Application of SDAD1 as target spot in preparation of medicine for treating diffuse large B-cell lymphoma

By using CRISPR/Cas9 screening technology to identify SDAD1 as a target for diffuse large B-cell lymphoma, drugs that inhibit SDAD1 expression were prepared, solving the drug resistance problem of DLBCL and achieving effective treatment and prognosis improvement for lymphoma cells.

CN121320528APending Publication Date: 2026-01-13HENAN CANCER HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511187653.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-25
Publication Date
2026-01-13

AI Technical Summary

Technical Problem

Current treatments for diffuse large B-cell lymphoma suffer from drug resistance issues, and the key molecular mechanisms are not fully understood, resulting in limited treatment efficacy.

Method used

CRISPR/Cas9 gene library screening technology was used to identify DLBCL drug resistance genes, and SDAD1 was found as a potential target. Targeted drugs were prepared by inhibiting the expression or function of the SDAD1 gene, such as nucleic acid molecules and antibodies, to inhibit tumor cell proliferation and promote apoptosis.

Benefits of technology

It effectively inhibits SDAD1 gene expression, induces lymphoma cell cycle arrest and apoptosis, and significantly prolongs patients' progression-free survival and overall survival, providing a new treatment strategy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_2
    Figure SMS_2
  • Figure HDA0005562731460000011
    Figure HDA0005562731460000011
  • Figure HDA0005562731460000012
    Figure HDA0005562731460000012
Patent Text Reader

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to application of SDAD1 as a target spot to preparation of a medicine for treating diffuse large B-cell lymphoma. The invention provides a biomarker SDAD1 gene or SDAD1 protein for auxiliary diagnosis of diffuse large B-cell lymphoma for the first time. The invention discovers that the progression-free lifetime and the total lifetime of patients with high SDAD1 expression are obviously shortened compared with those of patients with low expression for the first time, which prompts that the high expression of SDAD1 is related to poor prognosis of DLBCL patients. The LC1-DNAzyme drug capable of efficiently inhibiting SDAD1 gene expression is prepared, the effects of specifically recognizing DLBCL cells, inhibiting tumor cell proliferation and promoting tumor cell apoptosis can be achieved, and it is verified through a mouse tumor-bearing model that the drug can effectively treat lymphoma and is good in safety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the use of SDAD1 as a target in the preparation of drugs for treating diffuse large B-cell lymphoma. Background Technology

[0002] Diffuse large B-cell lymphoma (DLBCL) is a common and aggressive form of non-Hodgkin lymphoma (NHL). R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, prednisone) remains the primary treatment for lymphoma; however, approximately 40% of patients develop resistance or relapse. Recently approved bispecific antibodies, antibody-drug conjugates, small molecule targeted therapies, and cell therapies have partially improved the treatment outcomes for lymphoma patients, but the goal of ultimately conquering lymphoma remains far off.

[0003] Studies have found constitutive expression of γH2AX, a marker of DNA double-strand breaks (DSB), in tumor tissues of DLBCL patients. This expression is independently associated with poor prognosis after immunochemotherapy, and its formation is significantly related to replication stress caused by cell cycle dysregulation. Replication stress is a core characteristic of DLBCL, manifested as DNA replication inhibition, primarily caused by abnormal cell proliferation driven by oncogene activation and tumor suppressor gene loss. Under physiological conditions, excessive replication stress can lead to DSB and apoptosis. However, tumor cells can overcome replication stress through compensatory activation of various molecular mechanisms, leading to treatment resistance. This adaptive resistance mechanism has become an important breakthrough for targeted cancer therapy. Currently, the key molecules and functions of replication stress-induced drug resistance in DLBCL are not fully elucidated; further research will help solve the challenge of DLBCL drug resistance.

[0004] CRISPR / Cas9 gene library screening technology, as a highly efficient and precise gene editing tool, provides strong technical support for rapidly identifying drug resistance genes in tumor cells and discovering new clinical therapeutic targets. Based on previous research, we constructed a DLBCL line infected with a DLBCL drug resistance-related CRISPR / Cas9 sgRNA library to screen for lethal genes in DLBCL, driven by replication pressure-related drug resistance.

[0005] In the screening of DLBCL resistance genes, SDAD1 showed the most significant differences. SDAD1 (SDA1 DomainContaining1) is homologous to the yeast SDA1 gene and functions as a molecular chaperone in ribosome assembly. It stabilizes the conformation of ribosomes by binding to specific rRNA fragments, preventing unnatural folding and participating in the quality regulation of ribosome assembly. Its association with DLBCL has never been reported before; therefore, it is urgent to investigate the relationship between SDAD1 and DLBCL. Summary of the Invention

[0006] In view of the problems and deficiencies in the existing technology, the present invention provides the use of SDAD1 as a target in the preparation of drugs for treating diffuse large B-cell lymphoma.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] The first aspect of this invention provides the use of the SDAD1 gene or SDAD1 protein as a drug target for screening the prevention, remission and / or treatment of diffuse large B-cell lymphoma.

[0009] A second aspect of the present invention provides the use of substances that inhibit SDAD1 gene expression and / or function in the preparation of medicaments for the prevention, relief and / or treatment of diffuse large B-cell lymphoma.

[0010] The third aspect of the present invention provides the use of substances that inhibit SDAD1 expression and / or function in the preparation of products that inhibit the proliferation of diffuse large B-cell lymphoma cells and / or inhibit the growth of diffuse large B-cell lymphoma tumors.

[0011] According to the above application, preferably, the substance that inhibits SDAD1 expression and / or function is at least one of nucleic acid molecules, small molecule compounds, antibodies, proteins, adeno-associated viruses, lentiviruses, and bionanomaterials, wherein the adeno-associated virus contains the nucleic acid molecule, and the lentivirus contains the nucleic acid molecule.

[0012] More preferably, according to the above application, the nucleic acid molecule is at least one of shRNA, microRNA, and siRNA.

[0013] According to the above application, more preferably, the shRNA is shRNA1 or / and shRNA2, the nucleotide sequence of shRNA1 is: CCGATGAAGAACAGCAAGAAA, and the nucleotide sequence of shRNA2 is: GCAGAGCTGGTGATGTTTATG.

[0014] According to the above application, preferably, the bio-nanomaterial is a DNA nanoflower formulation targeting diffuse large B-cell lymphoma.

[0015] According to the above application, preferably, the DNA nanoflower preparation is prepared from a phosphorylated DNA template by a circular ligation reaction and a rolling circle amplification reaction; the DNA template contains a complementary sequence to the target sequence, and the target sequence contains a DNAzyme that downregulates the expression of SDAD1 protein, the nucleotide sequence of the DNAzyme being: 5'-TTGGTCCATCAGGCTAGCTACAACGACCTCAGATTCG-3'.

[0016] The target sequence also contains LC1, an aptamer for CD19 that targets lymphoma. The nucleotide sequence of LC1 is: 5'-TTTTTGCGTGTGTAGTGTGTCTGTTCTCCTTTTTTTGGTTGCTGCTCTTAGGGATTTGG GCGG-3'.

[0017] A fourth aspect of the present invention provides a medicament for the prevention, relief, and / or treatment of diffuse large B-cell lymphoma, the medicament containing a substance that inhibits the expression and / or function of SDAD1.

[0018] According to the above-mentioned drug, preferably, the drug is used to prevent, alleviate or treat diffuse large B-cell lymphoma, and the drug contains a substance that inhibits the expression and / or function of the SDAD1 gene.

[0019] More preferably, according to the above-mentioned drug, the nucleic acid molecule is at least one of shRNA, microRNA, and siRNA.

[0020] According to the above-mentioned drug, more preferably, the shRNA is shRNA1 or / and shRNA2, the nucleotide sequence of shRNA1 is: CCGATGAAGAACAGCAAGAAA, and the nucleotide sequence of shRNA2 is: GCAGAGCTGGTGATGTTTATG.

[0021] According to the above-mentioned drug, preferably, the bio-nanomaterial is a DNA nanoflower formulation targeting diffuse large B-cell lymphoma.

[0022] According to the above-mentioned drug, preferably, the DNA nanoflower preparation is prepared by phosphorylated DNA template through a circular ligation reaction and a rolling circle amplification reaction; the DNA template contains a complementary sequence to the target sequence, the target sequence contains a DNAzyme that downregulates the expression of SDAD1 protein, and the nucleotide sequence of the DNAzyme is: 5'-TTGGTCCATCAGGCTAGCTACAACGACCTCAGATTCG-3'.

[0023] According to the aforementioned drug, preferably, the target sequence further contains an aptamer LC1 that targets CD19 in lymphoma, and the nucleotide sequence of the aptamer LC1 is: 5'-TTTTTGCGTGTGTAGTGTGTCTGTTCTCCTTTTTTTGGTTGCTGCTCTTAGGGATTTGG GCGG-3'.

[0024] According to the above-described drug, preferably, the drug further contains a pharmaceutically acceptable carrier / excipient.

[0025] The fifth aspect of the present invention provides a biomarker for predicting the prognosis of diffuse large B-cell lymphoma, said biomarker being the SDAD1 gene or SDAD1 protein.

[0026] The sixth aspect of this invention provides the use of a reagent for detecting the expression level of the biomarker described in the fourth aspect in the preparation of a product for prognostic prediction of diffuse large B-cell lymphoma.

[0027] According to the above application, preferably, the product is used to detect the expression level of the biomarker in the sample by RT-PCR, real-time quantitative PCR, in situ hybridization, western blotting, chip or high-throughput sequencing platform.

[0028] Preferably, high expression of SDAD1 indicates a poor prognosis and is significantly associated with shortened overall survival (OS) or progression-free survival (PFS).

[0029] Compared with the prior art, the beneficial effects of the present invention are:

[0030] (1) This invention is the first to discover that patients with high SDAD1 expression had significantly shorter progression-free survival and overall survival than those with low expression, suggesting that high SDAD1 expression is associated with poor prognosis in DLBCL patients. A knockdown model of the SDAD1 gene was constructed, and it was found that low SDAD1 expression can induce cell cycle arrest, apoptosis, and slowed proliferation in diffuse large B-cell lymphoma tumor cells, indicating that SDAD1 is a potential therapeutic target for DLBCL. Developing drugs that inhibit SDAD1 expression levels is expected to provide a new strategy for the treatment of DLBCL.

[0031] (2) The present invention prepared an LC1-DNAzyme drug that can effectively inhibit the expression of SDAD1 gene, which can specifically recognize DLBCL cells and inhibit tumor cell proliferation and promote tumor cell apoptosis. The drug was verified to be effective in treating lymphoma and has good safety through a mouse tumor-bearing model. Attached Figure Description

[0032] Figure 1Western blotting was used to detect Cas9 protein expression.

[0033] Figure 2 The screening results for lethal genes in a gene library related to replication pressure and drug resistance in diffuse large B-cell lymphoma (DLBCL) were presented. SDAD1 was the most significantly different gene among all lethal genes in DLBCL, showing high expression and association with poor prognosis in DLBCL patients. The findings included: a) changes in sgRNA in the DLBCL cell line OCI-LY8 after 14 days of screening; b) a graph of SDAD1 mRNA expression levels analyzed using the GEPIA database; and c) a graph showing the correlation between SDAD1 expression and prognosis in DLBCL patients.

[0034] Figure 3 This study investigated the expression of SDAD1 in OCI-LY8 cells after constructing a stable low-expression SDAD1 knockdown strain using a lentiviral vector and examined its effects on cell cycle. The findings included: a. RT-qPCR detection of SDAD1 mRNA expression level; b. Western blotting detection of SDAD1 protein expression level; c. Effect of low SDAD1 expression on cell proliferation; d. Effect of low SDAD1 expression on apoptosis; and e. Effect of low SDAD1 expression on cell cycle.

[0035] Figure 4 This section describes the screening of DNAzyme sequences targeting SDAD1 and the characterization of the formulation synthesis of DNA nanoflowers. Specifically: ac. TEM images of DZ, DNAzyme, and LC1-DNAzyme, respectively; d. Agarose gel electrophoresis image of LC1-DNAzyme; e. and f. EDS and mapping elemental analysis images of LC1-DNAzyme, respectively; g. Particle size distribution of LC1-DNAzyme; h. Zeta potential images of DZ, DNAzyme, and LC1-DNAzyme; i. Particle size distribution of DZ, DNAzyme, and LC1-DNAzyme.

[0036] Figure 5This study examines the in vitro formulation stability, degradation characterization, and safety of DNA nanoflowers, including: a. SEM images of LC1-DNAzyme after 100-fold dilution with DEPC and incubation for 1 hour; b. Agarose gel electrophoresis images of LC1-DNAzyme after 20 minutes of high-temperature treatment at 95°C; agarose gel electrophoresis images of LC1-DNAzyme after incubation with DNase I (2 U / mL) at 37°C for 1 hour; and agarose gel electrophoresis images of LC1-DNAzyme after treatment with 10% fetal bovine serum for 1 hour; c. SEM images and particle size distribution of LC1-DNAzyme at pH 7.4 and pH 5.5; e. Particle size changes of LC1-DNAzyme in PBS solution over 7 days; f. Hemolysis rates of DNAzyme and LC1-DNAzyme at different concentrations.

[0037] Figure 6 The in vitro antitumor effects of DNA nanoflowers are shown in the following figures: a. Fluorescence images of live and dead cells of OCI-Ly8 cells after treatment with different formulations; b. Fluorescence images of live and dead cells of BV2 cells after treatment with different formulations; c. Fluorescence images of live and dead cells of KYSE450 cells after treatment with different formulations; d. Cell viability of OCI-Ly8 cells after treatment with different concentrations of LC1-DNAzyme; e. Cell viability of OCI-Ly8 cells after different treatments; f. Cell viability of BV2 cells after different treatments; g. Cell viability of KYSE450 cells after different treatments; h. Flow cytometry images and quantitative statistical graphs of OCI-Ly8 cells after different treatments.

[0038] Figure 7 This study validates the antitumor mechanism of DNA nanoflower drugs, including: a. confocal images of OCI-Ly8 cells taking up different formulations; b. semi-quantitative fluorescence analysis; c. confocal images of the regulation of SDAD1 protein expression in OCI-Ly8 cells by different formulation groups; d. semi-quantitative fluorescence analysis; e. schematic diagram of the antitumor mechanism of DNA nanoflowers.

[0039] Figure 8 This study validates the in vivo tumor targeting and anti-tumor effects of DNA nanoflowers, including: a. in vivo fluorescence images of lymphoma-bearing mice treated with different formulations; b. in vitro fluorescence images of lymphoma-bearing mice treated with different formulations; c. tumor tissue photographs of different treatment groups on day 14 after treatment; d. relative tumor volume of different treatment groups during the 14-day treatment period; e. weight changes of mice in different treatment groups over 14 days. Detailed Implementation

[0040] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0041] Example 1: Screening process for DLBCL replication stress-related drug resistance genes

[0042] The specific steps for building a CRISPR / Cas9 screening system are as follows:

[0043] 1. Take 5 × 10 6 Personally derived diffuse large B-cell lymphoma OCI-LY8 cells were configured at 1×10⁻⁶ cells. 5 Cell suspension of cells / mL was seeded into 12-well plates, with a seeding volume of 1 mL per well;

[0044] 2. The titer of the CRISPR / Cas9 gene knockout library lentivirus (purchased from Genewiz Biotechnology Co., Ltd.) was adjusted to 4 × 10⁻⁶. 9 TU / mL, and add 2.5 μL to each well of the 12-well plate. Add 20 μL of Hitrans GP to each well, mix well, and centrifuge at 1000g for 30 min.

[0045] 3. After 12 hours, add 1 mL of solution to each well, change the solution after 24 hours, and start screening with puromycin after 48 hours;

[0046] 4. OCI-LY8 cells were counted and the medium was changed every 2 days. After 7 days, the selection was completed. The cells were then cultured in medium containing puro. On the 12th day, Western blotting was performed to verify the expression of Cas9 protein.

[0047] 5. After verifying the successful expression of Cas9 protein, OCI-LY8 cells were cultured for 14 days to screen for lethal genes. Cells before culture were designated as the Plasmid group. After 14 days of culture, cells with the lethal gene knocked out died, and the surviving cells contained the lethal gene (designated as the Fitness group). This process continued until day 26 after lentivirus infection.

[0048] 6. Genomic DNA was extracted from OCI-LY8 cells after screening. Two rounds of PCR amplification were performed to introduce complete sequencing adapters and indices. After separation by agarose gel, the recovered products were used together with the library plasmids for next-generation DNA sequencing on the Illumina platform.

[0049] The specific steps for verifying Cas9 protein expression using Western blotting in step 5 are as follows:

[0050] (1) Protein extraction

[0051] 1) Cell counting: Take 1×10⁻⁶ cells based on the counting results. 6 The cell suspension corresponding to each cell was placed in a 15mL centrifuge tube and centrifuged at 800rpm for 5min.

[0052] 2) After discarding the supernatant, resuspend the cell pellet in PBS solution pre-cooled at 4°C into a 1.5 mL microtube, centrifuge at 300 g for 5 min, discard the supernatant, and repeat twice;

[0053] 3) Lyse cells with 50 μL of RIPA cell lysis buffer containing protease inhibitors, phosphatase inhibitors, and deacetylase inhibitors;

[0054] 4) Use a cell sonicator to sonicate the sample at an energy of 2J;

[0055] 5) Vortex the sample and place it on ice for 8 minutes. Repeat 3 times.

[0056] 6) Centrifuge at 12000 rpm for 20 minutes in a centrifuge pre-cooled at 4℃;

[0057] 7) Transfer the supernatant to a new 1.5 mL microtube, quantify the BCA protein, add 5× protein loading buffer, mix well, heat at 95℃ for 5 min, centrifuge briefly, and store at -80℃.

[0058] (2) Protein quantification

[0059] 1) Draw 30 μL of protein standard with a concentration of 5 mg / mL and add 270 μL of PBS and mix well;

[0060] 2) Take a 96-well plate and add 0 μL, 2 μL, 4 μL, 6 μL, 8 μL, 12 μL, 16 μL, and 20 μL of protein standard diluted to 0.5 mg / mL, respectively. Add 3 wells for each concentration and prepare a standard curve.

[0061] 3) Add 2 μL of the sample to each well. To ensure the accuracy and reliability of the experimental data, set up 3 replicates for each sample.

[0062] 4) Add PBS solution to both the standard and sample wells to a total volume of 20 μL;

[0063] 5) Mix Cu solution and BCA solution at a ratio of 1:50, and add 200 μL to each well;

[0064] 6) Incubate at 37℃ in the dark for 15 minutes;

[0065] 7) The absorbance of each well at 562 nm was measured using a fluorescence microplate reader;

[0066] 8) Plot a standard curve corresponding to mass and absorbance based on the mass and absorbance of the standard. Calculate the protein amount corresponding to each well based on the average OD value of the sample, and divide by 2 to obtain the corresponding protein concentration.

[0067] (3) Western blotting

[0068] 1) Heat the loaded protein sample at 95°C for 5 minutes, then centrifuge briefly.

[0069] 2) After adding 10 μg of sample to each sample, start electrophoresis: electrophoresis at 80V for 30 min, then adjust to 120V for 60 min, until the blue loading reaches the bottom.

[0070] 3) After activating the PVDF membrane in methanol for 20 seconds, it is then placed in the electroporation solution for equilibration;

[0071] 4) Prepare the sandwich structure: Soak the filter screen and filter paper in the pre-cooled electrotransfer solution at -20℃ until fully saturated. Place them on the clamp, carefully remove the glue and place it on the filter paper, cover it with the PVDF membrane, and place them in the order of filter paper-glue-PVDF membrane-filter paper. Use a roller to carefully remove the air bubbles between the glue and the PVDF membrane, and clamp the sandwich structure tightly.

[0072] 5) Place the electrophoresis tank in an ice-water mixture for membrane transfer. The transfer conditions are 90V for 70 minutes.

[0073] 6) Carefully remove the PVDF membrane and place it in an antibody incubation box. Block it at room temperature for 1 hour with TBST solution containing 5% BSA or skim milk.

[0074] 7) Incubate the primary antibody overnight at 4°C with low-speed shaking on a shaker;

[0075] 8) Wash the membrane three times with TBST solution at medium speed on a shaker, 10 min each time;

[0076] 9) Incubate the secondary antibody on a shaker at low speed for 1 hour at room temperature;

[0077] 10) Wash the membrane three times with TBST solution at medium speed on a shaker, 10 min each time;

[0078] 11) Images were acquired after development with ECL reagent.

[0079] Western blotting verification results are as follows: Figure 1 As shown, by Figure 1This indicates that the Cas9 protein was successfully expressed.

[0080] Sequencing data were analyzed using the RRA (Robust Rank Aggregation) algorithm in MAGeCK software. The sgRNA abundance was compared between the Fitness and Plasmid groups. The raw statistical p-values ​​(neg / p-value), False Discovery Rate (neg / FDR), and log2 Fold Change (log2(FC)) for each gene under negative selection were obtained. The results are as follows: Figure 2 As shown in figure a. The screening criteria were set as p < 0.05 and log2(FC) < -1, resulting in the identification of 94 lethal genes. Among them, SDAD1 (p < 0.0000315, log2(FC) = -3.7287) showed the most significant difference.

[0081] The expression differences of SDAD1 at the mRNA level in DLBCL tumor tissues (n=48) and normal lymph node tissues (n=337) were analyzed using the GEPIA database (http: / / gepia.cancer-pku.cn). The differences between groups were analyzed using a t-test. The results are as follows: Figure 2 As shown in b. The results showed that SDAD1 was highly expressed in DLBCL, and the expression was statistically significant (p < 0.05).

[0082] High-throughput sequencing datasets of DLBCL patients were retrieved from the GEO database, and gene expression profiling dataset GSE31312 with follow-up information for 470 patients was found. The probe with the highest SDAD1 expression level was selected, and the patients were divided into high-expression (Q4, n=115) and low-expression (Q1-3, n=355) groups based on SDAD1 expression quartiles. Survival curves were analyzed using Kaplan-Meier and Log-Rank methods, and the results are as follows: Figure 2 As shown in c and d, the progression-free survival (PFS, HR = 1.418, p = 0.033) and overall survival (OS, HR = 1.743, p = 0.0005) of patients in the SDAD1 high expression group were significantly shorter than those in the low expression group, suggesting that high expression of SDAD1 is associated with poor prognosis in DLBCL patients.

[0083] Example 2: Construction of a SDAD1 gene knockdown model and its effects on DLBCL cells

[0084] I. Construction of the SDAD1 gene knockdown model

[0085] This invention constructed two lentiviral vectors carrying GFP targeting SDAD1: shRNA1 lentiviral vector and shRNA2 lentiviral vector. The shRNA1 lentiviral vector contains shRNA1, with the target sequence CCGATGAAGAACAGCAAGAAA (SEQ ID NO.1), while the shRNA2 lentiviral vector contains shRNA2, with the target sequence GCAGAGCTGCTGGTGATGTTTATG (SEQ ID NO.2). The shRNA1 and shRNA2 lentiviral vectors were packaged into lentiviruses, and the corresponding viral particles were collected to infect the OCI-LY8 cell line, resulting in two engineered OCI-LY8 cell lines with stable low expression of SDAD1: LY8-shSDAD1#1 and LY8-shSDAD1#2, denoted as the shSDAD1#1 group and shSDAD1#2 group, respectively. An empty vector was used as a control group, denoted as the Vector group. The specific process is as follows:

[0086] (1) OCI-LY8 cell culture

[0087] 1) Observe cell state and density to determine the appropriate passage ratio;

[0088] 2) Mix the cell suspension well and transfer it to a 15mL centrifuge tube according to the required ratio;

[0089] 3) Centrifuge at 800 rpm / min for 5 minutes, then discard the supernatant;

[0090] 4) Resuspend the cell pellet in 10 mL of fresh complete culture medium and transfer it to a T25 culture flask;

[0091] 5) Place the cell culture flask in an incubator at 37°C and 5% CO2 for static culture.

[0092] (2) Cell counting

[0093] Mix the cell suspension in the culture flask thoroughly. Transfer the desired amount to a 15 mL centrifuge tube and centrifuge at 800 rpm for 5 min. Discard the supernatant. Resuspend the pellet in 5 mL of fresh complete culture medium and mix well. Transfer 100 μL of the mixed cell suspension to a 1.5 mL microtube, add 100 μL of 0.4% trypan blue solution and 800 μL of PBS solution, and mix thoroughly by pipetting. Transfer 10 μL of the mixed solution into a counting chamber. Count the cells by recording the top count and the left count, excluding the bottom and right counts, and calculate the cell density.

[0094] (3) Cell plating and lentiviral infection

[0095] After cell counting, the cells were prepared at a density of 1×10⁶ cells / year using serum-free medium. 5 Cell suspensions of cells / mL were prepared. Two lentiviruses carrying GFP-containing shRNA were diluted to a titer of 1 × 10⁻⁶ cells / mL using MEM medium. 8 TU / mL was used to infect OCI-LY8 cells. In an uncoated 12-well cell culture plate, 1 mL of cell suspension was seeded into each well, and lentivirus infection was performed at an MOI of 20 (virus volume = (MOI × cell number) / virus titer). After incubation at 37°C for 12 h, 1 mL of complete culture medium was added to each well. 24 h after replenishment, cells were collected, centrifuged at 800 rpm for 5 min, the supernatant was discarded, and the cells were resuspended in fresh culture medium and seeded into 6-well plates.

[0096] All plasmids used in this invention are puromycin (puro) resistant. After the cells have expanded to a certain number, each group of cells is divided into two parts: one part is used for seed preservation, and the other part is used for selection at the concentration of 2 μg / mL recommended in the instructions. When all wild-type control cells die, it is considered that pure cells have been selected, and subsequent culture is maintained using a low concentration of puromycin (1 μg / mL). In this invention, cell selection begins 72 hours after infection, and the cells required for the experiment can be obtained after 3-4 rounds of selection.

[0097] II. Effects of SDAD1 gene knockdown on DLBCL cells

[0098] 1. Experimental Methods

[0099] (1) RT-qPCR (Real-time Quantitative PCR)

[0100] The expression level of SDAD1 in the OCI-LY8 engineered cell lines LY8-shSDAD1#1 and LY8-shSDAD1#2 was detected by RT-qPCR. The specific procedure is as follows:

[0101] 1) Use the Tiangen RNA Extraction Kit to extract RNA according to the instructions;

[0102] 2) Reverse transcription: The RNA from step 1) is reverse transcribed to synthesize cDNA. This process involves two steps: removing genomic DNA and reverse transcription. The specific steps are as follows:

[0103] (a) Thaw the RNA solution and all reagents in the Takara reverse transcription kit on ice;

[0104] (b) gDNAEraser and Prime Script RT Enzyme Mix I were centrifuged using a handheld centrifuge;

[0105] (c) Mix 5×gDNAEraser Buffer and 5X Prime Script Buffer 2 (for Real Time) by vortexing and then centrifuge gently;

[0106] (d) Prepare the reagents required to remove genomic DNA on ice. The specific amounts are shown in Table 1 below. Heat the prepared reaction system at 42°C for 2 min in a PCR instrument.

[0107] Table 1. Genomic DNA Removal Reaction System

[0108] Reagent Name Usage 5×gDNAEraserBuffer 2μL gDNAEraser 1μL RNA 1μg <![CDATA[ddH2O]]> Up to 10 μL

[0109] (e) Prepare the reagents required for reverse transcription on ice. The reverse transcription reaction system is shown in Table 2.

[0110] Table 2 Reverse transcription reaction system

[0111] Reagent Name Usage / μL The above reaction has removed genomic DNA from the solution. 10 PrimeScriptRTEnzymeMixI 1 RTPrimerMix 1 5×PrimeScriptBuffer2(forRealTime) 4 RNaseFreeH2O 4

[0112] (f) The above reaction system was reverse transcribed according to the procedure in Table 3 to obtain cDNA products.

[0113] Table 3 Reverse Transcription Procedure

[0114] Temperature / °C Time / min 37 15 85 5s 4 ∞

[0115] 3) Real-time quantitative PCR was used to detect the relative expression level of SDAD1;

[0116] Using the above cDNA product as a template, dilute it 10-fold with ddH2O before use. (The last part, "based on...", appears to be a separate, unrelated sentence fragment and is left untranslated.) Real-time polymerase chain reaction with Green I fluorescence was used to detect the expression level of target gene mRNA. The specific procedure is as follows:

[0117] (a) After all reagents have melted, prepare the reaction system according to Table 4;

[0118] Table 4 Real-time quantitative PCR reaction system

[0119]

[0120] Using GAPDH as an internal control, the expression level of the target gene mRNA was detected by RT-qPCR. The primer sequences are as follows:

[0121] SDAD1_qPCR_F:ACATCGAGGAGTTTCTACAGCA(SEQ ID NO.3);

[0122] SDAD1_qPCR_R: AGGTACTCTGGGTAGCAGTGA (SEQ ID NO.4);

[0123] GAPDH-F: GGACGAGATCCCTCCAAAAT (SEQ ID NO. 5);

[0124] GAPDH-R: GGCTGTTGTCATACTTCTCATGG (SEQ ID NO. 6);

[0125] (b) The reaction procedure is shown in Table 5;

[0126] Table 5 Real-time quantitative PCR reaction procedure

[0127] Temperature / °C time Loop count Pre-variation 95 60 1 transsexual 95 15 40 annealing 55 15 40 extend 72 45 40 (Data Collection) 4 ∞ 1

[0128] (c) After collecting the data, the relative expression level of mRNA was calculated using the 2-ΔΔCT method.

[0129] (2) Western blotting

[0130] The expression level of SDAD1 protein in the OCI-LY8 engineered cell lines LY8-shSDAD1#1 and LY8-shSDAD1#2 was detected by Western blotting. The specific procedure was the same as in Example 1.

[0131] (3) Flow cytometry detection of cell apoptosis

[0132] Apoptosis in the OCI-LY8 engineered cell lines LY8-shSDAD1#1 and LY8-shSDAD1#2 was detected by flow cytometry. The specific experimental procedures are as follows:

[0133] 1) Collect the cells to be tested into a 15mL centrifuge tube, centrifuge at 800rpm for 5min, and discard the supernatant;

[0134] 2) After resuspending in PBS, centrifuge at 800 rpm for 5 min, discard the supernatant, and repeat twice;

[0135] 3) Prepare 1× Binding Buffer by mixing 10× Binding Buffer with deionized water to make 1× Binding Buffer, and resuspend each sample in 100 μL of Binding Buffer;

[0136] 4) Add 5 μL of Annexin-V antibody and 5 μL of 7-AAD antibody respectively, and mix well;

[0137] 5) Incubate at room temperature in the dark for 30 minutes;

[0138] 6) Add 400 μL of Binding Buffer to each sample, mix well, and load the sample into the instrument as soon as possible.

[0139] (4) CCK8 assay for cell viability

[0140] The cell proliferation activity of OCI-LY8 engineered cell lines LY8-shSDAD1#1 and LY8-shSDAD1#2 was detected using the CCK8 assay. The specific experimental procedures are as follows:

[0141] 1) When the cells are in good condition, perform cell counting;

[0142] 2) Based on the cell count results, configure the cells to 1×10⁶. 5 Cell suspension of cells / mL;

[0143] 3) Take a 96-well plate, set up 3 replicates for each type of cell, and add 100 μL of the corresponding cell suspension to each well according to the experimental design. Pay attention to mixing the cell suspension during the experiment.

[0144] 4) Set up blank control wells with only 100 μL of culture medium, and add 200 μL of PBS to the remaining wells around the perimeter to prevent evaporation;

[0145] 5) Set five time periods: 0h, 24h, 48h, 72h, and 96h;

[0146] 6) After culturing the cells in a 37°C, 5% CO2 incubator for the corresponding time, add 10 μL of CCK-8 solution to each well;

[0147] 7) Incubate in a cell culture incubator in the dark for 2 hours;

[0148] 8) Measure its absorbance at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader.

[0149] (5) Flow cytometry for cell cycle detection

[0150] The cell cycle of the OCI-LY8 engineered cell lines LY8-shSDAD1#1 and LY8-shSDAD1#2 was detected by flow cytometry. The specific experimental procedures are as follows:

[0151] 1) Collect the cell suspension from the culture flask into a 15mL centrifuge tube, centrifuge at 800rpm for 5min, and discard the supernatant;

[0152] 2) The cell pellet was resuspended in fresh complete culture medium and mixed well before cell counting.

[0153] 3) Based on the cell count results, configure the cells to a density of 1×10⁻⁶. 5 Cell suspension of cells / mL;

[0154] 4) Inoculate 3 mL into each well of a six-well plate, and set up 3 replicate wells for each cell type. Incubate at 37°C and 5% CO2 for 48 h.

[0155] 5) Collect cells after 48 hours, centrifuge at 800 rpm for 5 minutes, and discard the supernatant;

[0156] 6) Resuspend the cells in PBS solution pre-cooled to 4°C, centrifuge at 800 rpm for 5 min, discard the supernatant, and repeat twice;

[0157] 7) Gently mix with pre-cooled 70% ethanol at -20℃ and fix the cells overnight at 4℃;

[0158] 8) On the second day, wash twice with 5 mL of pre-cooled PBS solution at 4°C;

[0159] 9) Prepare propanediol iodide (PI) solution and RNase A solution at a ratio of 9:1, mix well and set aside for later use;

[0160] 10) Add 0.5 mL of the prepared PI staining solution to each sample tube, slowly and thoroughly resuspend the cell pellet, transfer it to a flow cytometer tube, incubate at room temperature in the dark for 1 hour, and then perform the analysis.

[0161] 2. Experimental Results

[0162] (1) Results of RT-qPCR and Western Blotting:

[0163] The results of RT-qPCR and Western blotting are as follows: Figure 3 As shown in Figure A. Figure 3 As shown in A, the expression level of SDAD1 in both cells was significantly reduced after lentiviral infection.

[0164] (2) Flow cytometry results of apoptosis detection:

[0165] The results of flow cytometry analysis of the effect of SDAD1 on apoptosis are as follows: Figure 3 As shown in B, low expression of SDAD1 induced a significant increase in apoptosis levels in OCI-LY8 cells (14.7% ± 0.11% vs 4.46% ± 0.16%, p < 0.0001; 27.36% ± 0.13% vs 4.46% ± 0.16%, p < 0.0001).

[0166] (3) Results of CCK-8 assay for cell proliferation activity:

[0167] The results of cell counting and CCK-8 assays on the effect of SDAD1 on cell growth are as follows: Figure 3As shown in Figure C, low expression of SDAD1 significantly inhibited the growth of OCI-LY8 cells. CCK-8 measurements on day 4 showed that, compared to day 1, the proliferation rates of both SDAD1 knockdown cell lines were significantly slower (10.28±0.12 vs 16.59±0.55, p<0.0001; 6.18±0.99 vs 16.59±0.55, p<0.0001).

[0168] (4) Flow cytometry results of cell cycle detection:

[0169] The results of flow cytometry analysis of the effect of SDAD1 on the OCI-LY8 cell cycle are as follows: Figure 3 As shown in Figure D, low expression of SDAD1 induced cell cycle arrest in OCI-LY8 cells at the G1 phase (28.28% ± 2.04% vs 24.04% ± 1.64%, p = 0.049; 36.98% ± 2.14% vs 24.04% ± 1.64%, p = 0.001).

[0170] The above results indicate that knockdown of the SDAD1 gene significantly reduced SDAD1 expression levels, significantly increased apoptosis levels, and significantly slowed cell proliferation in DLBCL cells. Low expression of SDAD1 induced cell cycle arrest in OCI-LY8 cells at the G1 phase, suggesting that knockdown of the SDAD1 gene has an inhibitory effect on DLBCL cells.

[0171] Example 3: Preparation, synthesis, and characterization of LC1-DNAzyme formulation targeting lymphoma and downregulating SDAD1 protein.

[0172] I. Preparation of L-SD Nanoparticles

[0173] The full-length mRNA sequence of the SDAD1 gene was obtained from NCBI. Suitable cleavage sites were identified on the mRNA, typically 5'-...GUC...-3'. A DNAzyme sequence was designed, consisting of a fixed sequence and binding arms. The fixed sequence catalyzes the SDAD1 target gene, while the binding arms are located flanking the fixed sequence (core catalytic domain) (5'-arm-core-arm-3'). The fixed sequence is 5'-GGCTAGCTACAACGA-3', and the binding arms are perfectly complementary to the SDAD1 mRNA sequence. BLAST was used to align the binding arm sequences to ensure binding only to the target gene.

[0174] The relationship between DNAzyme and SDAD1 is a targeted catalytic cleavage regulatory relationship. At its core, it involves sequence-specific recognition of the target gene's mRNA and catalytic cleavage to inactivate it, thereby downregulating gene expression at the post-transcriptional level.

[0175] The specific preparation steps of LC1-DNAzyme nanoparticles are as follows:

[0176] (1) Circulation reaction of DNA template strand: First, a phosphorylated DNase template and primers encoding SDAD1 mRNA were designed. The phosphorylated DNase template (final concentration 1 μM) containing the DNase sequence targeting SDAD1 mRNA was mixed with primers (as bridging short strands, complementary to both ends of the template, final concentration 1 μM) in T4 DNA ligase buffer (1×), mixed evenly with a pipette, reacted at 95℃ for 5 min, and slowly cooled to 25℃ at a rate of 0.1℃ / s. The annealed product was mixed with T4 DNA ligase (final concentration 0.25 U / μL), incubated at room temperature for 3 h, and then a circularization reaction was performed to obtain a circular DNA template.

[0177] The DNase template contains a complementary sequence to the target sequence; the target sequence is obtained by combining the aptamer LC1, which targets lymphoma CD19, with a DNAzyme. This sequence can both target lymphoma and downregulate the SDAD1 protein. The DNAzyme sequence is: 5'-TTGGTCCATCAGGCTAGCTACAACGACCTCAGATTCG-3' (SEQ ID NO.7), and the aptamer LC1 sequence is: 5'-TTTTTGCGTGTGTAGTGTGTCTGTTCTCCTTTTTTTGGTTGCTGCTCTTAGGGATTTGG GCGG-3' (SEQ ID NO.8).

[0178] The nucleotide sequence of the target sequence is as follows:

[0179] 5'-TTTTTGCGTGTGTAGTGTGTCTGTTCTCCTTTTTTTGGTTGCTGCTCTTAGGGATT TGGGCGGTTGGTCCATCAGGCTAGCTACAACGACCTCAGATTCGTTTT-3' (SEQ ID NO. 9);

[0180] The DNA enzyme template sequence is:

[0181] 5'-AAAACGAATCTGAGGTCGTTGTAGCTAGCCTGATGGACCAACCGCCCAAATCCC TAAGAGCAGCAACCAAAAAAAGGAGAACAGACACACTACACACGCAAAAA-3' (SEQ ID NO. 10);

[0182] The primer sequences are:

[0183] 5'-GTGTGCGTTTTTTTTTGCTTAGAC-3' (SEQ ID NO. 11).

[0184] (2) RCA reaction: After obtaining the circular DNA template in step (1), add dNTP (final concentration of 1mM), phi29 DNA polymerase (final concentration of 0.125U / μL), phi29 DNA polymerase buffer (final concentration of 1×), and DEPC enzyme-free water to a final volume of 200μL. Mix well with a pipette and react at 37℃ for 2h. After the reaction, place the EP tube in a PCR instrument and react at 95℃ for 5min to inactivate the phi29 DNA polymerase and terminate the reaction. Centrifuge at 12000rpm for 20min, discard the supernatant, wash the precipitate with DEPC enzyme-free water, repeat three times to obtain nanoparticles, which are named LC1-DNAzyme.

[0185] In addition, a phosphorylated DNase template sequence that does not specifically recognize and bind to SDAD1 mRNA was designed. This phosphorylated DNase template sequence (excluding the aptamer LC1 sequence) and primers were prepared according to the LC1-DNAzyme nanoparticle preparation method to obtain DNAzyme nanoparticles, denoted as DNAzyme. Simultaneously, DZ nanoparticles were formed by self-assembly of the template strand without the addition of DNAzyme, denoted as DZ (DZ served as an experimental control).

[0186] II. Synthetic Characterization of LC1-DNAzyme Preparations

[0187] 1. Characterization by transmission electron microscopy

[0188] Transmission electron microscopy (TEM) projects an accelerated and focused electron beam onto a very thin sample. The electrons collide with atoms in the sample, changing direction and producing stereo scattering. With a resolution of 0.1-0.2 nm, it can observe ultrastructures smaller than 0.2 μm. DZ, DNAzyme, and LC1-DNAzyme, washed with ultrapure water, were dissolved in an aqueous solution, and 5 μL was added dropwise onto a copper grid specifically designed for TEM analysis. After complete drying, the morphology, size, and dispersion of the DNA nanoflowers were observed using TEM, and photographs were taken and recorded.

[0189] The TEM images of DZ, DNAzyme, and LC1-DNAzyme are as follows Figure 4As shown in Figures A, 4B, and 4C, the basic framework of DNA nanoflowers exhibits a typical "flower-like" multi-branched structure with relatively large particle sizes and a loose structure. Modifying the nanoflowers with DNAzyme did not alter their structure, indicating that the introduction of DNAzyme did not disrupt the overall morphology of the nanoflowers. DNAzyme nanoflowers loaded with LC1 showed a significantly reduced particle size and a more compact structure, suggesting that the binding of LC1 to DNAzyme may have influenced the DNA self-assembly process, leading to the formation of a more dense core in the nanoflowers.

[0190] 2. Agarose gel electrophoresis of LC1-DNAzyme

[0191] Prepare a 2% agarose gel system. Weigh 0.6 g of agarose into an Erlenmeyer flask and add 30 mL of 1×TB electrophoresis buffer. Heat the Erlenmeyer flask in a microwave oven until all the white powder dissolves. Add 6 μL of nucleic acid dye, gently shake to mix, avoiding air bubbles. While still hot, quickly pour the agarose gel solution into a pre-washed gel plate, observe for air bubbles, insert a comb, and wait for solidification. Once the gel has completely solidified, gently remove the comb, place the gel plate in the electrophoresis tank, and pour in 1×TB electrophoresis buffer to cover the gel surface by at least 1 mm. Mix the DNA loading marker, phosphorylated DNA template strand, primer strand, circular DNA template, and LC1-DNAzyme with 6× DNA loading buffer (final concentration 1×), and add them sequentially to the wells of the agarose gel. Electrophoresis is performed at 120 V for 50 min. After electrophoresis, remove the gel plate and image it using a gel imaging system under dark conditions.

[0192] Agarose gel electrophoresis image of LC1-DNAzyme as shown below Figure 4 As shown in D, by Figure 4 As shown in D, LC1-DNAzyme successfully constructed a circular template and amplified to generate nanoflowers. Template / Primer band: shows the linear template and primers before DNA circularization. Circle DNA band: a slow-migrating band higher than the linear template indicates successful circularization. DNF band: a very high molecular weight band appears near the pores, indicating that the nanoflowers are highly aggregated DNA self-assembled structures with low migration.

[0193] 3. EDS and mapping characterization

[0194] X-ray energy dispersive spectroscopy (EDS) and mapping are methods to determine the elements contained in LC1-DNAzyme and further verify the successful preparation of nano-formulations. After the LC1-DNAzyme is ultrasonically mixed evenly, an appropriate amount is dropped onto a copper grid. After the sample dries, the LC1-DNAzyme is imaged with TEM and then subjected to EDS and mapping analysis.

[0195] EDS plot and mapping elemental analysis of LC1-DNAzyme are as follows: Figure 4 Figures E and 4F show the composition and elemental distribution of the LC1-DNAzyme. Mapping results show the presence of C, N, O, P, and Mg. 2- Uniformly distributed throughout the nanoflower ( Figure 4 E), EDS spectroscopy detected obvious C, N, O, and P signals and a Mg peak (E). Figure 4 F) proves that the product has a typical DNA backbone structure, and Mg 2+ Ions participate in the catalysis and stabilization of nanoflowers.

[0196] 4. DLS characterization

[0197] LC1-DNAzym was sonicated until the sample was evenly dispersed and free of precipitate. 10 μL of LC1-DNAzym was diluted to 1 mL with ultrapure water. 1 mL of the solution was added to a particle size potential cuvette. The particle size and zeta surface potential of LC1-DNAzym were detected by DLS.

[0198] The particle size distribution of LC1-DNAzyme is shown in the figure. Figure 4 As shown in Figure G, the LC1-DNAzyme distribution is concentrated in the 150–250 nm range, exhibiting a unimodal distribution. This indicates that the LC1-DNAzyme has good uniformity, and its particle size distribution meets the nanoscale range required for drug delivery, which is beneficial for cellular uptake. The Zeta potential diagrams of DZ, DNAzyme, and LC1-DNAzyme are shown below. Figure 4 As shown in Figure H, the Zeta potential of DZ and DNAzyme is around -20mV, indicating a typical negative charge on the DNA surface. The Zeta potential of LC1-DNAzyme rises slightly to nearly -10mV, suggesting that the introduction of LC1 partially neutralizes the negative charge. This potential change indirectly proves the successful modification of LC1, and the potential approaching -10mV may enhance cell membrane interactions. The particle size distributions of DZ, DNAzyme, and LC1-DNAzyme are shown below. Figure 4 As shown in Figure I, the particle size of LC1-DNAzyme is smaller than that of DZ and DNAzyme.

[0199] In summary, the multidimensional characterization results, including TEM, DLS, Zeta potential, and EDS, jointly demonstrate the successful construction of LC1-DNAzyme, which possesses uniform nanoscale particle size, a stable DNA backbone, and good surface charge characteristics, making it suitable for subsequent drug delivery and functional validation.

[0200] 5. In vitro stability characterization

[0201] 1) The LC1-DNAzyme was ultrasonically mixed thoroughly. An appropriate amount of LC1-DNAzyme was diluted 100-fold with DEPC enzyme-free water and incubated at 4℃ for 1 hour. Its morphology was then analyzed by SEM. The results are as follows: Figure 5 As shown in A, by Figure 5 As shown in Figure A, the morphology of the LC1-DNAzyme did not change after one hour of in vitro placement, indicating that the LC1-DNAzyme is morphologically stable at 4℃ and has good in vitro stability.

[0202] 2) Take an appropriate amount of LC1-DNAzyme, mix it evenly by sonication, heat it at 95℃ for 20 min, and test the heat resistance stability of LC1-DNAzyme by agarose gel electrophoresis. The agarose gel electrophoresis procedure is the same as above, and the results are as follows. Figure 5 As shown in Figure B on the left;

[0203] Take an appropriate amount of LC1-DNAzyme, mix it thoroughly by sonication, add DNase I (final concentration 2 U / mL), and incubate at 37℃ for 1 h. The stability of LC1-DNAzyme against nucleases is then detected by agarose gel electrophoresis. The results are as follows: Figure 5 As shown in the middle image (B);

[0204] An appropriate amount of LC1-DNAzyme was ultrasonically mixed and added to DMEM high-glucose medium containing 10% fetal bovine serum. The mixture was incubated at 37°C for 1 hour. Serum stability of LC1-DNAzyme was detected by agarose gel electrophoresis. The results are as follows: Figure 5 As shown in Figure B on the right, by Figure 5 It can be seen that LC1-DNAzyme has good in vitro stability. It does not degrade after being treated at 95℃ for 20 min, DNase I (2U / mL) at 37℃ for 1 h, or DMEM high glucose culture with 10% fetal bovine serum at 37℃ for 1 h.

[0205] 6. Acid response investigation

[0206] 1) SEM analysis

[0207] The prepared LC1-DNAzyme was uniformly dispersed by ultrasound. The LC1-DNAzyme was incubated for 12 hours at different pH conditions (5.5, 7.4). 5 μL of each LC1-DNAzyme was pipetted onto a 10×10 mm silicon wafer. After drying, the samples were sputter-coated with gold. The size and morphology of the LC1-DNAzyme incubated at different pH conditions were observed using scanning electron microscopy. The results are as follows: Figure 5 As shown in C, by Figure 5 C indicates that LC1-DNAzyme degrades in an acidic environment.

[0208] 2) Particle size analysis

[0209] LC1-DNAzyme was incubated for 12 h at different pH conditions (5.5, 7.4). 10 μL of LC1-DNAzyme was diluted to 1 mL with ultrapure water. 1 mL of this solution was added to a particle size distribution cup, and the particle size of the LC1-DNAzyme was detected using DLS. The particle size distribution results are shown below. Figure 5 As shown in D, by Figure 5 D indicates that LC1-DNAzyme degrades under acidic conditions. The changes in particle size and potential of LC1-DNAzyme over 7 days were detected by DLS, and the results are as follows... Figure 5 As shown in E, where Figure 5 The red line (E) represents the particle size of LC1-DNAzyme, and the black line (LC1-DNAzyme) represents its electrical potential. Figure 5 E indicates that the particle size and potential of LC1-DNAzyme did not change significantly after 7 days in PBS solution, demonstrating good stability.

[0210] 7. Hemolysis test

[0211] Prepare physiological saline containing 1% heparin and moisten EP tubes (10 mg heparin dissolved in 1 mL physiological saline). Collect whole blood from mice via the eyeball and place it into the heparin-moistened EP tube to prevent clotting. Centrifuge the EP tubes at 4°C and 1500 rpm / min for 5 min, discarding the supernatant plasma layer and the intermediate leukocyte and platelet layers, retaining the lower erythrocyte layer. Wash the erythrocyte layer twice with pre-cooled PBS solution at 4°C, centrifuge under the same conditions, and collect the lower layer. Dilute the obtained erythrocytes 50-fold to obtain a erythrocyte suspension. Experimental groups: PBS group, DZ group, DNAzyme group, LC1-DNAzyme group, and Triton X-100 group. The PBS group served as a negative control, and the Triton X-100 group served as a positive control. Mix 10 μL of each different concentration of the preparation with 1 mL of erythrocyte suspension, incubate at room temperature, and take representative images after 4 hours. Four hours later, the samples were centrifuged at 4℃ and 1500 rpm for 5 minutes. The condition of each group after centrifugation was recorded by photograph. The supernatant from each group was collected and placed in a 96-well plate. The absorbance at 570 nm was measured using a microplate reader. The absorbance of the Triton X-100 group was taken as 100% hemolysis rate, and the hemolysis rates of the other three groups were calculated. The hemolysis rates of different concentrations of DNAzyme and LC1-DNAzyme are shown below. Figure 5 As shown in Figure F, the hemolysis rate of each concentration of DZ, DNAzyme, and LC1-DNAzyme is less than 5%, proving that LC1-DNAzyme has good biocompatibility.

[0212] Example 4: In vitro antitumor effect verification of LC1-DNAzyme: DNA nanoflowers have good specific targeted anticancer effects.

[0213] 1. Experimental materials and their sources

[0214] Three cell types were used: human DLBCL cells OCI-Ly8, mouse microglia BV2, and human esophageal squamous cell carcinoma cells KYSE450.

[0215] 2. Experimental Methods

[0216] (1) The toxicity of LC1-DNAzyme was investigated using the live and dead cell staining method.

[0217] The cytotoxicity of LC1-DNAzyme was assessed by staining with live and dead cells. OCI-Ly8, BV2, and KYSE450 cells were respectively stained at 1×10⁻⁶ cells / cells. 5Cells were seeded at a density of cells / well in 24-well plates. PBS, DZ, DNAzyme, and LC1-DNAzyme were added to a final concentration of 110 nM, designated as Control group, DZ group, DNAzyme group, and LC1-DNAzyme group, respectively. Calcein-AM and propidium iodide (PI) were added to the cell culture medium, and the plates were incubated at 37°C for 15 min. Cell viability in each group was observed using a fluorescence microscope, and representative images were captured.

[0218] (2) CCK8 assay to investigate the toxicity of LC1-DNAzyme

[0219] To assess the biosafety of LC1-DNAzyme at the cellular level, its cytotoxicity was validated using cell viability assays. The effect of LC1-DNAzyme on the cell viability of OCI-Ly8, BV2, and KYSE450 cell lines was detected using the CCK8 assay. First, the cell viability of OCI-Ly8 cells treated with different concentrations of LC1-DNAzyme (0, 50, 75, 100, 125, and 150 nM) was examined, where 0 represents no LC1-DNAzyme treatment, and 50, 75, 100, 125, and 150 nM were used to achieve final concentrations of 0, 50, 75, 100, 125, and 150 nM, respectively. Next, the cell viability of OCI-Ly8, BV2, and KYSE450 cells after different treatment groups was examined, with the experimental groups as described above.

[0220] The specific detection process is as follows: Cells are prepared at a concentration of 1×10⁻⁶. 4 Cells were seeded at a density of 100 μL / well in 96-well plates, with 100 μL of culture medium containing 20% ​​fetal bovine serum added to each well. Five replicates were set up for each group. 100 μL of sterile PBS was added to each well at the edge of the 96-well plate to prevent culture medium evaporation. The culture medium contained different drugs. After 24 h of culture, 10 μL of CCK8 assay solution was added to each well, and the plates were incubated at 37°C in the dark for 1 h. The absorbance at 450 nm was measured using a microplate reader, and cell viability was calculated for each group according to the formula:

[0221] Cell activity = (OD) 实验组 –OD 空白 ) / (OD 对照组 –OD 空白 )×100%

[0222] Control group: Contains cells and cell culture medium, CCK-8, and no test drug;

[0223] Blank group: Contains no cells, test drug, culture medium, or CCK-8; OD represents absorbance value.

[0224] (3) In vitro detection of cell apoptosis by flow cytometry

[0225] OCI-Ly8 (5×10 per well) 5 Cells were seeded and treated with PBS, DZ, DNAzyme, and LC1-DNAzyme to a final concentration of 110 nM for 48 hours. After 48 hours, the cells were collected, washed, and resuspended in PBS, and were designated as Control group, DZ group, DNAzyme group, and LC1-DNAzyme group, respectively. Apoptosis in different groups was detected by flow cytometry using the Annexin V-FITC apoptosis detection kit.

[0226] 3. Experimental Results

[0227] (1) The toxicity of LC1-DNAzyme was investigated using the live-dead cell staining method. The results of live-dead cell staining fluorescence images of OCI-Ly8 cells, BV2 cells, and KYSE450 cells after different treatment groups are shown below. Figure 6 As shown in Figures A through 6C, it can be seen that LC1-DNAzyme can be specifically taken up by lymphoma cells and induce cell death, while having no toxicity to other cells.

[0228] (2) Cell viability graphs of OCI-Ly8 cells after treatment with different concentrations of LC1-DNAzyme are shown below. Figure 6 As shown in Figure D, the cell viability of OCI-Ly8 cells gradually decreased with increasing LC1-DNAzyme concentration. The cell viability of OCI-Ly8 cells, BV2 cells, and KYSE450 cells after different treatments is shown in Figure D. Figure 6 As shown in E-6G, the figure demonstrates the specific targeting and anti-cancer effect of LC1-DNAzyme. OCI-LY8 cells can specifically take up LC1-DNAzyme and induce cell death, while having no toxicity to other cells.

[0229] (3) OCI-Ly8 flow cytometry images and quantitative statistical graphs of different treatment groups, as shown in the figure. Figure 6 As shown in Figures H and 6I, LC1-DNAzyme treatment significantly increases apoptosis in OCI-LY8 cells.

[0230] Example 5: Antitumor mechanism of LC1-DNAzyme

[0231] 1. Confocal microscopy was used to examine cellular uptake of the LC1-DNAzyme.

[0232] The uptake of DNAzyme and LC1-DNAzyme by OCI-Ly8 cells was observed using Leica laser confocal microscopy. The specific procedure is as follows: DNAzyme and a Cy5-labeled fluorescent complementary sequence, 5'cy5-CTACACACGCAAAAA 3', were mixed at a volume ratio of 1:20, and an appropriate amount of 10×T4 DNA ligase buffer (final concentration 1×) was added. The mixture was incubated at 37°C in the dark for 1 h to obtain a Cy5-labeled DNAzyme nanocomplex, denoted as Cy5-DNAzyme. Cy5-LC1-DNAzyme was prepared using the same method.

[0233] OCI-Ly8 cells were divided into 2×10 5 Cells were seeded at a density of 1 cell / well in 24-well plates. 500 μL of serum-free DMEM high-glucose medium containing Cy5-DNAzyme and Cy5-LC1-DNAzyme were added to each well, designated as the DNAzyme group and LC1-DNAzyme group, respectively. A blank control group (Control group) was also included. After 4 hours of culture, the medium was aspirated, and 200 μL of paraformaldehyde was added to each well to fix the cells. After 15 minutes, the cells were washed 3-5 times with PBS. The cytoskeleton and nuclei of OCI-Ly8 cells were stained with phalloidin and DAPI staining solutions, respectively. The uptake of DNAzyme and LC1-DNAzyme by OCI-Ly8 cells was observed using CLSM. The results are shown below. Figure 7 As shown in Figure A, the corresponding semi-quantitative fluorescence analysis results are as follows: Figure 7 As shown in Figure B, Ly8 cells can specifically take up LC1-DNAzyme.

[0234] 2. Detection of SDAD1 expression level by immunofluorescence assay

[0235] OCI-Ly8 cells were used at 2×10 5Cells were seeded at a density of cells / well in 24-well plates. Subsequently, cells were treated with PBS, DZ, DNAzyme, and LC1-DNAzyme for 48 hours, designated as Control group, DZ group, DNAzyme group, and LC1-DNAzyme group, respectively. SDAD1 levels were then measured after incubation. The specific detection procedure was as follows: cells were fixed with 4% paraformaldehyde for 15 min, followed by permeabilization with Triton X-100 immunostaining buffer for 10 min, and then blocked with rapid blocking buffer for 30 min. Anti-SDAD1 antibody (1:200) was added, and cells were incubated overnight at 4°C. After washing with PBS, cells were incubated with Alexa Fluor 488-labeled secondary antibody for 1 hour. Finally, nuclei were stained with DAPI for 10 min, and SDAD1 expression levels in different treatment groups were observed using CLSM, and representative images were captured. Results are as follows: Figure 7 As shown in B, the corresponding semi-quantitative fluorescence analysis results are as follows: Figure 7 As shown in Figure C, the LC1-DNAzyme significantly reduces the expression level of SDAD1 in Ly8 cells after being taken up by Ly8 cells.

[0236] In summary, the anti-tumor mechanism of DNA nanoflowers is as follows: after being specifically taken up by lymphoma cells, DNA nanoflowers induce tumor apoptosis by downregulating the SDAD1 protein in lymphoma cells. Figure 7 E).

[0237] Example 6: Validation of the in vivo antitumor effect of LC1-DNAzyme

[0238] 1. Establish a subcutaneous OCI-LY8 cell lymphoma model in NOD-SCID mice.

[0239] Each NOD-SCID mouse (purchased from Cyagen) was subcutaneously injected with OCI-LY8 (1×10⁻⁶). 7 (1 cell / 100 μL). After cell inoculation, the mice's mental state, diet, and defecation habits were observed regularly. When the tumor volume reached 100 mm², the tumor was counted. 3 At that time, it was considered that the tumor model was successful, and a tumor-bearing mouse model was obtained.

[0240] 2. Evaluate the targeting ability of LC1-DNAzyme in vivo.

[0241] To evaluate the targeting effect of LC1-DNAzyme in tumor-bearing mice constructed in step 1 above, when the tumor volume (V = a × b) was measured, the tumor volume was evaluated. 2 / 2, where a is the length and b is the width) reaches 100-200mm 3At the time of administration, 100 μL of free Cy5, Cy5-labeled DNAzyme, and Cy5-labeled LC1-DNAzyme were injected into tumor-bearing mice via the tail vein. The final concentrations of the Cy5-labeled DNAzyme and Cy5-labeled LC1-DNAzyme were 250 nM, designated as the Free-Cy5 group, DNAzyme group, and LC1-DNAzyme group, respectively. Fluorescence intensity was detected on the Xenogen IVIS Lumina XR imaging system at 1, 2, 4, and 6 hours after administration. Six hours later, the mice were sacrificed, and their tumors and major organs, including the heart, liver, spleen, lungs, and kidneys, were harvested for in vitro imaging.

[0242] In vivo and in vitro fluorescence images of lymphoma-bearing mice after different treatments are shown below. Figure 8 As shown in A and 8B, both demonstrate that LC1-DNAzyme can target lymphoma.

[0243] 3. Evaluation of the antitumor efficacy and toxicity of L-SD

[0244] When the tumor volume in the tumor-bearing mouse model reaches approximately 100 mm... 3 The experiment was divided into 6 groups, labeled as Saline group, 250nM group, 500nM group, 1μM group, 2μM group and DOX group, with 5 animals in each group.

[0245] The treatment for the Saline group was as follows: 100 uL of physiological saline was injected into tumor-bearing mice via tail vein injection, once every 2 days, for a total of 4 times.

[0246] The treatment method for the 250 nM group was as follows: 100 uL of 250 nM LC1-DNAzyme was injected into tumor-bearing mice via tail vein injection, once every 2 days, for a total of 4 times.

[0247] The treatment method for the 500 nM group was as follows: 100 uL of 500 nM LC1-DNAzyme was injected into tumor-bearing mice via tail vein injection, once every 2 days, for a total of 4 times.

[0248] The treatment method for the 1μM group was as follows: 100uL of 1μM LC1-DNAzyme was injected into tumor-bearing mice via tail vein injection, once every 2 days, for a total of 4 times.

[0249] The treatment method for the 2μM group was as follows: 100uL of 2μM LC1-DNAzyme was injected into tumor-bearing mice via tail vein injection, once every 2 days, for a total of 4 times.

[0250] The DOX group was treated by tail vein injection at a dose of 3 mg / kg, once every 2 days for a total of 4 times.

[0251] The tumor length (L, mm), width (W, mm), and volume (V, mm) were measured using electronic vernier calipers. 3 The formula for calculating tumor volume is V = (LW) / (LW) 2 ) / 2. Tumor volume was monitored every 2 days, and a time curve of tumor volume was plotted. The tumor-bearing mice were weighed every 2 days, and a time curve of weight change in the tumor-bearing mice was plotted.

[0252] Tumor size on day 14 after treatment in different treatment groups, as shown below Figure 8 As shown in Figure C, the relative tumor volume during the 14-day treatment period after treatment in different treatment groups is as follows: Figure 8 As shown in Figure D, the results indicated that the 2 μM treatment group exhibited the best anti-tumor effect of LC1-DNAzyme, with efficacy similar to that of doxorubicin (DOX). The changes in body weight of mice in different treatment groups over 14 days are shown in Figure D. Figure 8 As shown in E, the results indicate no significant differences among the groups, and the drug has good safety.

Claims

1. Application of the SDAD1 gene or SDAD1 protein as a drug target for screening the prevention, remission and / or treatment of diffuse large B-cell lymphoma.

2. Application of substances that inhibit SDAD1 gene expression and / or function in the preparation of drugs for the prevention, relief and / or treatment of diffuse large B-cell lymphoma.

3. The application according to claim 2, characterized in that, The substance that inhibits SDAD1 gene expression and / or function is at least one of nucleic acid molecules, small molecule compounds, antibodies, proteins, adeno-associated viruses, lentiviruses, and bionanomaterials, wherein the lentivirus contains the nucleic acid molecule.

4. The application according to claim 3, characterized in that, The nucleic acid molecule is at least one of sgRNA, shRNA, siRNA, and microRNA; the shRNA is shRNA1 or / and shRNA2, the target nucleotide sequence of shRNA1 is: CCGATGAAGAACAGCAAGAAA, and the target nucleotide sequence of shRNA2 is: GCAGAGCTGGTGATGTTTATG.

5. The application according to claim 3, characterized in that, The biomaterial is a DNA nanoflower formulation; the DNA nanoflower formulation is prepared from a phosphorylated DNA template through a circular ligation reaction and a rolling circle amplification reaction; the DNA template contains a complementary sequence to the target sequence, and the target sequence contains a DNA zyme that downregulates the expression of SDAD1 protein, and the nucleotide sequence of the DNA zyme is: 5'-TTGGTCCATCAGGCTAGCTACAACGACCTCAGATTCG-3'.

6. The application according to claim 5, characterized in that, The target sequence also contains LC1, an aptamer for CD19 that targets lymphoma. The nucleotide sequence of LC1 is: 5'-TTTTTGCGTGTGTAGTGTGTCTGTTCTCCTTTTTTTGGTTGCTGCTCTTAGGGATTTGGGCGG-3'.

7. A drug, characterized in that, The drug is used to prevent, alleviate or treat diffuse large B-cell lymphoma, and the drug contains a substance that inhibits the expression and / or function of the SDAD1 gene.

8. The medicament according to claim 7, characterized in that, The substance that inhibits SDAD1 gene expression and / or function is at least one of nucleic acid molecules, small molecule compounds, antibodies, proteins, adeno-associated viruses, lentiviruses, and bionanomaterials, wherein the lentivirus contains the nucleic acid molecule.

9. The drug according to claim 7, characterized in that, The biomaterial is a DNA nanoflower formulation; the DNA nanoflower formulation is prepared from a phosphorylated DNA template through a circular ligation reaction and a rolling circle amplification reaction; the DNA template contains a complementary sequence to the target sequence, and the target sequence contains a DNA zyme that downregulates the expression of SDAD1 protein, and the nucleotide sequence of the DNA zyme is: 5'-TTGGTCCATCAGGCTAGCTACAACGACCTCAGATTCG-3'.

10. The medicament according to claim 9, characterized in that, The target sequence also contains LC1, an aptamer for CD19 that targets lymphoma. The nucleotide sequence of LC1 is: 5'-TTTTTGCGTGTGTAGTGTGTCTGTTCTCCTTTTTTTGGTTGCTGCTCTTAGGGATTTGGGCGG-3'.

11. The use of reagents for detecting the expression level of the SDAD1 gene or SDAD1 protein in the preparation of products for predicting the prognosis of diffuse large B-cell lymphoma.

12. According to the above application, the characteristic is that, The product is used to detect the expression level of SDAD1 gene or SDAD1 protein in samples via RT-PCR, real-time quantitative PCR, in situ hybridization, western blotting, microarray, or high-throughput sequencing platforms.