIA-1304 integrates a dual reporter system of GUS (β-glucuronidase) and GFP (green fluorescent protein). A vector for GUS staining and subcellular localization assays was constructed, and homologous recombination primers containing NcoI and SpeI restriction sites were designed (Table 1) to sequence the correct T-... ZmNAL4 The plasmid was used as a template to amplify the target fragment. The PCR products were detected by electrophoresis on a 1.2% agarose gel and then recovered from the gel. The pCAMBIA-1304 circular vector was digested with NcoI and SpeI restriction endonucleases, as shown in Table 4. The program was 37℃ for 30 min.

[0068] Table 4. Vector digestion system (12 μL) The enzyme digestion products were detected by agarose gel electrophoresis and then recovered from the gel. Hifair Clone was used. ® The Plus OneStep Cloning Kit performs homologous recombination between the target gene amplification fragment and the linearized vector, and prepares the following systems on ice (Table 5): Table 5. Homologous recombination system (10 μL) Note: X and Y are the linearized vector and insert fragment amounts calculated according to the formulas, respectively. Optimal linearized vector amount = [0.02 × number of vector base pairs] ng (0.03 pmol), optimal insert fragment amount = [0.04 × number of insert fragment base pairs] ng (0.06 pmol).

[0069] The recombinant product was transformed into *E. coli*. Single clones were picked for culture PCR. Plasmids were extracted from the bacterial cultures with correct sequencing results to obtain 1304- ZmNAL4 Integration of expression carriers.

[0070] The plasmids used in the subcellular localization assay were concentrated according to the following steps: (1) Collect a large amount of extracted plasmids in the same centrifuge tube, add 0.1 times the volume of 3 M sodium acetate to the plasmid, then add 0.8 times the volume of isopropanol to the plasmid, shake to mix, and let stand for 30-60 min. (2) Centrifuge at 12000 rpm for 10 min at room temperature and discard the supernatant; (3) Add 0.6-1 mL of 75% ethanol, gently rotate the centrifuge tube to wash away the impurities on the tube wall; (4) Add an appropriate amount of anhydrous ethanol, wash again, centrifuge for 2 min and discard the supernatant again.

[0071] With the correct T- sequencing ZmNAL4 Using plasmids as templates, primers ZmNAL4 -1304F / R amplification ZmNAL4 The coding region sequence, Figure 6 A is ZmNAL4 Gene amplification diagram; Figure 6 B is pCAMBIA-1304- ZmNAL4 Vector double enzyme digestion gel image; using HifairClone ® The Plus One Step Cloning Kit uses homologous recombinase to ligate the vector and target gene. After PCR verification, bacterial suspensions with the correct band size are sent for testing. Figure 6 C), compare the sequencing results.

[0072] 4. Agrobacterium-mediated transformation: (1) Remove Agrobacterium competent cells GV3101 from -80℃, place them on ice to thaw for 3-5 min, and add 2 μL of 1304- ZmNAL4 The plasmid was gently aspirated and mixed, and then placed on ice for 30 min. (2) After being rapidly frozen in liquid nitrogen for 5 min, it was immediately placed in a 28°C water bath for 5 min, and then immediately placed on ice for 5 min. (3) Add 700 μL of antibiotic-free LB medium, incubate at 28℃ and 160 rpm for 2-3 h for recovery; (4) Collect the bacterial cells by centrifuging at 600 rpm for 1 min at room temperature. Take about 100 μL of supernatant, gently aspirate and mix it, and spread it on LB solid medium containing kanamycin resistance. Invert the medium and incubate it in a 28℃ incubator for 2 days.

[0073] Transformation of Arabidopsis thaliana by infection: When the plant first flowers, prune the main stem flower buds (remove the top) to promote lateral branch growth and increase the number of inflorescences. After 3-5 days, select immature inflorescences that have not yet formed siliques for infection. The steps are as follows: (1) Pick a single Agrobacterium clone of the fusion expression vector and put it into 1000 µL of LB+Kan+Rif liquid medium and culture it in a shaker at 28℃ and 200 rpm for 2 days; (2) After the bacterial culture becomes turbid, the bacterial culture is expanded at a ratio of 1:50. 1000 µL of bacterial culture is transferred to 50 mL of LB+Kan+Rif liquid medium and cultured at 28℃ and 200 rpm in a shaker until the bacterial culture OD 600 The value reaches 0.8-1.0; (3) Transfer the expanded bacterial culture to a 50 mL sterile centrifuge tube and centrifuge at 5000 rpm for 10 min at room temperature until all bacterial culture is enriched. Discard the supernatant. (4) Resuspend the enriched bacterial cells in the infusion solution to 200 mL, pour into a large petri dish, add 20 µL of surfactant SilwetL-77 and mix well; (5) Under light-protected conditions, completely immerse the Arabidopsis thaliana inflorescences in full bloom in Agrobacterium suspension and rotate them slightly to ensure full contact (if the inflorescences are not completely wetted, gloves can be used to manually assist). The infection time for each plant should be controlled within 1 minute to avoid excessive damage. (6) After infection, tilt and avoid light for 24 h, then restore normal light and watering after dark treatment, and keep the soil moist.

[0074] 5. Identification and screening of transgenic Arabidopsis thaliana T0 generation seeds, surface-sterilized with 50% sodium hypochlorite solution, were vernalized (4°C, 72 hours) and then evenly inoculated onto the surface of 1 / 2 MS solid medium supplemented with 30 mg / L herbicide in a clean bench. After germination, normally growing Arabidopsis seedlings were transplanted into nutrient soil. Two weeks after transplanting, leaves were harvested for genomic DNA extraction. Positive transgenic lines were obtained through PCR identification. Once the seeds were fully mature, individual plants were isolated and harvested to obtain T1 generation germplasm. T1 generation seeds were surface-sterilized and then subjected to secondary resistance screening: sown on 1 / 2 MS medium containing herbicide, DNA was extracted from surviving seedlings, and single plants confirmed by PCR to be successfully transgenic were further cultured until full maturity, ultimately yielding T2 generation seeds. To obtain homozygous lines, T2 generation seeds were planted in herbicide-free medium, tested again, cultured, and harvested; these were the homozygous T3 generation seeds.

[0075] 6. ZmNAL4 Tissue-specific expression analysis of genes (1) GUS staining test Using GUS staining ZmNAL4 Tissue-specific expression analysis in Arabidopsis thaliana was performed using Phygene's Ready-to-use GUS Staining Solution. The specific steps were as follows: 1 mL of X-Gluc Solution was completely dissolved in one vial of X-Gluc to obtain a 50× X-Gluc Solution solution; an appropriate amount of 50× X-Gluc Solution solution and GUS Buffer were mixed thoroughly at a ratio of 1:49 to prepare the GUS staining working solution; transgenic Arabidopsis thaliana plants at the seedling and flowering stages were added to the GUS staining working solution, ensuring complete immersion, and incubated at 37°C in the dark for 12-24 hours; the samples were then immersed in 70% ethanol for 1-3 hours to thoroughly remove chlorophyll until a blue color appeared, at which point the samples were observed.

[0076] (2) Paraffin slice preparation Healthy, undamaged maize leaf tissue at the 9-leaf stage was selected, washed with distilled water, and cut into 2.0 cm × 2.0 cm pieces. After being preserved with dry ice, the tissue was sent to Henan Rainforest Education Engineering Co., Ltd. to prepare paraffin sections. Upon receiving the paraffin section samples, they were observed using an OLYMPUSBX53 research microscope.

[0077] Using GUS staining assay to target gene ZmNAL4 Tissue-specific expression analysis in Arabidopsis thaliana revealed that it is mainly expressed in rapidly growing, maturing leaves, young roots, calyx, stigma, and other sites with high mitotic activity. Figure 7It is expressed at lower levels in young leaves and stems.

[0078] Longitudinal sections of leaf cells parallel to the veins in the F2 population of broad-leaved and narrow-leaved plants showed that the leaves of broad-leaved plants were thicker than those of narrow-leaved plants, with looser cell arrangement and larger cells. The average size of leaf cells in broad-leaved plants was 17.31% larger than that in narrow-leaved plants. Transverse sections perpendicular to the veins showed that the vascular bundle density in the leaves of broad-leaved plants was lower, with sparser arrangement of vascular bundles and leaf cells. The average size of leaf cells in broad-leaved plants was 14.62% larger than that in narrow-leaved plants. Figure 8 ).

[0079] 7. Agrobacterium-mediated transfection of tobacco epidermal cells (1) Tobacco culture: Sow a number of tobacco seeds, culture under light for 12 hours, and the culture can be used for experiments after one month; (2) Agrobacterium culture: The constructed vector plasmid was transferred into Agrobacterium (GV3101) by electroporation and cultured at 30℃ for 2 days; (3) Suspended Agrobacterium: Use an inoculation loop to scrape Agrobacterium from the solid culture dish and inoculate it into 10 mL of the corresponding resistant YEB liquid medium, and culture at 170 rpm / min for 1 day; (4) Collect bacterial cells: Centrifuge at 4000 rpm / min for 4 min, and discard the supernatant; (5) Resuspension: Resuspend the bacterial cells in 10 mM MgCl2 (containing 120 μM AS) suspension and adjust OD. 600 Up to around 0.6; (6) Injection: Select tobacco plants with good growth, use a 1mL syringe with the nozzle removed to inject into the lower epidermis of the tobacco leaves, and make a label. (7) Cultivation: After injection, the tobacco plants are cultured in low light for 2 days, and then they can be observed; (8) Observation: Take the labeled tobacco leaves injected with Agrobacterium, make them into glass slides, observe them under a laser confocal microscope, and take pictures.

[0080] Note: During co-localization, the marker plasmid is transformed into Agrobacterium and suspended together with the constructed vector plasmid Agrobacterium. They are then mixed in a 1:1 ratio before injection and injected into tobacco leaves.

[0081] 8. Subcellular localization analysis Agrobacterium transfection of tobacco leaf epidermal cells revealed that the ZmNAL4 protein overlapped with the mitochondrial marker protein OsMSTP, indicating... ZmNAL4 The subcellular localization results of the gene show expression in mitochondria. Figure 9 ).

[0082] ZmNAL4The gene exhibits significant developmental stage-specific expression in maize leaves, peaking in the leaves, roots, and shoot apical meristems of both parents at the 7-leaf stage. In WB665 leaves, it shows a bimodal expression pattern (peaking at both the 7-leaf and 14-leaf stages). The 7-leaf stage typically corresponds to the early jointing stage in maize, a critical period for vegetative growth; high expression at this time indicates gene development. ZmNAL4 It participates in leaf cell proliferation and vascular bundle differentiation. The 14-leaf stage is the reproductive growth transition period of maize, usually entering the tassel differentiation stage. ZmNAL4 At this time, high expression in WB665 leaves may be involved in maintaining the photosynthetic efficiency of functional leaves, providing a carbon source for reproductive organ development, and may also... ZmNAL4 It is regulated by transcription factors specific to different developmental stages. By combining the dynamic changes in leaf width phenotype at different developmental stages of parents NL409 and WB665, genes were found... ZmNAL4 A significant positive correlation was found between the gene and leaf width expansion rate, indicating that this gene positively regulates leaf width by controlling mRNA expression levels. GUS staining and subcellular localization assays confirmed the gene's presence. ZmNAL4 It is specifically expressed in actively dividing tissues and in intracellular mitochondria. Longitudinal paraffin section analysis revealed that the increased leaf width in broad-leaved plants is primarily driven by cell expansion rather than cell division. This example elucidates the gene's expression. ZmNAL4 The spatiotemporal expression characteristics of maize at key developmental stages provide crucial experimental evidence for revealing the molecular mechanisms by which it regulates leaf morphogenesis.

[0083] Example of implementation results: ZmNAL4 Gene functional analysis Strains and vectors: Strains: dH5α Escherichia coli competent cells, EHA105 Agrobacterium competent cells, Y2H strain.

[0084] Vectors: Yeast libraries were constructed using the overexpression vector p-Ubicub, the CRISPR / Cas9 gene editing vectors pBUE411, pCBC-MT1T2, pGBKT7, pGADT7, and WB665.

[0085] 1. Construction of overexpression vectors Overexpression vectors were constructed using homologous recombination, and primers were designed by selecting SmaI and SacI double restriction sites. ZmNAL4 -UbiF and ZmNAL4 -UbiR (Table 1) to sequence the correct T- ZmNAL4 Using plasmids as templates, the target fragment was amplified according to the system and procedure in Table 1. The PCR products were then detected by electrophoresis on a 1.2% agarose gel and subsequently recovered from the gel. The Ubi circular vector was digested with SmaI and SacI restriction endonucleases. The digestion products were then detected by agarose gel electrophoresis and subsequently recovered from the gel. Hifair Clone was used for the final analysis. ®The Plus One Step Cloning Kit performs homologous recombination between the amplified target gene fragment and a linearized vector. The resulting recombination product is then transformed into dH5α competent cells. Single clones are picked for culture PCR; plasmids are extracted from the correctly sequenced bacterial cultures to obtain Ubi- ZmNAL4 Overexpression vector. Ubi- ZmNAL4 After being transferred into Agrobacterium competent cells and correctly identified as having bacterial culture, the cells were handed over to the company for maize genetic transformation. Ubi- ZmNAL4 After introducing Agrobacterium competent cells and confirming the bacterial culture was correct, Arabidopsis thaliana genetic transformation was performed.

[0086] Selecting SmaI and SacI double restriction sites, Ubi- ZmNAL4 Overexpression vectors, such as Figure 10 As shown, the Maeker used in the experiment was a DL5000. Figure 10 A is ZmNAL4 Electrophoresis gel image of target fragment amplification. Figure 10 B is the overexpression vector p-Ubicub- ZmNAL4 Double enzyme digestion gel image, Figure 10 C is for Ubi- ZmNAL4 Image of Escherichia coli culture PCR identification results. Figure 10 It can be seen that Ubi- ZmNAL4 The fusion vector met theoretical expectations, further validating the reliability of the sequencing results, and the next stage of experiments can be carried out.

[0087] 2. Construction of CRISPR / Cas9 gene editing vector (1) Log in to https: / / crispr.dbcls.jp / , delete the example sequence, and enter the target gene. ZmNAL4 For the CDS sequence, select "NGG" in the "PAM sequence requirement" section and "Corn (Zea mays) genome, AGPv4 (Mar, 2016)" in the "Specificity check" section, then click "design". In the results, check "high specificity", select "positive +", set "20mer+PAM" to 1, and GC% to 40%-60%. Select primer sequences approximately in the first 1 / 3 of the target sequence. Verify the target location using the Ensembl Plants website, avoiding exon crossings, and screen for... ZmNAL4 The shearing target points (Table 1).

[0088] (2) Amplification of sgRNA: using Cas9- ZmNAL4 Normal working solution concentration of F1 / R1 primers (10 µM), Cas9- ZmNAL4The F2 / R2 primers should be diluted to 0.05 µM before use. PCR amplification should be performed using the pCBC-MT1T2 plasmid as a template. After amplification, the PCR products should be detected by agarose gel electrophoresis and then recovered.

[0089] (3) Enzyme digestion-ligation: Prepare the reaction system in Table 6. The reaction program is as follows: 37℃, 4-5 h; 50℃, 5 min; 80℃, 10 min; 4℃, 10 min. After the program is completed, perform agarose gel electrophoresis detection, then gel recovery, E. coli transformation, pick single clones and perform bacterial PCR identification, amplify the correctly sequenced bacterial cultures, extract plasmids, and store at -20℃ for later use.

[0090] Table 6 Enzyme digestion-ligation reaction system (15 μL) pBUE411- ZmNAL4 The fusion expression vector was used to transform Agrobacterium (EHA105) competent cells. After the bacterial culture was identified as correct, it was handed over to the company for maize genetic transformation.

[0091] The sgRNA was ligated into the pBUE411-Cas9 vector, and the target band was obtained after amplification using universal primers. Figure 11 The sequencing results were in line with experimental expectations and were used for subsequent experiments. The Bar gene was identified by PCR amplification, and PCR products with the correct band size were sequenced.

[0092] 3. Construction of yeast dual-hybrid bait carrier Design primers with EcoRI and BamHI restriction sites. ZmNAL4 -KTF and ZmNAL4 -KTR (Table 1) will T- ZmNAL4 After digestion with enzymes and gel recovery of the pGBKT7 vector, the vector and target gene were ligated using T4 ligase. The reaction mixture was prepared according to Table 7. After overnight incubation at 16°C, E. coli transformation was performed. Bacterial solutions with the correct band size were sent for sequencing. Plasmids were extracted from the correct bacterial solutions to complete the pGBKT7-... ZmNAL4 Construction of decoy carriers.

[0093] Table 7. T4 ligase reaction system (10 μL) Preparation of yeast competent cells: (1) Take out the Y2H strain stored at -80℃, streak it on YPDA solid medium to propagate it, seal it and invert it in a 30℃ incubator for 3-5 days; (2) Add 50 mL of YPDA liquid culture medium to a 200 mL Erlenmeyer flask and pick out a 2-3 mm diameter plaque for inoculation; (3) Place on a shaker at 220 rpm and 30℃ for 16-18 h (if OD 600 A value >1.5 indicates normal bacterial activity. If the OD value is... 600 A value that is too low indicates a problem with the bacteria being cultured under shaking. (4) Take 15 mL of the cultured bacterial solution and add it to fresh YPDA liquid culture medium, and measure the OD of the bacterial solution. 600 Adjust the bacterial concentration to between 0.2 and 0.3, then incubate again at 220 rpm and 30°C on a shaker for 3-5 hours to allow the OD value of the bacterial solution to adjust. 600 The value reaches between 0.4 and 0.6 (i.e., the bacterial concentration doubles). (5) Transfer the cultured Y2H yeast culture to a 50mL sterile Eppendorf tube, centrifuge at 5000rpm for 3min at room temperature, and collect the yeast cells; (6) Discard the supernatant, add 25-50 mL of sterile water or sterile 1×TE to resuspend the yeast cells, centrifuge at 5000 rpm for 3 min at room temperature, discard the supernatant, and collect the yeast cells; (7) Resuspend Y2H yeast cells in 1.5 mL of freshly prepared sterile 1×TE / LiAc to obtain freshly prepared Y2H yeast competent cells.

[0094] 4. Transformation of bait plasmids: (1) Carrier DNA pretreatment: After bathing the carrier DNA in a 95°C water bath for 3 min, quickly insert it into ice; (2) Add 100 ng of the prepared pGBKT7- to a 1.5 mL sterile centrifuge tube. ZmNAL4 Add 10 μL of Carrier DNA to the bait vector plasmid DNA and gently mix. (3) Add 100 μL of Y2H yeast competent cells to the tube, shake to mix, then add 600 μL of sterile 1×PEG / TE / LiAc solution and shake to mix. (4) After incubating at 30℃ and 180 rpm for 30 min, add 50 μL of dimethyl sulfoxide (DMSO) to each tube and gently invert to mix. (5) Heat shock in a 42℃ water bath for 15 min, gently inverting and mixing every 5 min; (6) Cool on ice for 1-2 min, centrifuge at 5000 rpm for 2 min at room temperature and discard the supernatant; (7) Take 500 μL of sterile 1×TE or YPDA liquid culture medium to resuspend the yeast cells; (8) Take an appropriate amount of bacterial solution (usually 100 μL) and spread it onto an SD / -Trp medium plate. After sealing, place it in a 30℃ incubator for 3-5 days.

[0095] Figure 12 pGBKT7- ZmNAL4 Vector double enzyme digestion gel image ( Figure 12 A) pGADT7- ZmNAL4 Vector double enzyme digestion gel image ( Figure 12 B), pGBKT7- ZmNAL4 Image of PCR-positive clones transformed with E. coli ( Figure 12 C) and pGADT7- ZmNAL4 ( Figure 12 D) Identification of positive clones by PCR in transformed *E. coli* culture, further validating the sequencing results, confirming the successful construction of the bait expression vector. The constructed bait vector pGBKT7- ZmNAL4 It is transferred into yeast cells for further yeast library screening and interaction verification.

[0096] 5. ZmNAL4 Verification of genetic complementation The built ZmNAL4 Overexpression vectors and CRISPR / Cas9 gene editing vectors were transformed into Agrobacterium GV3101, and genetic transformation was carried out by Agrobacterium-mediated transformation. Maize overexpression and transgenic lines, as well as Arabidopsis overexpression lines, were screened to verify genetic complementation function.

[0097] After screening, 13 were finally selected. ZmNAL4 Overexpression of T3 positive transgenic lines and 5 ZmNAL4 The gene-edited T3-positive transgenic lines were obtained. Measurements showed that the average leaf width of the overexpressing maize lines was 8.6 cm, while the average leaf width of the CRISPR / Cas9 gene-edited maize lines was 7.6 cm. The overexpressing lines showed a 13.2% increase in average leaf width compared to the CRISPR / Cas9 gene-edited lines. Figure 13-14 Meanwhile, the average plant height of the overexpression line was 168.6 cm, while the average plant height of the gene-edited line was 146.8 cm, representing a 14.8% increase in average plant height between the overexpression and gene-edited lines. Figure 13-14 ).

[0098] ZmNAL4 Screening of positive transgenic Arabidopsis thaliana plants: After sterilizing the genetically transformed T0 generation Arabidopsis thaliana seeds with 50% sodium hypochlorite, they were inoculated on 1 / 2 MS medium containing herbicide (herbicide concentration of 35 mg / L) for screening of positive seedlings. The positive seedlings obtained after herbicide screening can grow normally, with longer stems and green cotyledons, while non-positive seedlings have yellow cotyledons or even die.

[0099] To verify ZmNAL4 To determine the success of transgenic introduction into Arabidopsis thaliana, leaves were harvested two weeks after the plants began growth. RNA was extracted, reverse transcribed into cDNA, and then tested by PCR. No bands were amplified in the WT and negative controls, while the target band was amplified in both the extracted DNA and the positive control. Once the positive plants matured, they were harvested individually to obtain T1 generation seeds. The T1 generation seeds were then disinfected and coated onto 1 / 2 MS medium containing herbicide for secondary resistance selection. DNA was extracted from surviving seedlings and identified by PCR. Single plants confirmed as successfully transgenic were harvested for T2 generation seeds. The T2 generation seeds were then planted again on 1 / 2 MS medium without herbicide, tested, and then harvested to obtain homozygous T3 generation seeds.

[0100] ZmNAL4 Phenotypic identification of transgenic Arabidopsis thaliana: After obtaining homozygous T3 generation Arabidopsis thaliana seeds, they were planted, and their phenotypes were measured and compared with wild-type Arabidopsis thaliana. The measurements showed that the leaf area of ​​the overexpressing line Arabidopsis thaliana was significantly higher than that of the wild-type Arabidopsis thaliana. Figure 15 Overexpression of the target gene ZmNAL4 This leads to an increase in leaf area and plant height in Arabidopsis thaliana. Figure 15 , Figure 16 ), indicating the target gene ZmNAL4 It can positively regulate the size of Arabidopsis leaves and the height of plants.

[0101] The target gene can be identified from the above data. ZmNAL4 Overexpression significantly promoted leaf expansion and plant height increase, while CRISPR / Cas9-mediated gene editing may have disrupted its function, leading to a weakened phenotype. These results suggest that the target gene... ZmNAL4 It may positively regulate maize leaf width and also affect other traits such as plant height, providing direct evidence for understanding the biological function of this gene and its application in plant type improvement.

[0102] 6. ZmNAL4 Screening of gene-interacting proteins (1) Save pGBKT7- ZmNAL4 Streaking of yeast culture onto SD / -Trp solid medium, incubating in the dark at 30°C for 3-5 days, then picking 2-3 mm pGBKT7- ZmNAL4 The bacterial colonies were inoculated into 20 mL of SD / -Trp liquid medium, mixed thoroughly by pipetting, and then incubated on a shaker at 220 rpm and 30°C for 16-18 h until the bacterial OD of the culture was reached. 600 Values ​​range from 1.2 to 1.6; (2) Inoculate the above bacterial culture into 50 mL of SD / -Trp liquid medium and measure the OD of the bacterial culture. 600Adjust the bacterial concentration to between 0.2 and 0.3, then incubate again at 220 rpm and 30°C on a shaker for 3-5 hours to allow the OD value of the bacterial solution to adjust. 600 The value reaches between 0.4 and 0.6 (i.e., the bacterial concentration doubles). (3) Transfer the cultured bacterial solution to a 50 mL sterile Eppendorf tube, centrifuge at 5000 rpm for 3 min at room temperature, and collect the yeast cells; (4) Discard the supernatant, add 50 mL of sterile water to resuspend the yeast cells, centrifuge at 5000 rpm for 3 min at room temperature, discard the supernatant, and collect the yeast cells; (5) Discard the supernatant, add 25 mL of sterile 1×TE solution to resuspend the yeast cells, centrifuge at 5000 rpm for 3 min at room temperature, discard the supernatant, and collect the yeast cells; (6) Add 900 µL of 1×TE / LiAC solution to resuspend the yeast cells. The competent cells are now ready. (9) Add 1.5 mL of yeast library and 60 µL of pretreated carrier DNA, gently mix and then add 3600 µL of sterile 1×PEG / TE / LiAc solution, shake to mix. (10) Incubate at 30℃ and 200 rpm for 30 min with shaking. (11) Add 300 µL DMSO and gently invert to mix (do not shake); (12) Heat shock in a 42℃ water bath for 15 min, gently inverting and mixing once every 5 min; (13) After heat shock, let stand on ice for 2 min, centrifuge at 5000 rpm for 5 min at room temperature, and discard the supernatant; (14) Take 30 mL of sterile water to resuspend the yeast cells, incubate in a shaker at 30℃ for 1 h, then centrifuge at 5000 rpm for 5 min at room temperature and discard the supernatant; (15) After resuspending the yeast cells twice with 25 mL of sterile 1×TE, add 3 mL of sterile water to resuspend the yeast cells; (16) Spread the bacterial solution evenly on about 50 SD / -Leu / -Trp solid mediums, incubate upside down in a 30℃ incubator for 3-5 days, and observe the colony growth. (17) Pick colonies from SD / -Leu / -Trp solid medium and transfer them to 100 µL of sterile water. Mix well and then spot them onto SD / -Ade / -His / -Leu / -Trp solid medium until all colonies on SD / -Leu / -Trp solid medium are transferred to SD / -Ade / -His / -Leu / -Trp solid medium. Incubate upside down in a 30℃ incubator for 3-5 days and observe the colony growth. (18) Pick colonies from SD / -Ade / -His / -Leu / -Trp solid medium and transfer them to 100 µL of sterile water. Mix well and then spot them onto SD / -Ade / -His / -Leu / -Trp / X-α-gal / AbA solid medium. Incubate upside down in a 30 ℃ incubator for 3-5 days and observe the colony growth. (19) Pick blue bacterial spots from SD / -Ade / -His / -Leu / -Trp / X-α-gal / AbA solid medium into 100µL of sterile water, mix well, and then amplify using pGADT7 universal primers PGADT7-F / PGADT7-R (Table 1). Identify the bacterial solution by agarose gel electrophoresis and send the PCR product to the company for sequencing. (20) Based on the sequence obtained from sequencing, the gene ID is obtained from the NCBI website Blast.

[0103] ZmNAL4 Interacting protein screening: pGBKT7- ZmNAL4 The bait vector plasmid and the yeast library plasmid constructed from maize WB665 were co-transformed into Y2H yeast competent cells and plated on SD / -Ade / -His / -Leu / -Trp / X-α-gal / AbA auxotrophic solid medium. When the target protein interacts with the bait protein, it activates the activity of the GAL4 protein, leading to reporter gene expression. The yeast can grow on the auxotrophic solid medium and shows a blue color on X-α-gal medium, ultimately yielding 180 interacting yeast plaques. Figure 17 ).

[0104] Blue colonies were picked, diluted with 100 µL of sterile water, and 2 µL was used as a template for bacterial PCR identification to obtain insert fragments of different sizes. Figure 18 The amplified PCR products were sent to Beijing Liuhe BGI Genomics Co., Ltd., and the brightest main bands were selected for sequencing.

[0105] 7. Verification of interacting proteins: By sequencing yeast two-hybrid positive clones and performing bioinformatics analysis (open reading frame protein identity verification), 14 candidate proteins with correct coding and high sequence identity were screened and then subjected to inversion verification.

[0106] bait protein pGBKT7- ZmNAL4The plasmid and the pGADT7-interacting gene fusion vector plasmid were co-transformed into yeast Y2H competent cells. The co-transformed bacterial culture was spread onto SD / -Leu / -Trp solid medium and incubated upside down in a 30℃ incubator for 3-5 days to observe colony growth. Colonies from the SD / -Leu / -Trp solid medium were picked and transferred to 100 µL of sterile water, mixed thoroughly, and then spotted onto SD / -Ade / -His / -Leu / -Trp+X-α-gal solid medium and incubated upside down in a 30℃ incubator for 3-5 days to observe colony growth.

[0107] Ultimately, three proteins that may potentially interact with ZmNAL4 were identified. Figure 19 Table 8) includes ferroredoxin Zmfdx1 (GRMZM2G122337), ferroredoxin Zmfdx2 (GRMZM2G048313) and pyruvate dehydrogenase ZmPDHE1 (GRMZM2G043198).

[0108] To further verify the interactions between ZmNAL4 and Zmfdx1, Zmfdx2, and ZmPDHE1 in yeast, the stability of these interactions was further verified in tobacco leaf epidermal cells using the bimolecular fluorescence complementation (BiFC) method. Figure 20-22 It was found that ZmNAL4 interacts with Zmfdx1, Zmfdx2, and ZmPDHE1 in tobacco epidermal cells. The accuracy of the interaction results between ZmNAL4 and Zmfdx1, Zmfdx2, and ZmPDHE1 was verified using two different methods, providing evidence for further analysis of the ZmNAL4 interaction regulatory pathway and its biological functions.

[0109] Table 8 ZmNAL4 Potential interacting genes This application involves constructing the target gene. ZmNAL4 Overexpression and CRISPR / Cas9 gene-edited plants were found to have overexpression ZmNAL4 Compared to CRISPR / Cas9 gene-edited plants, maize plants showed increases in plant height and leaf width of 14.8% and 13.2%, respectively. Furthermore, Arabidopsis overexpression lines were obtained through genetic transformation, and overexpression was observed in the transgenic Arabidopsis plants. ZmNAL4 This resulted in increased leaf area and plant height in Arabidopsis thaliana, consistent with the phenotype observed in maize, indicating that the target gene... ZmNAL4 Leaf width is positively regulated by controlling the expression level of mRNA.

[0110] Using ZmNAL4 protein as bait, a library was screened in a maize yeast library, yielding 14 proteins that might interact with the bait protein. Validation was performed using different methods, and three proteins were identified as interacting with the bait protein. ZmNAL4 Interacting proteins include ferrugin Zmfdx1 (GRMZM2G122337), ferrugin Zmfdx2 (GRMZM2G048313), and pyruvate dehydrogenase ZmPDHE1 (GRMZM2G043198). Zmfdx1 and Zmfdx2 share 68.6% homology. Zmfdx1 is a response factor in maize's tolerance to high-density environments. Zmfdx2 interacts with BES1 / BZR1, and BES1 / BZR1 affects brassinolide content, regulating plant development and maize kernel size. ZmPDHE1 It is a candidate gene for the angle between maize leaves, through interaction with... ZmNAL4 The interaction between them has a significant impact on the morphology of the leaves. ZmNAL4 The gene shares the same functional domain as Arabidopsis thaliana YUCCA and rice NAL7, encoding a flavin monooxygenase. Flavin monooxygenase is an important rate-limiting enzyme in the plant auxin synthesis pathway, participating in the regulation of plant growth and development. The Arabidopsis thaliana YUCCA and rice NAL7 genes are closely related to leaf development. Mutations in NAL7 lead to a decrease in auxin content in the plant, consistent with the reduced IAA and BR content in the narrow-leaved parent and F2 narrow-leaved individual plants in this invention. Therefore, it can be concluded that... ZmNAL4 By mediating changes in the content of auxin and brassinolide, leaf growth and plant height are regulated. Combined with genetic complementation verification results, this further confirms... ZmNAL4 Through with Zmfdx1 , Zmfdx2 , ZmPDHE1 The interaction affects leaf size and plant height, while ZmNAL4 Further in-depth research is needed to understand the molecular mechanisms by which plant development and leaf size are regulated.

[0111] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. ZmNAL4 Application of genes or their encoded proteins in regulating plant leaf morphology and plant height.

2. The application according to claim 1, characterized in that: The plant leaf morphology refers to the width of the plant leaf.

3. The application according to claim 2, characterized in that: The plant in question is either maize or Arabidopsis thaliana.

4. The application according to claim 3, characterized in that: The regulation is overexpression. ZmNAL4 Genes increase leaf width and plant height.

5. The application according to claim 4, characterized in that: The regulation is knockout. ZmNAL4 Genes reduce leaf width and plant height.

6. The application according to claim 5, characterized in that: The ZmNAL4 The gene's Gene ID in NCBI is 103652784.

7. The application according to claim 6, characterized in that: The amino acid sequence of the encoded protein is shown in SEQ ID No.

1.

8. A method for cultivating transgenic plants, characterized in that, The steps are as follows: (1) If construct ZmNAL4 Gene overexpression vectors, when transferred into plants via Agrobacterium-mediated transformation, can produce transgenic plants with increased leaf width and plant height. (2) If the knockout is constructed ZmNAL4 When the CRISPR / Cas9 gene editing vector is transferred into plants via Agrobacterium-mediated transformation, transgenic plants with reduced leaf width and plant height are obtained.

9. The method according to claim 8, characterized in that: The ZmNAL4 The gene's Gene ID in NCBI is 103652784.

10. The method according to claim 9, characterized in that: The plant in question is either maize or Arabidopsis thaliana.

Images