Targeting ligand coupled drug compound as well as preparation and application thereof

Abstract

According to the targeting ligand coupled drug compound and the preparation and application thereof, coupling of the targeting ligand and the drug is achieved through the annular nucleic acid, and the antibody drug conjugate with the high drug-antibody coupling ratio is smoothly prepared by means of the characteristics that the structure of the annular nucleic acid is stable, and the size and the number of coupling sites are adjustable; according to the present invention, the antibody drug conjugate has characteristics of closed structure, stable structure, programmable number and type of the coupled drugs, on-demand assembly, difficult degradation in the living body, smooth drug delivery to the tumor site, synergistic interaction, drug anti-tumor activity improving, and good anti-tumor effect, and can be used for the preparation of the anti-tumor drug conjugate, such that the anti-tumor drug conjugate has characteristics of good anti-tumor effect, good anti-tumor effect, and good anti-tumor effect. The development of antibody drug conjugates can be effectively promoted.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and in particular relates to a kind of targeted ligand conjugated drug complex and its preparation and application. BACKGROUND

[0002] Antibody drug conjugate (ADC) is a kind of drug conjugate formed by connecting monoclone antibody targeting antigen and small molecule cytotoxic drug through linker, which has the killing effect of traditional small molecule chemotherapy and the tumor targeting of antibody drug, and has been a hotspot of research as a kind of targeted tumor drug. Currently, 19 kinds of ADC drugs have been put on the market, mainly for the treatment of a series of middle and late stage cancers such as gastric cancer, colorectal cancer and lung cancer, and have shown good efficacy.

[0003] ADC is composed of three parts: antibody responsible for selective recognition of cancer cell surface antigen, effective load responsible for killing cancer cells, and linker connecting antibody and effective load. After ADC recognizes tumor cell surface antigen, it enters the cell through endocytosis pathway, and the linker is hydrolyzed by protease in lysosome, so that the effective load is released in a bioactive form, resulting in cancer cell death. The number of effective load entering the cell is determined by the number of each cell surface antigen, the number of ADC drug effective load, and the time required for antigen to return to the cell surface. The effective load transmembrane from cytoplasm to exert inhibitory effect on peripheral tumor cells, which is called bystander effect.

[0004] Therefore, how to improve the number of effective load of ADC drug, that is, how to make the antibody load more drugs, so as to improve the drug antibody coupling ratio (DAR) is the key point to improve the anti-tumor activity of ADC, and has been a hotspot of research on ADC drug.

[0005] Many people use the side end modification of polymer to increase DAR, but the lack of accurate DAR and non-site modification has become a headache. At the same time, there are also reports that nucleic acid framework is used as a carrier to improve the drug antibody coupling ratio (DAR) of ADC, but this mode generally has poor stability and weak anti-exonuclease ability, resulting in that the drug cannot reach the tumor site stably.

[0006] Therefore, it is urgent to find a method that can improve the drug antibody coupling ratio (DAR) of ADC and ensure its stability to solve the above problems. SUMMARY

[0007] To solve the above problems, the application provides a kind of targeted ligand conjugated drug complex and its preparation and application, the coupling of targeted ligand and drug is realized by circular nucleic acid, the structural stability of circular nucleic acid is used, the characteristics of adjustable size and coupling site number are used, the preparation of antibody drug conjugate with high drug antibody coupling ratio is successfully realized, and the connection mode is optimized, the structure of the prepared antibody drug conjugate is closed and stable, the number and type of coupled drugs can be programmed according to the needs of assembly, it is not easy to be degraded in vivo, and the drug can be successfully delivered to the tumor site, which can also play a synergistic effect and improve the antitumor activity of the drug, which will effectively promote the development of antibody drug conjugate.

[0008] In one aspect, the application provides a kind of targeted ligand conjugated drug complex, the complex includes targeted ligand, circular nucleic acid and drug;The targeted ligand is coupled with the drug by circular nucleic acid;The targeted ligand can specifically bind to the target.

[0009] The research group has applied for a domestic invention patent: "a kind of circular functional nucleic acid and its preparation method and application" (application number: 2024108835794), which can realize the preparation of size controllable circular nucleic acid. Based on the previous patent application, the antibody drug conjugate is prepared by using the circular nucleic acid, which can help to improve the drug loading of antibody drug conjugate, that is, to improve the drug antibody coupling ratio, and to realize the programmable drug type and number of antibody drug conjugate. The programmable here means that it can be designed according to the needs, so that any desired antibody drug conjugate can be obtained.

[0010] The targeted ligand conjugated drug complex described in the application is a kind of generalized antibody drug conjugate (ADC), and the targeted ligand refers to any substance that can bind to a specific target, that is, a generalized "antibody".

[0011] Based on the structural stability of circular nucleic acid, the targeted ligand conjugated drug complex prepared by the application also has a stable structure, has strong resistance to exonuclease, so that the drug can be successfully delivered to the tumor site. Moreover, the combination of targeted ligand, circular nucleic acid and conjugated drug also has a significant synergistic effect, which can more effectively improve the antitumor activity of the drug compared with the combination of targeted ligand and conjugated drug.

[0012] Further, the targeted ligand includes any one or more of targeted polypeptide, nucleic acid aptamer, nanobody and antibody.

[0013] Targeted polypeptide, nucleic acid aptamer, nanobody and antibody all belong to the generalized "antibody". That is, any kind of targeted ligand can be based on circular nucleic acid to prepare the targeted ligand conjugated drug complex described in the application.

[0014] For example, nucleic acid aptamer, because it can bind to target protein, so nucleic acid aptamer is also called "biological antibody". For example, some cell penetrating peptides, targeting peptides, hormones, cytokines, toxin polypeptides, and artificially designed peptibodies, probes and the like are all short amino acid chains (targeting polypeptides) that can bind to targets and are also "antibodies" in a broad sense. Nanobodies are the smallest functional antigen-binding fragments derived from camelid heavy chain antibodies, and are also "antibodies" in a broad sense.

[0015] Further, the drug includes one or more of a cytotoxic drug, a small molecule targeted drug, an immune checkpoint inhibitor, a hormone drug, an immune agonist, or a small molecule diagnostic agent.

[0016] In theory, any drug can be used to prepare the targeting ligand conjugated drug complex based on the circular nucleic acid. However, the targeting ligand conjugated drug complex prepared from different drugs may have different steric effects and different drug activity.

[0017] Further, the coupling ratio of the drug to the targeting ligand is greater than or equal to 1.

[0018] To improve the efficacy of the targeting ligand conjugated drug complex, increasing the drug loading is an important aspect. The targeting ligand conjugated drug complex provided by the present application has a structure designed based on a circular nucleic acid. Not only the type and number of drugs coupled can be programmed, but also the size of the circular nucleic acid can be programmed. Therefore, the coupling ratio of the drug to the targeting ligand of the prepared targeting ligand conjugated drug complex can also be programmed, and it is easy to achieve a coupling ratio of the drug to the targeting ligand of greater than or equal to 1.

[0019] Further, the circular nucleic acid is a double-stranded circular nucleic acid composed of a single-stranded circular nucleic acid and a DNA short chain. The DNA short chain is coupled to the targeting ligand or the drug.

[0020] Further, the DNA short chain contains a T base, and the T base is located at a non-terminal position of the DNA short chain.

[0021] In some ways, the targeting ligand and the drug have N3 terminals, and the DNA short chain has a DBCO modification, which is coupled by an azide-alkyne cycloaddition reaction. The DBCO modification needs to be connected to the T base in the DNA short chain, so the DNA short chain needs to contain a T base.

[0022] Meanwhile, the T base needs to be located at a non-terminal position of the DNA short chain, because the terminal positions of the DNA short chain need to be connected to each other by the action of T ligase to form a circular nucleic acid. If the T base is also located at the terminal position of the DNA short chain, it can interfere with the connection work of T ligase during the coupling reaction, and there can also be a steric hindrance effect. Therefore, the T base is preferably located in the middle of the DNA short chain.

[0023] Further, the DNA short chain comprises a first DNA short chain and a second DNA short chain; the first DNA short chain is coupled with a targeting ligand and has a length of 10-60 nt; and the second DNA short chain is coupled with a drug and has a length of 3-20 nt.

[0024] The length of the DNA short chain needs to be selected according to the size of the coupled drug to prevent the steric hindrance effect from affecting the exertion of the drug efficacy.

[0025] Further, the coupling ratio of the second DNA short chain to the drug is 1: (1-10).

[0026] In some modes, the number of coupled drugs in the prepared targeting ligand-coupled drug complex is 1-8.

[0027] In some modes, the number of coupled drugs in the prepared targeting ligand-coupled drug complex is 1-20.

[0028] In another aspect, the present application provides a preparation method of a targeting ligand-coupled drug complex, which comprises the following steps:

[0029] (1) coupling a targeting ligand with a first DNA short chain to prepare a targeting building block;

[0030] (2) coupling a drug with a second DNA short chain to prepare a drug building block;

[0031] (3) preparing a single-stranded circular nucleic acid; the first DNA short chain or the second DNA short chain can be complementary to different partial sequences in the single-stranded circular nucleic acid, respectively;

[0032] (4) reacting the single-stranded circular nucleic acid with the targeting building block and / or the drug building block, respectively, to prepare a targeting ligand-coupled drug complex.

[0033] By designing the first DNA short chain and the second DNA short chain with different sequences, the first DNA short chain and the second DNA short chain can be complementary to and combined with specific positions of the circular nucleic acid, respectively, so that the binding sites of the targeting ligand and the drug to the circular nucleic acid can be programmed and designed, and the targeting ligand and the drug are combined to the pre-set positions of the circular nucleic acid as needed.

[0034] Further, the targeting ligand and the first DNA short chain in step (1) are coupled by any one or more of the following: N3 end and DBCO, thiol and double bond, trans-cyclooctene and tetrazine, cysteine and cyano benzothiazole, and other bioorthogonal reactions; the drug and the second DNA short chain in step (2) are coupled by any one or more of the following: N3 end and DBCO, thiol and double bond, trans-cyclooctene and tetrazine, cysteine and cyano benzothiazole, and other bioorthogonal reactions.

[0035] Further, the targeting ligand in step (1) has an N3 end, and the first DNA short chain has a DBCO modification; the drug in step (2) has an N3 end, and the second DNA short chain has a DBCO modification.

[0036] Further, the single-stranded circular nucleic acid in step (3) is prepared using T4 nucleic acid ligase; and the first DNA short chain or the second DNA short chain contains T4 nucleic acid ligase in the ligation system of the single-stranded circular nucleic acid.

[0037] In some modes, the present application introduces a reactive N3 end at the Fc end of the antibody (targeting ligand) through site-specific coupling of the sugar group, and couples it with a 40 nt long DNA chain with a DBCO modification through click coupling, and then couples various chemotherapeutic drugs and immune agonists in the same way on a 10 nt long short fragment, so that different targeting building blocks (targeting Coden) and drug building blocks (drug Coden) are obtained.

[0038] In some modes, the present application uses the DNA template assembly to prepare single-stranded circular nucleic acids with sizes of 60-120 nt. Then, using the single-stranded circular nucleic acid as a template, a complex with different targeting groups coupled with different drugs is synthesized, and a stable double-ring structure targeting ligand drug complex is obtained by T4 coupling technology. The double-ring structure has a size that can be adjusted, and the appropriate length of the single-strand can be selected according to the required drug loading, so as to prepare a double-ring structure with appropriate size. Moreover, the result is stable, and the targeting ligand or drug conjugate can be assembled on the double-ring structure as needed to prepare a high-DAR drug assembly, and the traditional ADC drug has a better therapeutic effect in the subsequent mouse tumor inhibition, and has a better application prospect.

[0039] In some modes, when multiple drugs need to be coupled, each drug can be connected with a different DNA short chain, that is, one drug is combined with one specific DNA short chain, and matched with a specific position of the circular nucleic acid, so as to be complementary combined to different positions of the circular DNA, realizing programmable design of drug types and coupling positions.

[0040] In still another aspect, the present application provides a preparation method of an antibody drug conjugate with high DAR, comprising the following steps:

[0041] (1) coupling the antibody with a first short DNA chain to prepare a targeting block;

[0042] (2) coupling the drug with a second short DNA chain to prepare a drug block;

[0043] (3) preparing a single-stranded circular nucleic acid; the first short DNA chain or the second short DNA chain can be complementary to different sequences in the single-stranded circular nucleic acid, respectively;

[0044] (4) reacting the single-stranded circular nucleic acid with the targeting block and / or the drug block, respectively, to prepare the antibody drug conjugate.

[0045] In still another aspect, the present application improves the use of a circular nucleic acid for preparing a reagent for improving the DAR of a targeted ligand conjugated drug complex, the targeted ligand conjugated drug complex comprising a targeted ligand, a circular nucleic acid and a drug; the targeted ligand is coupled with the drug through the circular nucleic acid; the targeted ligand can specifically bind to a target; the DAR is the coupling ratio of the drug to the targeted ligand, and 1≤DAR≤20.

[0046] In still another aspect, the present application provides the use of a circular nucleic acid for preparing a targeted ligand conjugated drug complex with editable drug number and type, the targeted ligand conjugated drug complex comprising a targeted ligand, a circular nucleic acid and a drug; the targeted ligand is coupled with the drug through the circular nucleic acid; the targeted ligand can specifically bind to a target; the DAR of the targeted ligand conjugated drug complex is greater than or equal to 1, and the DAR is the coupling ratio of the drug to the targeted ligand.

[0047] In still another aspect, the present application provides the use of a targeted ligand conjugated drug complex for preparing a reagent for improving the anti-tumor activity of a drug, the targeted ligand conjugated drug complex comprising a targeted ligand, a circular nucleic acid and a drug; the targeted ligand is coupled with the drug through the circular nucleic acid; the targeted ligand can specifically bind to a target.

[0048] The present application has the following beneficial effects:

[0049] (1) a new preparation method of a targeted ligand conjugated drug complex with high drug loading, stable structure and programmable drug type and number is provided, which solves the problems of low drug loading (low DAR), poor stability and inability to flexibly adjust the drug type and number of the ADC drug in the prior art;

[0050] (2) suitable connection modes between the circular nucleic acid and the targeted ligand and the drug are screened, respectively;

[0051] (3) The DNA short chain coupled to the targeting ligand and the drug was screened respectively, and the appropriate length and modification position of the short chain were selected;

[0052] (4) Based on the stable structure of the circular nucleic acid, the stability of the targeting ligand coupled drug complex was improved, and the targeting ligand and the drug could realize the synergistic effect in the aspect of anti-tumor and improve the anti-tumor effect. BRIEF DESCRIPTION OF DRAWINGS

[0053] Figure 1 The preparation flow chart of the targeting ligand coupled drug complex is shown in the figure;

[0054] Figure 2 The preparation flow chart of the single-stranded circular nucleic acid is shown in the figure;

[0055] Figure 3 The cryo-EM images of four kinds of circular nucleic acid targeted drugs o-RDC-4M4D, o-ApDC-4M4D, o-NDC-4M4D and o-ADC-4M4D are shown in the figure;

[0056] Figure 4 The polyacrylamide gel electrophoresis characterization results of the serum stability test of o-ADC-4M4D, circular nucleic acid, circular nucleic acid coupled drug and circular nucleic acid coupled antibody are shown in the figure;

[0057] Figure 5 The activation results of o-ADC-4M4D for the STING signaling pathway in antigen-presenting cells (THP-1) are shown in the figure;

[0058] Figure 6 The cytotoxicity cck-8 results of o-ADC-4M4D are shown in the figure;

[0059] Figure 7 The tumor volume change curves of different drug groups are shown in the figure;

[0060] Figure 8 The mouse weight change curves of different drug groups are shown in the figure;

[0061] Figure 9 The structural formula of o-ADC is shown in the figure;

[0062] Figure 10 The structural formula of o-ADC-4M4D is shown in the figure;

[0063] Figure 11 The structural formula of o-ADC-4M is shown in the figure;

[0064] Figure 12 The structural formula of o-ADC-4D is shown in the figure. DETAILED DESCRIPTION

[0065] The application will be further described in detail below with reference to the accompanying drawings and examples. It should be noted that the following examples are intended to facilitate the understanding of the application and do not limit the application in any way. The experimental reagents, consumables and experimental instruments used in the following examples are commercially available if not specified.

[0066] Example 1: Preparation of o-ADC

[0067] o-ADC refers to the conjugate of an antibody and a circular nucleic acid. The preparation process includes coupling of the antibody and the first DNA short chain, and then coupling of the conjugate and the circular nucleic acid. The specific preparation process is as follows:

[0068] (1) Coupling of HER2 antibody and first DNA short chain;

[0069] The HER2 antibody (trastuzumab, purchased from Yantang Biotechnology (Hangzhou) Co., Ltd., model Herceptin) is coupled by glycosyl strategy (the glycosyl on the Fc fragment of the antibody can be cut by endoglycosidase, thereby exposing N-acetylglucosamine, and N-acetylgalactosamine modified by azide is connected to the N-acetylglucosamine of the antibody by glycosyltransferase. The specific operation method is: EndoS or EndoS2 cuts Fc N-glycan between the two GlcNAc of chitosan core. Then, azide, cyclopropene or norbornene labeled salivation full-length sugar can be transferred to GlcNAc antibody by EndoS-D233Q57, 58 or EndoS2-D184M59 by bio-orthogonal reaction. The left and right ends of the Fc are modified with azide, and then reacted with DNA with a DBCO modification and a length of 40 nt (5' end phosphate modification, nucleotide sequence as SEQ ID NO: 1). The specific preparation method is: first, the DBCO-modified DNA synthesized by solid-phase synthesis is purified and involved in the subsequent reaction. Specifically, HER2 antibody and 40 nt-DNA are added in a molar ratio of 1:2 in 10 mM DPBS to make the final concentration of the antibody 15 μM. Shake at room temperature for 18 h, and then remove the unreacted 40 nt-DNA with a 100K ultrafiltration tube.

[0070] (2) Preparation of single-stranded circular nucleic acid;

[0071] Mix 0.1 nmol of 5' phosphorylated ssl120 sequence (SEQ ID NO: 4) and 0.15 nmol of complementary short chain Split20 (SEQ ID NO: 5) in 1x T4 ligase buffer (consisting of 366 mM Tris-HCl, pH 7.6, 6.6 mM MgCl2, 10 mM DTT and 0.1 mM ATP) to a total volume of 0.05 mL, and the final concentration of ssl120 is 2 μM. The preparation process of single-stranded circular nucleic acid is as follows:Figure 2 indicated.

[0072] The mixture was heated to 95°C in 5 minutes, then slowly cooled from 85°C to 65°C in 30 minutes, from 59°C to 35°C, after 30 minutes, kept at 26°C for 5 minutes, and finally reached 16°C. Then, 5 U / L of T4 ligase (TAKARA) was added, and the mixture was incubated at 16°C for 4 hours to connect the gaps. Then, 1 x EI buffer (ingredients 67 mM Glycine-KOH, pH 9.5, 6.7 mM MgCl2 1 mM DTT), 1 x EIII buffer (50 mM Tris-HCl, pH 8.0 5 mM MgCl2 1 mM DTT), 0.5 U / L Exonuclease III (TAKARA), and 2.5 U / L of Exonuclease I were added, and incubated at 37°C for 1 hour to cut all unreacted DNA single strands and Split20.

[0073] Finally, an equal amount of phenol-chloroform was added to the solution, vortexed for 30 s, and then centrifuged at 14,000 g for 5 minutes. The supernatant was removed and anhydrous ethanol (2.5 volumes) and sodium acetate (0.1 volume fraction, pH = 5.2) were added. The sample was precipitated at -40°C for 5 hours, and centrifuged at 14,000 g for 30 minutes. The supernatant was removed, and the precipitate was baked at 55°C for 5 min. The sscDNA template was collected by the following method: the precipitate was resuspended in ddH2O. Amicon Ultra 10KDa or 30KDa centrifuge was then used to purify the sscDNA three times using filters (Millipore). The final concentration of the sscDNA template was quantified using a Nanodrop (Thermo, USA).

[0074] (3) Synthesis of o-ADC;

[0075] The sscDNA, antibody-DNA conjugate, and second DNA short chain-1 without drug (SEQ ID NO: 2), second DNA short chain-2 without drug (SEQ ID NO: 3) were added in a molar ratio of 1:0.5:4.8:4.8, 10 x T4 DNA ligase Buffer was added to a final concentration of 1 x, and finally 1 x DPBS was added to a final concentration of 0.67 mM of sscDNA.

[0076] The following program was run using a PCR instrument: 37°C, 15 min; 37-4°C, 5 min; 4°C, ∞. After the program ended, 5 U / μL T4 DNA ligase was added, and incubated at 16°C for 4 h.

[0077] Add 10x Exonuclease III Buffer and 10x Exonuclease I Buffer to make the final concentration 1x, then add 0.5 U / L EIII (TAKARA) and 2.5 U / L E I to incubate at 37℃ for 1 hour to cut all the unreacted DNA single strands, and then purify the final product by SEC to obtain o-ADC (circular nucleic acid conjugated antibody), the structure is as shown in Figure 9 .

[0078] Example 2: Preparation of o-ADC-4M4D

[0079] The preparation flow chart of the target ligand conjugated drug complex provided in this example is shown in Figure 1 .

[0080] The specific preparation method is as follows:

[0081] (1) Conjugate HER2 antibody with the first DNA short chain to prepare a target building block;

[0082] HER2 antibody is modified with glycosyl conjugation strategy (the glycosyl on the Fc fragment of the antibody can be cut by endoglycosidase to expose N-acetylglucosamine, and N-acetylgalactosamine modified by azide is connected to the N-acetylglucosamine of the antibody by glycosyltransferase. The specific operation method is: EndoS or EndoS2 cuts Fc N-glycan between the two GlcNAc of chitosan core. Then, azide, cyclopropene or norbornene labeled salivation full-length sugar can be transferred to GlcNAc antibody by EndoS-D233Q57, 58 or EndoS2-D184M59 through bioorthogonal reaction), so that the left and right ends of the Fc are modified with azide, and then the DNA with a DBCO modification and a length of 40 nt (5' end phosphate modification, nucleotide sequence as shown in SEQ ID NO: 1, and the specific preparation method is that the DBCO modified DNA after solid phase synthesis is involved in the subsequent reaction) is conjugated. Specifically, add HER2 antibody and 40 nt-DNA in a molar ratio of 1:2 to 10 mM DPBS to make the final concentration of the antibody 15 μM. Shake at room temperature for 18 h, and then remove the unreacted 40 nt DNA with a 100K ultrafiltration tube.

[0083] (2) Conjugate drug with the second DNA short chain to prepare a drug building block;

[0084]

[0085] Prepare drug N3-Vc-MMAE and N3-Vc-diABZI modified with N3 group, and the reaction formula is as follows:

[0086] Preparation of 10nt-DNA-1 (5' end phosphate modification, nucleotide sequence as SEQ ID NO: 2) with DBCO modification for conjugation of N3-Vc-MMAE: DNA was synthesized by solid phase synthesis, in which the exposed amino group of the DBCO-modified T base was modified, and then 10nt-DNA-1 was prepared according to the method of DNA: DBCO-NHS = 1: 10.

[0087] Preparation of 10nt-DNA-2 (5' end phosphate modification, nucleotide sequence as SEQ ID NO: 3) with DBCO modification for conjugation of N3-Vc-diABZI: DNA was synthesized by solid phase synthesis, in which the exposed amino group of the DBCO-modified T base was modified, and then 10nt-DNA-2 was prepared according to the method of DNA: DBCO-NHS = 1: 10.

[0088] Synthesis of drug building blocks: 10nt-DNA-1 and N3-Vc-MMAE were added in a molar ratio of 1:4, and 10nt-DNA-2 and N3-Vc-diABZI were added in a molar ratio of 1:4 in ddH2O, so that the final concentration of 10nt-DNA-1 and 10nt-DNA-2 was 100 μM. Shake at room temperature for 18 h, then remove the unreacted drugs with a 3K ultrafiltration tube.

[0089] (3) Preparation of single-stranded circular nucleic acid;

[0090] Mix 0.1 nmol of 5' phosphorylated ssl120 sequence (SEQ ID NO: 4) with 0.15 nmol of complementary short chain Split20 (SEQ ID NO: 5) in 1x T4 ligase buffer (consisting of 366 mM Tris-HCl, pH 7.6, 6.6 mM MgCl2, 10 mM DTT and 0.1 mM ATP) with a total volume of 0.05 mL, so that the final concentration of ssl120 is 2 μM. The preparation process of single-stranded circular nucleic acid is as shown in Figure 2 .

[0091] The mixture was heated to 95°C in 5 minutes, then slowly cooled from 85°C to 65°C in 30 minutes, from 59°C to 35°C, after 30 minutes, kept at 26°C for 5 minutes, and finally reached 16°C. Then, 5 U / L of T4 ligase (TAKARA) was added, and the mixture was incubated at 16°C for 4 hours to allow ligation at the gap. Then, 1 x EI buffer (67 mM Glycine-KOH, pH 9.5, 6.7 mM MgCl2 1 mM DTT), 1 x EIII buffer (50 mM Tris-HCl, pH 8.0 5 mM MgCl2 1 mM DTT), 0.5 U / L Exonuclease III (TAKARA), and 2.5 U / L of Exonuclease I were added and incubated at 37°C for 1 hour to shear all unreacted DNA single strands and Split20.

[0092] Finally, an equal amount of phenol-chloroform was added to the solution, vortexed for 30 s, and then centrifuged at 14000 g for 5 minutes. The supernatant was removed and anhydrous ethanol (2.5 volumes) and sodium acetate (0.1 volume fraction, pH = 5.2) were added. The sample was precipitated at -40°C for 5 hours, and centrifuged at 14000 g for 30 minutes. The supernatant was removed, and the precipitate was baked at 55°C for 5 min. The sscDNA template was collected by the following method: the precipitate was resuspended in ddH2O. Amicon Ultra 10KDa or 30KDa centrifuge was then used to purify the sscDNA three times using a filter (Millipore). The final concentration of the sscDNA template was quantified using a Nanodrop (Thermo, USA).

[0093] (4) Synthesis of o-ADC-4M4D;

[0094] The sscDNA, antibody-DNA conjugate, 10 nt-MMAE and 10 nt-diABZI conjugate were added in a molar ratio of 1:0.5:4.8:4.8, 10 x T4 DNA ligase Buffer was added to a final concentration of 1 x, and finally 1 x DPBS was added to a final concentration of 0.67 μΜ of sscDNA.

[0095] The following program was run using a PCR instrument: 37°C, 15 min; 37-4°C, 5 min; 4°C, ∞. After the program ended, 5 U / μL T4 DNA ligase was added, and incubated at 16°C for 4 h.

[0096] Add 10x Exonuclease III Buffer and 10x Exonuclease I Buffer to make the final concentration 1x, then add 0.5 U / L EIII (TAKARA) and 2.5 U / L E I at 37°C for 1 hour to cut all the unreacted DNA single strands, and then purify the final product by SEC to obtain o-ADC-4M4D (circular nucleic acid conjugated with one antibody and conjugated with 4 molecules of MMAE and 4 molecules of diABZI), the structure of which is shown in Figure 10 .

[0097] The same method is also used in this example, and the HER2 antibody therein is replaced by RDC (RGD), ApDC (AS1411, AGG TGG ACATTG TCC TGACTT TTT TGG TGG TGG TGG TTG TGG TGG TGG TGG TCC CTT CACTAT GTG CGT CG, SEQ ID NO: 6), NDC (nanobody), to obtain o-RDC-4M4D, o-ApDC-4M4D, o-NDC-4M4D, respectively.

[0098] This example carries out cryo-EM shooting for the four types of target ligand conjugated drug complexes o-ADC-4M4D, o-RDC-4M4D, o-ApDC-4M4D, and o-NDC-4M4D, respectively (using the method of dropping the sample on the copper mesh and then quickly freezing in liquid nitrogen, and then shooting), and the shooting results are shown in Figure 3 , which shows that the four types of target ligand conjugated drug complexes have been successfully synthesized.

[0099] In order to verify the stability of the target ligand conjugated drug complex, this example carries out serum stability test for o-ADC-4M4D, and the test method is as follows: 6 samples of 50 pmol are incubated in complete medium containing 5% serum at 37°C for corresponding time, and then polyacrylamide gel electrophoresis is used for characterization, 10 pmol is loaded on each lane, and the test results are shown in Figure 4 . According to Figure 4 , it can be seen that o-ADC-4M4D has similar stability with circular nucleic acid, circular nucleic acid conjugated drug or circular nucleic acid conjugated antibody, and still exists stably without being degraded after 24 hours in serum. The ordinary linear nucleic acid aptamer conjugated drug usually degrades obviously after 12 hours, and is completely degraded after 24 hours.

[0100] Example 3: Preparation of o-ADC-4M

[0101] The preparation flow chart of the target ligand conjugated drug complex provided in this example is shown in Figure 1 .

[0102] The specific preparation method is as follows:

[0103] (1) The HER2 antibody is coupled with the first DNA short chain to prepare a targeting block;

[0104] The method is consistent with that described in Example 1.

[0105] (2) The drug is coupled with the second DNA short chain to prepare a drug block;

[0106] The drug N3-Vc-MMAE with N3 group modification is prepared. The specific method is as follows: 10nt-DNA-1 (5' end phosphate modification, nucleotide sequence as SEQ ID NO: 2) with DBCO modification for coupling N3-Vc-MMAE is prepared by solid phase synthesis method, wherein the exposed amino group of the T base of the DBCO needs to be modified, and then 10nt-DNA-2 is prepared according to the method of DNA: DBCO-NHS = 1: 10.

[0107] Synthesis of the drug block: 10nt-DNA-1 and N3-Vc-MMAE are added according to a molar ratio of 1:4, so that the final concentration of 10nt-DNA-1 is 100 μM. Shake at room temperature for 18 h, and then remove the unreacted drug by using a 3K ultrafiltration tube.

[0108] (3) Preparation of a single-stranded circular nucleic acid;

[0109] 0.1 nmol of 5' phosphorylated ssl120 sequence (SEQ ID NO: 4) and 0.15 nmol of complementary short chain Split20 (SEQ ID NO: 5) are mixed in 1x T4 ligase buffer (consisting of 366 mM Tris-HCl, pH 7.6, 6.6 mM MgCl2, 10 mM DTT and 0.1 mM ATP) to a total volume of 0.05 mL, so that the final concentration of ssl120 is 2 μM.

[0110] The mixture was heated to 95°C in 5 minutes, then slowly cooled from 85°C to 65°C in 30 minutes, from 59°C to 35°C, after 30 minutes, kept at 26°C for 5 minutes, and finally reached 16°C. Then, 5 U / L of T4 ligase (TAKARA) was added, and the mixture was incubated at 16°C for 4 hours to connect the gaps. Then, 1 x EI buffer (67 mM Glycine-KOH, pH 9.5, 6.7 mM MgCl2 1 mM DTT), 1 x EIII buffer (50 mM Tris-HCl, pH 8.0 5 mM MgCl2 1 mM DTT), 0.5 U / L Exonuclease III (TAKARA), and 2.5 U / L of Exonuclease I were added and incubated at 37°C for 1 hour to cut all unreacted DNA single strands and Split20.

[0111] Finally, an equal amount of phenol-chloroform was added to the solution, vortexed for 30 s, and then centrifuged at 14,000 g for 5 min. The supernatant was removed and anhydrous ethanol (2.5 volumes) and sodium acetate (0.1 volume fraction, pH = 5.2) were added. The sample was precipitated at -40°C for 5 hours, and centrifuged at 14,000 g for 30 min. The supernatant was removed, and the precipitate was baked at 55°C for 5 min. The sscDNA template was collected by the following method: the precipitate was resuspended in ddH2O. Amicon Ultra 10KDa or 30KDa centrifuge was then used to purify the sscDNA three times using a filter (Millipore). The final concentration of the sscDNA template was quantified using a Nanodrop (Thermo, USA).

[0112] (4) Synthesis of o-ADC-4M;

[0113] sscDNA, antibody-DNA conjugate, 10 nt-MMAE conjugate, and the second DNA short chain-2 (SEQ ID NO: 3) without drugs were added in a molar ratio of 1:0.5:4.8:4.8, 10 x T4 DNA ligase Buffer was added to a final concentration of 1 x, and finally 1 x DPBS was added to a final concentration of 0.67 μΜ of sscDNA.

[0114] The following program was run using a PCR instrument: 37°C, 15 min; 37-4°C, 5 min; 4°C, ∞. After the program ended, 5 U / μL T4 DNA ligase was added, and incubated at 16°C for 4 h.

[0115] Add 10x Exonuclease III Buffer and 10x Exonuclease I Buffer to make the final concentration 1x, then add 0.5U / L EIII (TAKARA) and 2.5U / L E I at 37℃ for 1 hour to cut all the unreacted DNA single strands, and then purify the final product by SEC to obtain o-ADC-4M (circular nucleic acid conjugated with one molecule of antibody and four molecules of MMAE), the structure of which is shown in Figure 11 .

[0116] The same method is also used in this embodiment, and the HER2 antibody is replaced by RDC (RGD), ApDC (AS1411, SEQ ID NO: 6), and NDC (nanobody), thereby obtaining o-RDC-4M, o-ApDC-4M, and o-NDC-4M, respectively.

[0117] Example 4: Preparation of o-ADC-4D

[0118] The preparation flow chart of the targeted ligand-drug conjugate provided in this embodiment is shown in Figure 1 .

[0119] The specific preparation method is as follows:

[0120] (1) HER2 antibody is coupled with the first short DNA chain to prepare a targeting building block;

[0121] The method is consistent with the method described in Example 1.

[0122] (2) Drug is coupled with the second short DNA chain to prepare a drug building block;

[0123] The drug N3-Vc-diABZI with N3 group modification is prepared by the following method: 10nt-DNA-1 (5' end phosphate modification, nucleotide sequence as SEQ ID NO: 2) with DBCO modification for coupling N3-Vc-diABZI is prepared by the following method: solid-phase synthesis method is used to synthesize DNA, wherein the exposed amino group of the T base modified with DBCO is modified, and then 10nt-DNA-2 is prepared according to the method of DNA: DBCO-NHS = 1: 10.

[0124] Synthesis of drug building block: 10nt-DNA-1 and N3-Vc-diABZI are added according to the molar ratio of 1:4, and the final concentration of 10nt-DNA-1 is 100μM. Shake at room temperature for 18h, and then remove the unreacted drug by 3K ultrafiltration tube.

[0125] (3) Preparation of single-stranded circular nucleic acid;

[0126] 0.1 nmol of 5’ phosphorylated modified ssl120 sequence (SEQ ID NO: 4) was mixed with 0.15 nmol of complementary short chain Split20 (SEQ ID NO: 5) in 1x T4 ligase buffer (composed of 366 mM Tris-HCl, pH 7.6, 6.6 mM MgCl2, 10 mM DTT and 0.1 mM ATP) in a total volume of 0.05 mL, making the final concentration of ssl120 2 mM.

[0127] The mixture was heated to 95°C for 5 minutes, then slowly cooled from 85°C to 65°C for 30 minutes, from 59°C to 35°C for 30 minutes, and then kept at 26°C for 5 minutes, and finally reached 16°C. Then, 5 U / L of T4 ligase (TAKARA) was added, and the mixture was incubated at 16°C for 4 hours to allow ligation at the gap. Then, 1x EI buffer (67 mM Glycine-KOH, pH 9.5, 6.7 mM MgCl2, 1 mM DTT), 1x EIII buffer (50 mM Tris-HCl, pH 8.0, 5 mM MgCl2, 1 mM DTT), 0.5 U / L Exonuclease III (TAKARA) and 2.5 U / L Exonuclease I were added to cut all unreacted DNA single strands and Split20 at 37°C for 1 hour.

[0128] Finally, an equal amount of phenol-chloroform was added to the solution, vortexed for 30 s, and then centrifuged at 14000 g for 5 minutes. The supernatant was removed and anhydrous ethanol (2.5 volumes) and sodium acetate (0.1 volume, pH = 5.2) were added. The sample was precipitated at -40°C for 5 hours, and centrifuged at 14000 g for 30 minutes. The supernatant was removed, and the precipitate was baked at 55°C for 5 min. The sscDNA template was collected by resuspending the precipitate in ddH2O. Amicon Ultra 10KDa or 30KDa centrifuge was then used to purify the sscDNA three times using filters (Millipore). The final concentration of sscDNA template was quantified using a Nanodrop (Thermo, USA).

[0129] (4) Synthesis of o-ADC-4D;

[0130] sscDNA, antibody-DNA conjugate, 10 nt-diABZI conjugate, and second DNA short chain-1 (SEQ ID NO: 2) without drug were added in a molar ratio of 1:0.5:4.8:4.8, 10x T4 DNA ligase Buffer was added to make the final concentration 1x, and finally 1x DPBS was added to make the final concentration of sscDNA 0.67 mM.

[0131] The following program was run using a PCR instrument: 37°C, 15 min; 37-4°C, 5 min; 4°C, ∞. After the program ended, 5 U / μL T4 DNA ligase was added, and incubation was performed at 16°C for 4 h.

[0132] 10×Exonuclease III Buffer and 10×Exonuclease I Buffer were added to a final concentration of 1×, and then 0.5 U / L EIII (TAKARA) and 2.5 U / L E I were added for incubation at 37°C for 1 h to cut all unreacted DNA single strands, after which the final product was purified by SEC to prepare o-ADC-4D (circular nucleic acid coupled with 1 molecule of antibody coupled with 4 molecules of diABZI), the structure of which is shown in Figure 12

[0133] The same method was also used in this example, in which the HER2 antibody was replaced by RDC (RGD), ApDC (AS1411, SEQ ID NO: 6), NDC (nanobody), thereby preparing o-RDC-4D, o-ApDC-4D, and o-NDC-4D, respectively.

[0134] Example 5: Activation of the STING signaling pathway in antigen-presenting cells (THP-1) by o-ADC-4M4D In this example, o-ADC-4M4D prepared by the method provided in Example 2 was used to investigate its effect on the activation of the STING signaling pathway in antigen-presenting cells (THP-1). The specific experimental method was as follows: 500 μL, 100 nM of each material was first allowed to act on SKBR3 (adherent cells) for 12 h, and then THP-1 (suspension cells) was added for another 12 h of incubation, after which the proteins of the two cells were extracted, and then WB was used to characterize each protein to investigate the effects of PBS (blank control group), MMAE (single drug group), diABZI (single drug group), o-Ab (antibody coupled with circular nucleic acid group), and o-ADC-4M4D group on STING, TBK1, IRF3, and GAPDH. The former p is a phosphorylated protein. The depth of the protein band corresponds to the degree of activation. The darker the color, the more obvious the activation. The test results are shown in Figure 5

[0135] As can be seen from Figure 5 , o-ADC-4M4D not only effectively exerts the effects of both MMAE and diABZI to activate the STING signaling pathway, but also significantly activates p-STING, STING, p-TBK1, TBK1, p-IRF3, IRF3, and GAPDH. However, other groups do not have this phenomenon. For example, the MMAE group can only activate STING, TBK1, IRF3, and GAPDH.​​

[0136] Example 6: Cytotoxicity of o-ADC-4M4D

[0137] This example uses the method provided in Example 2 to prepare o-ADC-4M4D to investigate its cytotoxicity cck-8, the specific experimental method is: each group is set up concentration gradient, and the SKBR3 cells are incubated for 24h, then incubated for 72h, and then the cell viability is determined by CCK-8 method. The detection results are shown in Figure 6 .

[0138] According to Figure 6 It can be seen that the cytotoxicity of o-ADC-4M4D is obviously stronger than that of the conjugated antibody group (o-Ab-4M or o-Ab-4D). It needs to be explained here that the single drug (without conjugated antibody) has stronger cytotoxicity, but it has no targeting property and the release speed is too fast, so its therapeutic effect is still not as good as that of the conjugated antibody group.

[0139] Example 7: Anti-tumor activity of o-ADC-4M4D

[0140] This example uses the method provided in Example 2 to prepare o-ADC-4M4D for tumor treatment of immunized mice (Balb / c-CT26-hHER2, CT26 transfected with hHER2 to express humanized HER2 protein), and the construction method of the immunized mouse tumor model is: the tumor block with a volume of 1mm 3 The tumor block with a volume of 1mm Figure 7 and Figure 8 .

[0141] Table 1, Anti-tumor effect of different drugs

[0142] Group Tumor inhibition rate (%) at 10 days Survival rate (%) at 40 days PBS / 0 Ab 11.5 0 MMAE 22.8 3.2 diABZI 16.4 2.5 o-ADC-4M 41.2 10.1 o-ADC-4D 30.3 8.4 o-ADC-4M4D 90.5 25.0

[0143] According to Table 1, from the treatment results, it can be seen that the o-ADC-4M4D prepared by us has good tumor inhibition effect compared with the 4 MMAE single chemotherapy drugs o-ADC-4M and the single immune agonist o-ADC-4D, the tumor inhibition rate of 10d reached 90.5%, the 40d survival rate reached 25%, and there was obvious synergistic effect.

[0144] Example 8: Effect of base T position in DNA short chain

[0145] This example also investigates the effect of the position of the DBCO modification in the first DNA short chain connected by the targeting ligand in the targeting ligand conjugated drug complex constructed according to the method provided in Example 2 on the drug efficacy. The first DNA short chain has 12 T bases (AGGTGGACATTGTCCTGACTTTCCCTTCACTATGTGCGTCG), respectively at positions 4, 10, 11, 20, 21, 22, 26, 27, 31, 33, 35, and 39, the second DNA short chain-1 has 3 T bases (ACCTCTCGTC), respectively at positions 4, 6, and 9, and the second DNA short chain-2 has 3 T bases (TGACGTTCCA), respectively at positions 1, 6, and 7. The modification of DBCO on different positions of T bases was investigated, and 6 groups of o-ADC-4M4D were constructed. According to the method provided in Example 7, a tumor model was constructed, and the anti-tumor activity of the different o-ADC-4M4D on the 10th day of the constructed targeting ligand conjugated drug was investigated, and the results are shown in Table 2.

[0146] Table 2, Effect of base T position in DNA short chain

[0147]

[0148] According to Table 2, it can be seen that the anti-tumor effect of the prepared o-ADC-4M4D is different when the position of the base T is different, that is, the position of the DBCO modification is different. The reason may be that the DBCO modification at the end of the DNA short chain interferes with the T ligase, and at the same time, it may also cause steric hindrance effect, affecting the exertion of drug efficacy, so it is necessary to select the DNA short chain with the base T position in the middle, which is more conducive to exerting the synergistic effect between the targeting ligand and the drug, and improving the anti-tumor effect of the drug.

[0149] Example 9: Efficacy of different lengths of circular nucleic acids and conjugation of different numbers of drugs

[0150] The present example was prepared according to the method provided in Example 2, using SSL100-1 (SEQ ID NO: 7), SSL100-2 (SEQ ID NO: 8), ssl120 sequence (SEQ ID NO: 4), ssl120 sequence-2 (SEQ ID NO: 9) respectively to prepare o(SSL100-1)-ADC-10M, o(SSL100-2)-ADC-5M, o(SSL120-2)-ADC-10M, o(SSL120)-ADC-4M4D (Example 2), o(SSL120)-ADC-4M (Example 3), o(SSL120)-ADC-4D (Example 4) altogether 6 kinds of antibody conjugated drug complex.

[0151] In the preparation of o(SSL100-1)-ADC-10M, the complementary short chain Split20-1 is SEQ ID NO: 10, the sequence of the first DNA short chain (SSL100-1) used for conjugating the antibody is SEQ ID NO: 11, and the sequence (6nt) of the second DNA short chain (SSL100-1) used for conjugating MMAE is SEQ ID NO: 12.

[0152] In the preparation of o(SSL100-2)-ADC-5M, the complementary short chain Split20-2 is SEQ ID NO: 13, the sequence of the first DNA short chain (SSL100-2) used for conjugating the antibody is SEQ ID NO: 14, and the sequence (12nt) of the second DNA short chain-1 (SSL100-2) used for conjugating MMAE is SEQ ID NO: 15.

[0153] In the preparation of o(SSL120-2)-ADC-10M, the complementary short chain Split20-3 is SEQ ID NO: 16, the sequence of the first DNA short chain (SSL120-2) used for conjugating the antibody is SEQ ID NO: 17, and the sequence (8nt) of the second DNA short chain (SSL120-2) used for conjugating MMAE is SEQ ID NO: 18.

[0154] According to the method provided in Example 6, a tumor model was constructed, and each group was injected into the mouse body through the tail vein at a dose of 0.25 mg / kg / time of MMAE and diABZI, and the amount of each group was injected into the mouse body through the tail vein at a dose of 5 mg / kg / time. The drug was administered three times (on days 0, 7, and 14), that is, the equivalent amount of MMAE or diABZI in each drug was consistent, and the anti-tumor activity of different antibody conjugated drug complexes on day 10 was investigated, and the results are shown in Table 3.

[0155] Table 3, selection of DNA short chain length

[0156] Group Antibody-drug conjugate complex Tumor inhibition rate (%) 1 o(SSL100-1)-ADC-10M 72.2 2 o(SSL100-2)-ADC-5M 55.4 3 o(SSL120-2)-ADC-10M 83.2 4 (Example 2) o(SSL120)-ADC-4M4D 90.8 5 (Example 3) o(SSL120)-ADC-4M 41.3 6 (Example 4) o(SSL120)-ADC-4D 30.1

[0157] As can be seen from Table 3, for the targeting ligand (such as the HER2 antibody in this embodiment) and the drug (such as MMAE or diABZI in this embodiment), a suitable length of the circular nucleic acid needs to be selected for connection and complementary binding to the circular nucleic acid. For example, comparing Group 1 and Group 3, although both are coupled with 10M, due to the different lengths of the coupled DNA short chain sequences, the anti-tumor effects are also different, and the effect of Group 3 is obviously better.

[0158] Among them, the anti-tumor effect of o-ADC-4M4D constructed is the best, even better than that of 10M coupling. The reason may be that different lengths of DNA short chains or sequences have an impact on the activity of the drug. Too short or too long DNA short chains coupled with M may cause steric hindrance or interference. At the same time, there is also a synergistic effect when MMAE and diABZI are coupled at the same time. Therefore, selecting a suitable length of DNA short chain and simultaneously coupling MMAE and diABZI is more conducive to the synergistic effect between the targeting ligand and the drug, thereby significantly improving the therapeutic effect.

[0159] Although the present application is disclosed as above, the present application is not limited thereto. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the present application, and therefore the protection scope of the present application should be subject to the scope defined by the claims.

[0160] SEQUENCE LIST

[0161] SEQ ID NO. 1

[0162] First DNA short chain: phosphate 5' AGGTGGACATTGTCCTGAC / iDBCO dT / TTCCCTTCACTATGTGCGTCG 3'

[0163] Second DNA short chain-1: phosphate 5' ACCTC / iDBCO dT / CGTC 3'

[0164] SEQ ID NO. 3

[0165] Second DNA short chain-2: phosphate 5' TGACG / iDBCO dT / TCCA 3'

[0166] SEQ ID NO. 4

[0167] Ssl120: Phospho-5' AGATCGCAACCCAAGGAGCCGAGGACTGCAAAAACGCGTGAGTGAAGGACCTGGTCAGAGACCGGAATCGACTGACCAACTGCCATCTGCAGCTAACACG AGGATGTGCTGGAACGGAGA

[0168] SEQ ID NO. 5

[0169] Splint DNA: CTTGGGTTGCGATCTTCT CCGTTCCAGCAC

[0170] SEQ ID NO: 6

[0171] AS1411: Phospho-5' AGG TGG ACA TTG TCC TGA CTT TTT TGG TGG TGG TGG TTG TGGTGG TGG TGG TCC CTT CAC TAT GTG CGT CG3'

[0172] SEQ ID NO: 7

[0173] SSL100-1: Phospho-5' AGAGGTAGAGGTAGAGGTAGAGGTAGAGGTAGAGGTGAGAGTAGAGGTAGAGGTA GAGGTCGACGCACATAGTGAAGGGAAGTCAGGACAATGTCCACCT3'

[0174] SEQ ID NO: 8

[0175] SSL100-2: Phospho-5' GAC GAG AGG TCG GAC GAG AGG TCG GAC GAG AGG TCG GACGAG AGG TCG GAC GAG AGG TCG C GAC GCA CAT AGT GAA GGG AAG TCA GGA CAA TGT CCACCT3'

[0176] SEQ ID NO: 9

[0177] ssl120 sequence-2: Phospho-5' CGAGAGGTCGAGAGGTCGAGAGGTCGAGAGGTCGAGAGGTC GAGAGGTCGAGAGGTCGAGAGGTCGAGAGGTCGAGAGGTCGACGCACATAGTGAAGGGAAGTC AGGACAATGTCCACCT3'

[0178] SEQ ID NO: 10

[0179] Split20-1: 5' CTC TAC CTC TAG GTG GAC AT 3'

[0180] SEQ ID NO: 11

[0181] First DNA short strand (SSL100-1):

[0182] 5' AGGTGGACATTGTCCTGAC / iDBCO dT / TCCCTTCACTATGTGCGTCG 3'

[0183] SEQ ID NO: 12

[0184] Second DNA short strand (SSL100-1) (6 nt):

[0185] 5' ACC / iDBCO dT / CT 3'

[0186] SEQ ID NO: 13

[0187] Complementary short strand Split20-2: ACC TCT CGT CAG GTG GAC AT

[0188] SEQ ID NO: 14

[0189] First DNA short strand (SSL100-2):

[0190] 5' AGGTGGACATTGTCCTGAC / iDBCO dT / TCCCTTCACTATGTGCGTCG 3'

[0191] SEQ ID NO: 15

[0192] Second DNA short strand (SSL100-2):

[0193] 5' CGACC / iDBCO dT / CTC GTC 3'

[0194] SEQ ID NO: 16

[0195] Complementary short strand Split20-3: CGA CCT CTC GAG GTG GAC AT

[0196] SEQ ID NO: 17

[0197] First DNA short strand (SSL120-2):

[0198] phospho-5' AGGTGGACATTGTCCTGAC / iDBCO dT / TCCCTTCACTATG TGCGTCG 3'

[0199] SEQ ID NO: 18

[0200] Second DNA short strand (SSL120-2):

[0201] phospho-5' ACC / iDBCO dT / CTCG 3'

Claims

1. A targeted ligand-conjugated drug complex, characterized in that, It includes a targeting ligand, a circular nucleic acid, and a drug; the targeting ligand is coupled to the drug via the circular nucleic acid; the targeting ligand can specifically bind to the target.

2. The targeted ligand-conjugated drug complex as described in claim 1, characterized in that, The targeting ligand includes any one or more of the following: targeting peptides, nucleic acid aptamers, nanobodies, and antibodies.

3. The targeted ligand-conjugated drug complex as described in claim 1, characterized in that, The drug includes one or more of the following: cytotoxic drugs, small molecule targeted drugs, immune checkpoint inhibitors, hormonal drugs, immune agonists, or small molecule diagnostic agents.

4. The targeted ligand-conjugated drug complex as described in claim 1, characterized in that, The conjugation ratio of the drug to the target ligand is greater than or equal to 1.

5. The targeted ligand-conjugated drug complex as described in claim 1, characterized in that, The circular nucleic acid is a double-stranded circular nucleic acid, which is composed of a complementary combination of a single-stranded circular nucleic acid and a short DNA chain; the short DNA chain is conjugated to a target ligand or a drug.

6. The targeted ligand-conjugated drug complex as described in claim 5, characterized in that, The short DNA chain contains a T base, which is located at a non-terminal position of the short DNA chain.

7. The targeted ligand-conjugated drug complex as described in claim 5, characterized in that, The short DNA chain includes a first short DNA chain and a second short DNA chain; the first short DNA chain is coupled to a target ligand and has a length of 10–60 nt. The second short DNA strand, with a length of 3–20 nt, is conjugated to the drug.

8. The targeted ligand-conjugated drug complex as described in claim 7, characterized in that, The conjugation ratio of the second short DNA strand to the drug is 1:(1-10).

9. A method for preparing a targeted ligand-conjugated drug complex, characterized in that, Includes the following steps: (1) Targeting ligands are coupled with the first short DNA strand to prepare targeting building blocks; (2) The drug is coupled with the second short DNA strand to prepare drug building blocks; (3) Prepare single-stranded circular nucleic acid; the first short DNA strand or the second short DNA strand can be complementary to different parts of the sequence in the single-stranded circular nucleic acid; (4) React single-stranded circular nucleic acids with target building blocks and / or drug building blocks respectively to prepare target ligand-coupled drug complexes.

10. The preparation method according to claim 9, characterized in that, In step (1), the targeting ligand and the first DNA short chain are coupled in any one or more of the following ways: N3 end and DBCO, thiol and double bond, trans-cyclooctene and tetrazine, cysteine ​​and cyanobenzothiazole; in step (2), the drug and the second DNA short chain are coupled in any one or more of the following ways: N3 end and DBCO, thiol and double bond, trans-cyclooctene and tetrazine, cysteine ​​and cyanobenzothiazole.

11. The preparation method according to claim 10, characterized in that, The targeting ligand in step (1) has an N3 end and the first short DNA chain is modified with DBCO; the drug in step (2) has an N3 end and the second short DNA chain is modified with DBCO.

12. The preparation method according to claim 9, characterized in that, The single-stranded circular nucleic acid described in step (3) is prepared using T4 nucleic acid ligase; the ligation system of the first or second short DNA chain with the single-stranded circular nucleic acid contains T4 nucleic acid ligase.

13. A method for preparing an antibody-drug conjugate with high DAR, characterized in that, Includes the following steps: (1) Antibody is conjugated with the first short DNA strand to prepare a targeted building block; (2) The drug is coupled with the second short DNA strand to prepare drug building blocks; (3) Prepare single-stranded circular nucleic acid; the first short DNA strand or the second short DNA strand can be complementary to different parts of the sequence in the single-stranded circular nucleic acid; (4) Prepare antibody-drug conjugates by reacting single-stranded circular nucleic acids with target building blocks and / or drug building blocks through sequence complementation reactions.

14. The use of circular nucleic acids in the preparation of reagents to enhance the DAR of targeted ligand-coupled drug complexes, characterized in that, The targeted ligand-drug conjugate comprises a targeted ligand, a circular nucleic acid, and a drug; the targeted ligand is conjugated to the drug via the circular nucleic acid; the targeted ligand specifically binds to the target; and the DAR is the conjugation ratio of the drug to the targeted ligand, where 1 ≤ DAR ≤ 20.

15. The use of circular nucleic acids in the preparation of drug-targeting ligand-conjugated complexes with editable number and types of drugs, characterized in that, The targeted ligand-drug conjugate comprises a targeted ligand, a circular nucleic acid, and a drug; the targeted ligand is conjugated to the drug via the circular nucleic acid; the targeted ligand specifically binds to the target; the DAR of the targeted ligand-drug conjugate is greater than or equal to 1, where DAR is the conjugation ratio of the drug to the targeted ligand.

16. The use of a targeted ligand-conjugated drug complex in the preparation of a reagent to enhance the antitumor activity of a drug, characterized in that, The targeted ligand-drug conjugate comprises a targeted ligand, a circular nucleic acid, and a drug; the targeted ligand is conjugated to the drug via the circular nucleic acid; and the targeted ligand can specifically bind to the target.

Images