Recombinant human herpes simplex virus as well as construction method and application thereof

Abstract

The invention relates to the field of bioengineering, in particular to a recombinant human herpes simplex virus as well as a construction method and application thereof. The recombinant human herpes simplex virus lacks US1, US2, US3, US4 and US5 virulence genes at the same time. The construction method comprises the following steps: constructing a donor plasmid, and constructing a cleavage plasmid; transfecting cells with the cleavage plasmids and the donor plasmids in proportion; and after the transfected cells are incubated, infecting with an HSV-1 virus, purifying, and verifying to obtain the recombinant virus. The donor plasmid constructed by the invention retains non-coding regions among US1, US2, US3, US4 and US5 genes, also retains initiation codons and termination codons of the US1, US2, US3, US4 and US5 genes, is added with a fluorescent tag sequence, and can knock out five virulence genes of HSV-1US1-US2-US3-US4-US5 at the same time. The neutralizing antibody titer result of the recombinant human herpes simplex virus is the same as that of a wild type, and a foundation is laid for vaccine preparation.

Description

Invention Field

[0001] This invention relates to the field of bioengineering, and more specifically, to a recombinant human herpes simplex virus, its construction method, and its applications. Background Technology

[0002] Human herpes simplex virus (HSV) is a human pathogen that causes a range of illnesses, from mild skin lesions to fatal encephalitis. It is primarily transmitted through oral contact, typically causing cold sores, but can also lead to keratitis, other ocular sequelae, and encephalitis. Ocular complications caused by HSV-1 are a component of these complications. Genital HSV-1 infection through oral-genital contact is also becoming increasingly common. Newborns can contract HSV-1 from mothers with genital infections at birth, as well as from oral contact with caregivers after birth, a significant cause of neonatal death. HSV-1 is widespread globally, and infection results in lifelong carrier status, with some individuals experiencing periodic relapses. The number of HSV-1 infections increases with age, with the elderly having the highest infection rates and being more prone to periodic relapses. Therefore, due to individual factors, the disease is often asymptomatic yet contagious, allowing the virus to spread unnoticed, a major factor contributing to the global prevalence of HSV-1.

[0003] The development of an HSV-1 vaccine has been a lengthy process. Despite years of research, no vaccine has yet been approved for the prevention of HSV-1 infection. HSV-1 is known to have an incubation period, which complicates vaccine development, as an effective vaccine must prevent not only active clinical disease but also latent infection. The high prevalence of HSV-1 and its increasing resistance to existing therapies necessitate the development of new approaches to HSV-1 prevention and control.

[0004] In view of this, the present invention is proposed. Summary of the Invention

[0005] The primary objective of this invention is to provide a recombinant human herpes simplex virus, its construction method, and its application. The recombinant virus is a human herpes simplex virus strain with the virulence gene deleted from US1-US2-US3-US4-US5.

[0006] The technical solution adopted in this invention is as follows:

[0007] This invention proposes a method for constructing a human herpes simplex virus (HSV) strain with deleted virulence genes US1-US2-US3-US4-US5 using CRISPR / Cas9 technology. The technical solution adopted is as follows: using homologous recombination technology combined with CRISPR / Cas9 gene editing technology, a HSV strain with deleted virulence genes US1-US2-US3-US4-US5 is rapidly constructed. This includes designing and synthesizing amplification primers, preparing left and right homologous arm fragments, designing intermediate expression cassettes, constructing donor plasmids and cleavage plasmids, screening for HSV strains with deleted virulence genes, and cloning and purifying the virus through plaque cloning.

[0008] This invention proposes the application of the above-mentioned recombinant human herpes simplex virus in the preparation of medicines for the prevention of human herpes simplex virus.

[0009] This invention proposes a human herpes simplex virus vaccine, comprising the recombinant human herpes simplex virus and an adjuvant as described above.

[0010] This invention proposes an sgRNA for editing human herpes simplex virus, and the nucleotide sequences of the sgRNA primers are shown in SEQ ID NO:7 to SEQ ID NO:16.

[0011] The technical solution provided by the embodiments of the present invention has the following advantages compared with the prior art:

[0012] This invention combines classic homologous recombination technology with CRISPR / Cas9 gene editing technology to construct cleavage plasmids and donor plasmids. These plasmids were then co-transfected into 293T cells, ultimately yielding a human herpes simplex virus mutant strain with five virulence genes deleted. This provides a new approach for more efficient virus editing using CRISPR / Cas9 technology. Experiments confirmed that the neutralizing antibody titer of animals immunized with the recombinant human herpes simplex virus of this invention was the same as that of the wild type, and was not reduced due to the deletion of the five virulence genes. It can be used to prepare HSV-1 gene-deleted vaccines. Attached Figure Description

[0013] Figure 1 This is a schematic diagram of the donor plasmid recombination process;

[0014] Figure 2 A schematic diagram of plasmid construction;

[0015] Figure 3 The results of pHSV-3 enzyme digestion identification are shown in lane 1: M: 5000bp, lane 2: pHSV-3;

[0016] Figure 4 The results of enzyme digestion identification of pHSV-2; Lane 1: M: 5000bp, Lane 2: pHSV-2;

[0017] Figure 5 This is a schematic diagram of the intermediate expression box;

[0018] Figure 6 The results of enzyme digestion identification of pHSV-1 are shown in lane 1: M: 5000bp, lane 2: pHSV-1;

[0019] Figure 7 The results of enzyme digestion identification of PX459 are shown in lane 1: M: 1000bp, lane 2: PX459.

[0020] Figure 8 Sequencing results for PX459-sgRNA-US1;

[0021] Figure 9 Sequencing results for PX459-sgRNA-US2;

[0022] Figure 10 Sequencing results for PX459-sgRNA-US3;

[0023] Figure 11 Sequencing results for PX459-sgRNA-US4;

[0024] Figure 12 Sequencing results for PX459-sgRNA-US5;

[0025] Figure 13 Plaque screening for recombinant viruses

[0026] Figure 14 The results are for PCR identification of recombinant viruses; Lane 1: Marker 10000; Lane 2: HSV-1; Lane 3: HSV-1△US1-5 / EGFP+;

[0027] Figure 15 The experimental results for the determination of recombinant viral plaque-forming units (PFU);

[0028] Figure 16 The resulting growth curve is plotted. Detailed Implementation

[0029] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the specification.

[0030] This invention proposes a method for constructing a human herpes simplex virus (HSV) strain with deleted virulence genes US1-US2-US3-US4-US5 using CRISPR / Cas9 technology. The technical solution employed is as follows: Homologous recombination technology is combined with CRISPR / Cas9 gene editing technology to rapidly construct a type I HSV strain with deleted virulence genes US1-US2-US3-US4-US5. This includes designing and synthesizing amplification primers, preparing left and right homologous arm fragments, designing an intermediate expression cassette, constructing donor plasmids and cleavage plasmids, screening for HSV strains with deleted virulence genes, and purifying the virus through plaque cloning. Experiments have shown that the neutralizing antibody titer of animals immunized with the recombinant HSV of this invention is the same as that of the wild type, and is not reduced due to the deletion of the five virulence genes, laying the foundation for the preparation of an HSV-1 gene-deleted vaccine.

[0031] This invention provides a recombinant human herpes simplex virus, which is a type I human herpes simplex virus strain with the US1, US2, US3, US4, and US5 virulence genes simultaneously deleted. The construction of this recombinant human herpes simplex virus can be achieved using the following method, specifically including the following steps:

[0032] S1. Constructing donor plasmid-1, including: amplifying the left homologous arm fragment and right homologous arm fragment using the human herpes simplex virus type I genome as a template; designing and synthesizing the gene fragment of the intermediate expression cassette, which includes the non-coding region between the US1, US2, US3, US4, and US5 genes, and the start and stop codons of the US1, US2, US3, US4, and US5 genes; digesting the vector plasmid with enzymes, ligating it with the left homologous arm gene fragment, and transforming it into cells to obtain donor plasmid-3; digesting donor plasmid-3 with enzymes, ligating it with the right homologous arm gene fragment, and transforming it into cells to obtain donor plasmid-2; digesting donor plasmid-2 with enzymes, ligating it with the intermediate expression cassette gene fragment, and transforming it into cells to obtain donor plasmid-1.

[0033] S2. Construction of cutting plasmids: Gene fragments containing US1, US2, US3, US4, and US5 virulence genes were amplified using the human herpes simplex virus I genome as a template. sgRNA primers were designed for the US1, US2, US3, US4, and US5 virulence genes, and cutting plasmids 1, 2, 3, 4, and 5 were constructed respectively.

[0034] S3. Transfect cells with cutting plasmid 1, cutting plasmid 2, cutting plasmid 3, cutting plasmid 4, cutting plasmid 5 and donor plasmid-1 in the specified proportions.

[0035] S4. After the transfected cells are incubated, they are then infected with HSV-1 virus, purified, and verified to obtain the recombinant virus.

[0036] As a specific implementation of the present invention, in S1, after design and screening, the left homologous arm sequence is obtained by amplification using the left homologous arm primers shown in SEQ ID NO:3 and SEQ ID NO:4, and the right homologous arm sequence is obtained by amplification using the right homologous arm primers shown in SEQ ID NO:5 and SEQ ID NO:6.

[0037] As an improvement of this invention, a fluorescent tag sequence is added to the nucleotide sequence of the intermediate expression cassette. The fluorescent tag sequence can be added at any position of the nucleotide sequence of the intermediate expression cassette, and can be added at the position of the US2 gene, US3 gene, or US4 gene, or at the position of the US3 gene.

[0038] As an improvement to this embodiment of the invention, the fluorescent tag sequence is selected from the gene sequence of green fluorescent protein (EGFP); for example, the gene sequence of CMV-EGFP can be used.

[0039] As a specific embodiment of the present invention, the nucleotide sequence of the intermediate expression cassette is shown in SEQ ID NO:17.

[0040] As an improvement to the present invention, the nucleotide sequence of the sgRNA primer is shown in SEQ ID NO:7 to SEQ ID NO:16.

[0041] As an improvement to this embodiment of the invention, in S2, the method for constructing the cleavage plasmid includes: denaturing and annealing the sgRNA primers for extension, then ligating them with the plasmid, transforming them into cells, and obtaining the cleavage plasmid by sequencing identification.

[0042] As an improvement to this embodiment of the invention, in S3, the molar ratio of cutting plasmid 1, cutting plasmid 2, cutting plasmid 3, cutting plasmid 4, cutting plasmid 5 and donor plasmid-1 is 1:0.9~1.1:0.9~1.1:0.9~1.1:0.9~1.1:1.8~2.2, preferably 1:1:1:1:1:2.

[0043] As an improvement of this embodiment of the invention, in S4, HSV-1 virus is infected with MOI=0.1 5-7 hours after transfection of cells, and the spotting is checked 2-3 days later, and fluorescent empty spots are picked.

[0044] The present invention also proposes the application of the above-mentioned recombinant human herpes simplex virus in the preparation of medicines for the prevention of human herpes simplex virus.

[0045] This invention also proposes a human herpes simplex virus vaccine, comprising the aforementioned recombinant human herpes simplex virus and an adjuvant. The neutralizing antibody titer of the recombinant human herpes simplex virus of this invention is the same as that of the wild type, laying the foundation for vaccine preparation.

[0046] This invention also proposes an sgRNA for editing human herpes simplex virus, the nucleotide sequences of which are shown in SEQ ID NO:7 to SEQ ID NO:16. The primer sequences are annealed and extended to form a double-stranded sgRNA.

[0047] The technical solution and effects of the present invention are further illustrated below through specific embodiments. All reagents used are commercially available.

[0048] Example 1: Construction of a human herpes simplex virus strain with deleted virulence genes US1-US2-US3-US4-US5

[0049] 1. Materials and Methods

[0050] 1.1 Test Materials

[0051] Plasmid pcDNA3.1 was purchased from Invitrogen (USA), and CRISPR / Cas9 plasmid PX459 was purchased from AddGene. (lipofectamine) TM 3000 cells were purchased from Invitrogen. *E. coli* DH5α and stbl3 competent cells were purchased from Beijing TransGen Biotech Co., Ltd. NheI, KpnI, BamHI, NotI, and BbsI restriction endonucleases, plasmid mini-prep kits, DNA extraction kits, and DNA purification kits were purchased from Therom (USA). La Taq enzyme and pMD19T were purchased from Dalian Takara Bio Inc. Endotoxin-free plasmid extraction kits were purchased from Promega. DMEM high-glucose medium and Opti-MEM... TM Serum-free culture medium, antibiotics, and fetal bovine serum were all purchased from Gbico. All other reagents were domestically produced analytical grade.

[0052] 1.2 Test Methods

[0053] 1.2.1 Construction of donor plasmids and cutting plasmids: A schematic diagram of the donor plasmid recombination process is shown below. Figure 1 As shown in the diagram, the construction of the cleavage plasmid is illustrated below. Figure 2 As shown.

[0054] 1.2.1.1 Construction of donor plasmid

[0055] 1.2.1.1.1 Primer Design and Synthesis

[0056] Based on the human herpes simplex virus virulence gene reading frame US1-US2-US3-US4-US5 in NCBI, a pair of upstream and downstream primers were designed using the biological software Premier 5.0.

[0057] Primer name: Upstream primer is F- US1-US2-US3-US4-US5 The downstream primer is R- US1-US2-US3-US4-US5 The primer sequences are shown in SEQ ID NO:1 and SEQ ID NO:2.

[0058] Human herpes simplex virus type I DNA template: HSV-1 virus (preserved at Inner Mongolia Medical University and Inner Mongolia Haobokanghong Biotechnology Co., Ltd.) was used to infect Vero cells, and then the DNA template was extracted using a viral genome extraction kit.

[0059] The amplification system is as follows: 50 ng of human herpes simplex virus DNA template (type I), 8 μL of dNTPs, 1 μL each of upstream and downstream primers, 25 μL of 2×GC buffer, 0.5 μL of LaTaq, and water added to a final volume of 50 μL.

[0060] The PCR cycling conditions were as follows: 94℃ pre-denaturation for 2 minutes, 94℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 6 minutes and 10 seconds for a total of 35 cycles, and a final extension at 72℃ for 10 minutes. The PCR was then stored at 4℃.

[0061] The PCR products were sent to BGI Genomics for sequencing, and the US1-US2-US3-US4-US5 gene sequence was determined to be 6160bp.

[0062] Based on the locations of the US1-US2-US3-US4-US5 virulence genes in the HSV-1 genome, left and right homologous arms were designed. NheI and KpnI restriction enzyme sites were added to the 5' end of the primer for the left homologous arm, and BamHI and NotI were added to the 5' end of the primer for the right homologous arm. The amplified target gene fragment had a left homologous arm length of 1543 bp and a right homologous arm length of 1258 bp.

[0063] Left homologous arm primer: upstream primer is FL US1-US2-US3-US4-US5 The downstream primer is RL. US1-US2-US3-US4-US5 The primer sequences are shown in Table 1. The left homologous arm is shown in SEQ ID NO:18.

[0064] Right homologous arm primer: upstream primer is FR US1-US2-US3-US4-US5 The downstream primer is RR US1-US2-US3-US4-US5 The primer sequences are shown in Table 1. The right homologous arm is shown in SEQ ID NO:19.

[0065] Table 1: Primer sequences

[0066] Primer Sequence number Nucleotide sequence (5'-3') Restriction site <![CDATA[F- US1-US2-US3-US4-US5 ]]> SEQ ID NO:1 gatcgcatcggaaagggacacgc / <![CDATA[R- US1-US2-US3-US4-US5 ]]> SEQ ID NO:2 accggaacgcaccacacaaaagag / <![CDATA[F-L US1-US2-US3-US4-US5 ]]> SEQ ID NO:3 ctagctagcggcccggggagccggggcgctgct NheI <![CDATA[R-L US1-US2-US3-US4-US5 ]]> SEQ ID NO:4 cggggtacccatccagaaaacgtcccggaggacca KpnI <![CDATA[F-R US1-US2-US3-US4-US5 ]]> SEQ ID NO:5 cgcggatcctaatttcccccccccccccccttc BamHI <![CDATA[R-R US1-US2-US3-US4-US5 ]]> SEQ ID NO:6 atttcgggccgcatttagctccgggggcagcagggt NotI PX459-sgRNA-US1 F SEQ ID NO:7 caccgcgggtcgcccgggaccccca BbsI PX459-sgRNA-US1 R SEQ ID NO:8 aaactgggggtcccgggcgacccgc BbsI PX459-sgRNA-US2 F SEQ ID NO:9 caccggaccctctgatcgccgttcg BbsI PX459-sgRNA-US2 R SEQ ID NO:10 aaaccgaacggcgatcagagggtcc BbsI PX459-sgRNA-US3 F SEQ ID NO:11 caccgggagtccaggcacgcgtcct BbsI PX459-sgRNA-US3 R SEQ ID NO:12 aaacaggacgcgtgcctggactccc BbsI PX459-sgRNA-US4 F SEQ ID NO:13 caccggtgccggtctgggtcatgtt BbsI PX459-sgRNA-US4 R SEQ ID NO:14 aaacaacatgacccagaccggcacc BbsI PX459-sgRNA-US5 F SEQ ID NO: ​ ​ ​ ​ ​ ​

[0067] 1.2.1.1.2 pcDNA3.1(+) plasmid digestion

[0068] The pcDNA31(+) plasmid was double-digested with NheI and KpnI restriction endonucleases. The reaction mixture was as follows: 10× Buffer 2 μL, pcDNA3.1(+) plasmid 1 μg, NheI and KpnI restriction endonucleases 1 μL each, 2× GC buffer 2 μL, and ddH2O added to a final volume of 20 μL. The mixture was shaken and incubated at 37°C for 1 h. Finally, the target plasmid was recovered using a gel extraction kit.

[0069] Gel recovery kit recovery steps:

[0070] (1) Add 350 μL of membrane binding solution and melt the gel at 60 °C for 5–10 min;

[0071] (2) Cool to room temperature for 5 min, add to the adsorption column, and let stand for 2 min;

[0072] (3) Centrifuge at 12000 rpm for 1 min and discard the waste liquid;

[0073] (4) Add 700 μL of membrane elution buffer, centrifuge at 12000 rpm for 1 min, and discard the waste liquid;

[0074] (5) Repeat the above steps once;

[0075] (6) After centrifuging at 12000 rpm for 2 min, the adsorption column was placed in a new 1.5 mL EP centrifuge tube;

[0076] (7) Add 30-50 μL ddH2O, let stand for 2 min, and centrifuge at 12000 rpm for 1 min;

[0077] (8) Take 1.5 mL of liquid from the EP centrifuge tube and place it in the column. Let it stand for 2 min and centrifuge at 12000 rpm for 2 min.

[0078] 1.2.1.1.3 Amplification of the left and right homologous arms

[0079] PCR amplification was performed using the extracted human herpes simplex virus type I genome as a template. The amplification system was as follows: 100 ng DNA template, 4 μL dNTP, 1 μL each of upstream and downstream primers, 10 μL 2×GC buffer, 1 μL Lataq enzyme, and water added to a final volume of 50 μL.

[0080] The PCR cycling conditions were as follows: 94℃ pre-denaturation for 2 minutes, 94℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 1 minute and 30 seconds for a total of 35 cycles, and a final extension at 72℃ for 10 minutes. The PCR was then stored at 4℃.

[0081] The amplified PCR products were recovered using a gel recovery kit following the prescribed steps.

[0082] 1.2.1.1.4 Preparation of the left and right homologous arms

[0083] Perform PCR amplification according to the system in 1.2.1.1.3, prepare 5 tubes for each, and use a gel extraction kit to extract the left and right homologous arms from the gel.

[0084] The target fragment from the left homologous arm was recovered and subjected to double enzyme digestion. The system was as follows: 2×Buffer 2μL, target fragment 1μg, NheI and KpnI 1μL each, ddH2O added to 20μL, vortexed to mix, incubated at 37℃ for 1 hour, and then the target fragment was recovered using a gel extraction kit.

[0085] The recovered right homologous arm target fragment was subjected to double enzyme digestion in the following system: 2×Buffer 2μL, target fragment 1μg, BamHI and NotI 1μL each, ddH2O added to 20μL, vortexed to mix, incubated at 37℃ for 1 hour, and then the target fragment was recovered using a gel extraction kit.

[0086] 1.2.1.1.5 Ligation of vector pcDNA3.1(+) with the target fragment (left homologous arm)

[0087] Add the following to a 10 μL system: 4 μL of the target fragment, 1 μL of pcDNA3.1(+) vector digested with NheI and KpnI, and 5 μL of Solution I. Mix well and incubate overnight in a 16℃ ligation tank.

[0088] 1.2.1.1.6 Conversion of Linkage Products

[0089] Take 50 μL of DH5α competent cells, add 10 μL of the ligation product from 1.2.1.1.5, incubate on ice for 30 min, heat shock at 42℃ for 45 s, incubate on ice for another 2 min, add 500 μL of LB liquid medium without ampicillin, incubate at 37℃ and shake at 220 r / min for 1 h, centrifuge at 5000 rpm for 5 min, discard 400 μL of supernatant, resuspend the precipitate in the remaining 150 μL of supernatant, spread evenly on LB solid plates containing ampicillin, and incubate upside down in a 37℃ incubator for 12 h.

[0090] 1.2.1.1.7 Identification of donor plasmid (pHSV-3)

[0091] A single white colony was picked from the plate that had been inverted for 12 hours and inoculated into LB liquid medium containing 1 / 1000 ampicillin. The culture was carried out at 37°C and 220 rpm for 12 hours. Donor plasmids were then extracted using a plasmid extraction kit. The extracted plasmid was named pHSV-3. The extracted plasmid (pHSV-3) was identified by restriction enzyme digestion with NheI and KpnI. The recombinant plasmid pHSV-3, which showed positive enzyme digestion, was sent to BGI Genomics Co., Ltd. for sequencing. The sequencing results were consistent with expectations, confirming the availability of recombinant plasmid pHSV-3. The electrophoresis diagram of pHSV-3 after NheI and KpnI restriction enzyme digestion is shown below. ​ As shown.

[0092] 1.2.1.1.8 Enzyme digestion of donor plasmid (pHSV-3)

[0093] The pBHV-3 plasmid was double-digested with BamHI and NotI restriction endonucleases. The reaction mixture was as follows: 2 μL of 2×Buffer, 1 μg of pBHV-3 plasmid, 1 μL each of BamHI and NotI, and ddH2O was added to a final volume of 20 μL. The mixture was shaken and incubated at 37°C for 1 hour. The target vector was then recovered using a gel extraction kit.

[0094] 1.2.1.1.9 Ligation of vector pHSV-3 with the target fragment (right homologous arm)

[0095] Add the following to a 10 μL system: 4 μL of the target fragment, 1 μL of the vector (pBHV-3) digested with BamHI and NotI restriction endonucleases, and 5 μL of Solution I. Mix well and incubate overnight in a 16°C ligation tank.

[0096] 1.2.1.1.10 Conversion of Linkage Products

[0097] Take 50 μL of DH5α competent cells, add 10 μL of the ligation product from 1.2.1.1.9, incubate on ice for 30 min, heat shock at 42℃ for 45 s, incubate on ice for another 2 min, add 500 μL of LB liquid medium without ampicillin, incubate at 37℃ and shake at 220 r / min for 1 h, centrifuge at 5000 rpm for 5 min, discard 400 μL of supernatant, resuspend the precipitate in the remaining 150 μL of supernatant, spread evenly on LB solid plates containing ampicillin, and incubate upside down in a 37℃ incubator for 12 h.

[0098] 1.2.1.1.11 Identification of recombinant plasmid (pHSV-2)

[0099] A single white colony was picked from the plate that had been inverted for 12 hours and inoculated into LB liquid medium containing 1 / 1000 ampicillin. The culture was carried out at 37°C and 220 rpm for 12 hours. Donor plasmids were then extracted using a plasmid extraction kit. The extracted plasmid was named pHSV-2. The extracted plasmid (pHSV-2) was identified by restriction enzyme digestion with BamHI and NotI restriction endonucleases. The recombinant plasmid pHSV-2 that tested positive for restriction enzyme digestion was sent to BGI Genomics Co., Ltd. for sequencing. The sequencing results were consistent with expectations, thus obtaining the recombinant plasmid pHSV-2. The electrophoresis results of pHSV-2 after BamHI and NotI restriction enzyme digestion are shown below. ​ As shown.

[0100] 1.2.1.1.12 Enzyme digestion of recombinant plasmid (pHSV-2)

[0101] The pBHV-3 plasmid was double-digested with BamHI and KpnI restriction endonucleases. The reaction mixture was as follows: 2 μL of 10×Buffer, 1 μg of pBHV-3 plasmid, 1 μL each of BamHI and KpnI, and ddH2O was added to a final volume of 20 μL. The mixture was shaken and incubated at 37°C for 1 hour. The target vector was then recovered using a gel extraction kit.

[0102] 1.2.1.1.13 Preparation of intermediate expression cassette fragments

[0103] Based on the sequencing results of the US1-US2-US3-US4-US5 gene sequences, five virulence genes were removed, but all non-coding regions, the start codon ATG, and the stop codon TAG were retained. A CMV-EGFP gene expression cassette was added at the US3 virulence gene position, and KpnI and BamHI restriction enzyme sites were added to the 5' end of the gene sequence. The nucleotide sequence of the designed intermediate expression cassette is shown in SEQ ID NO:17, and a schematic diagram is shown below. ​ As shown. The sequence was sent to Beijing BGI Genomics Co., Ltd. for sequence synthesis. The synthesized intermediate fragment was subjected to double enzyme digestion in the following system: 2×Buffer 2μL, target fragment 1μg, BamHI and KpnI 1μL each, ddH2O added to 20μL, vortexed to mix, incubated at 37℃ for 1 hour, and then the target fragment was recovered using a gel extraction kit.

[0104] 1.2.1.1.14 Ligation of vector pHSV-2 with the target fragment (intermediate expression cassette)

[0105] Add the following to a 10 μL system: 4 μL of the target fragment, 1 μL of the vector (pHSV-2) that has been digested with BamHI and KpnI restriction enzymes, and 5 μL of Solution I. Mix well and incubate overnight in a 16°C ligation tank.

[0106] 1.2.1.1.15 Conversion of Linkage Products

[0107] Take 50 μL of DH5α competent cells, add 10 μL of the ligation product from 1.2.1.1.14, incubate on ice for 30 min, heat shock at 42℃ for 45 s, incubate on ice for another 2 min, add 500 μL of LB liquid medium without ampicillin, incubate at 37℃ and shake at 220 r / min for 1 h, centrifuge at 5000 rpm for 5 min, discard 400 μL of supernatant, resuspend the precipitate in the remaining 150 μL of supernatant, spread evenly on LB solid plates containing ampicillin, and incubate upside down in a 37℃ incubator for 12 h.

[0108] 1.2.1.1.16 Identification of recombinant plasmid (pHSV-1)

[0109] A single white colony was picked from the plate that had been inverted for 12 hours and inoculated into LB liquid medium containing 1 / 1000 ampicillin. The culture was carried out at 37°C and 220 rpm for 12 hours. Donor plasmids were then extracted using a plasmid extraction kit. The extracted plasmid was named pHSV-1. The extracted plasmid (pHSV-1) was identified by restriction enzyme digestion with BamHI and KpnI. The recombinant plasmid pHSV-1, which tested positive for enzyme digestion, was sent to BGI Genomics Co., Ltd. for sequencing. The sequencing results were consistent with expectations, confirming the availability of recombinant plasmid pHSV-1. The electrophoresis results of pHSV-1 after BamHI and KpnI restriction enzyme digestion are shown below. ​ As shown.

[0110] 1.2.1.2 Construction of cleavage plasmids

[0111] 1.2.1.2.1 Primer Design and Synthesis

[0112] Based on the sequencing results of the human herpes simplex virus (HSM) US1-US2-US3-US4-US5 virulence genes, sgRNA sequences were designed and optimized for each virulence gene. Optimization principles included selecting sequences with high virulence fractions and GC content of approximately 50%-60%, and adding a BbsI restriction enzyme site at the 5' end. The resulting primer sequences, verified experimentally, are shown in Table 1. Primers were synthesized by BGI Genomics.

[0113] 1.2.1.2.2 Enzyme digestion of PX459 plasmid

[0114] The PX459 plasmid was double-digested with BbsI restriction endonuclease, and the experimental results are as follows: ​As shown, the system is as follows: 10×Buffer 2μL, PX459 plasmid 1μg, BbsI 1μL, add ddH2O to 20μL, shake to mix, incubate at 37℃ for 1 hour, and then use a gel extraction kit to recover the target vector.

[0115] 1.2.1.2.3 Preparation of sgRNA-US1

[0116] The synthesized primers were subjected to denaturation, annealing, and extension. The amplification system was as follows: sgRNA-US1-F 2.5 μL, sgRNA-US1-R 2.5 μL, Solution I 5 μL, mixed well.

[0117] The PCR system was: 95℃ for 5 min, 85℃ for 5 seconds, 25℃ for 5 seconds, and stored at 4℃.

[0118] 1.2.1.2.4 Ligation of PX459 plasmid with sgRNA-US1

[0119] Add the following to a 10 μL system: 4 μL of the target fragment sgRNA-US1, 1 μL of the vector (PX459) digested with BbsI, and 5 μL of Solution I. Mix well and incubate overnight in a 16°C ligation tank.

[0120] 1.2.1.2.5 Conversion of Linkage Products

[0121] Take 50 μL of stbl3 competent cells, add 10 μL of the ligation product from 1.2.1.2.4, incubate on ice for 30 min, heat shock at 42℃ for 45 s, incubate on ice for another 2 min, add 500 μL of LB liquid medium without ampicillin, incubate at 37℃ and shake at 220 r / min for 1 h, centrifuge at 5000 rpm for 5 min, discard 400 μL of supernatant, resuspend the precipitate in the remaining 150 μL of supernatant, spread evenly on LB solid plates containing ampicillin, and incubate upside down in a 37℃ incubator for 12 h.

[0122] 1.2.1.2.6 Identification of the cleavage plasmid (PX459-sgRNA-US1)

[0123] Single white colonies were picked from the transformed plates and inoculated into 5 mL of LB broth containing ampicillin (100 μg / mL). The culture was carried out at 37°C with shaking at 220 rpm for 12 h. Plasmids were then extracted using a plasmid extraction kit. The extracted plasmids were sent to BGI Genomics Co., Ltd. for sequencing identification. The sequencing results are as follows: ​ As shown.

[0124] 1.2.1.2.7 Preparation of sgRNA-US2

[0125] The synthesized primers were denatured, annealed, and extended. The amplification system was as follows: sgRNA-US2-F 2.5 μL, sgRNA-US2-R 2.5 μL, Solution I 5 μL, mixed well.

[0126] The PCR system was: 95℃ for 5 min, 85℃ for 5 seconds, 25℃ for 5 seconds, and stored at 4℃.

[0127] 1.2.1.2.8 Ligation of PX459 plasmid with sgRNA-US2

[0128] Add the following to a 10 μL system: 4 μL of the target fragment sgRNA-US2, 1 μL of the vector (PX459) digested with BbsI, and 5 μL of Solution I. Mix well and incubate overnight in a 16°C ligation tank.

[0129] 1.2.1.2.9 Conversion of Linkage Products

[0130] Take 50 μL of stbl3 competent cells, add 10 μL of the ligation product from 1.2.1.2.8, incubate on ice for 30 min, heat shock at 42℃ for 45 s, incubate on ice for another 2 min, add 500 μL of LB liquid medium without ampicillin, incubate at 37℃ and 220 r / min for 1 h with shaking, centrifuge at 5000 rpm for 5 min, discard 400 μL of supernatant, resuspend the precipitate in the remaining 150 μL of supernatant, spread evenly on LB solid plates containing ampicillin, and incubate upside down in a 37℃ incubator for 12 h.

[0131] 1.2.1.2.10 Identification of the cleavage plasmid (PX459-sgRNA-US2)

[0132] Single white colonies were picked from the transformed plates and inoculated into 5 mL of LB broth containing ampicillin (100 μg / mL). The culture was carried out at 37°C with shaking at 220 rpm for 12 h. Plasmids were then extracted using a plasmid extraction kit. The extracted plasmids were sent to BGI Genomics Co., Ltd. for sequencing identification. The sequencing results are as follows: ​ As shown.

[0133] 1.2.1.2.11 Preparation of sgRNA-US3

[0134] The synthesized primers were subjected to denaturation, annealing, and extension. The amplification system was as follows: sgRNA-US3-F 2.5 μL, sgRNA-US3-R 2.5 μL, Solution I 5 μL, mixed well.

[0135] The PCR system was: 95℃ for 5 min, 85℃ for 5 seconds, 25℃ for 5 seconds, and stored at 4℃.

[0136] 1.2.1.2.12 Ligation of PX459 plasmid with sgRNA-US3

[0137] Add the following to a 10 μL system: 4 μL of the target fragment sgRNA-US3, 1 μL of the vector (PX459) digested with BbsI, and 5 μL of Solution I. Mix well and incubate overnight in a 16°C ligation tank.

[0138] 1.2.1.2.13 Conversion of Linkage Products

[0139] Take 50 μL of stbl3 competent cells, add 10 μL of the ligation product from 1.2.1.2.12, incubate on ice for 30 min, heat shock at 42℃ for 45 s, incubate on ice for another 2 min, add 500 μL of LB liquid medium without ampicillin, incubate at 37℃ and shake at 220 r / min for 1 h, centrifuge at 5000 rpm for 5 min, discard 400 μL of supernatant, resuspend the precipitate in the remaining 150 μL of supernatant, spread evenly on LB solid plates containing ampicillin, and incubate upside down in a 37℃ incubator for 12 h.

[0140] 1.2.1.2.14 Identification of the cleavage plasmid (PX459-sgRNA-US3)

[0141] Single white colonies were picked from the transformed plates and inoculated into 5 mL of LB broth containing ampicillin (100 μg / mL). The culture was carried out at 37°C with shaking at 220 rpm for 12 h. Plasmids were then extracted using a plasmid extraction kit. The extracted plasmids were sent to BGI Genomics Co., Ltd. for sequencing identification. The sequencing results are as follows: ​ .

[0142] 1.2.1.2.15 Preparation of sgRNA-US4

[0143] The synthesized primers were denatured, annealed, and extended. The amplification system was as follows: sgRNA-US4-F 2.5 μL, sgRNA-US4-R 2.5 μL, Solution I 5 μL, mixed well.

[0144] The PCR system was: 95℃ for 5 min, 85℃ for 5 seconds, 25℃ for 5 seconds, and stored at 4℃.

[0145] 1.2.1.2.16 Ligation of PX459 plasmid with sgRNA-US4

[0146] Add the following to a 10 μL system: 4 μL of the target fragment sgRNA-US4, 1 μL of the vector (PX459) digested with BbsI, and 5 μL of Solution I. Mix well and incubate overnight in a 16°C ligation tank.

[0147] 1.2.1.2.17 Conversion of Linkage Products

[0148] Take 50 μL of stbl3 competent cells, add 10 μL of the ligation product from 1.2.1.2.16, incubate on ice for 30 min, heat shock at 42℃ for 45 s, incubate on ice for another 2 min, add 500 μL of LB liquid medium without ampicillin, incubate at 37℃ and 220 r / min for 1 h with shaking, centrifuge at 5000 rpm for 5 min, discard 400 μL of supernatant, resuspend the precipitate in the remaining 150 μL of supernatant, spread evenly on LB solid plates containing ampicillin, and incubate upside down in a 37℃ incubator for 12 h.

[0149] 1.2.1.2.18 Identification of the cleavage plasmid (PX459-sgRNA-US4)

[0150] A single white colony was picked from the transformed plate and inoculated into 5 mL of LB broth containing ampicillin (100 μg / mL). The culture was incubated at 37°C with shaking at 220 rpm for 12 h. Plasmid extraction was then performed using a plasmid extraction kit. The extracted plasmid was sent to BGI Genomics Co., Ltd. for sequencing identification. The sequencing results are as follows: ​ As shown.

[0151] 1.2.1.2.19 Preparation of sgRNA-US5

[0152] The synthesized primers were denatured, annealed, and extended. The amplification system was as follows: sgRNA-US5-F 2.5 μL, sgRNA-US5-R 2.5 μL, Solution I 5 μL, mixed well.

[0153] The PCR system was: 95℃ for 5 min, 85℃ for 5 seconds, 25℃ for 5 seconds, and stored at 4℃.

[0154] 1.2.1.2.2 Ligation of 0PX459 plasmid with sgRNA-US5

[0155] Add the following to a 10 μL system: 4 μL of the target fragment sgRNA-US5, 1 μL of the vector (pSpCas9-2A-Puro) digested with BbsI, and 5 μL of Solution I. Mix well and incubate overnight in a 16°C ligation tank.

[0156] 1.2.1.1.21 Conversion of Linkage Products

[0157] Take 50 μL of stbl3 competent cells, add 10 μL of the ligation product from 1.2.1.2.20, incubate on ice for 30 min, heat shock at 42℃ for 45 s, incubate on ice for another 2 min, add 500 μL of LB liquid medium without ampicillin, incubate at 37℃ and shake at 220 r / min for 1 h, centrifuge at 5000 rpm for 5 min, discard 400 μL of supernatant, resuspend the precipitate in the remaining 150 μL of supernatant, spread evenly on LB solid plates containing ampicillin, and incubate upside down in a 37℃ incubator for 12 h.

[0158] 1.2.1.1.22 Identification of the cleavage plasmid (PX459-sgRNA-US5)

[0159] A single white colony was picked from the transformed plate and inoculated into 5 mL of LB broth containing ampicillin (100 μg / mL). The culture was incubated at 37°C with shaking at 220 rpm for 12 h. Plasmid extraction was then performed using a plasmid extraction kit. The extracted plasmid was sent to BGI Genomics Co., Ltd. for sequencing identification. The sequencing results are as follows: ​ As shown.

[0160] 1.2.2 Recombinant HSV-1△US1-5 / EGFP + Plaque screening and purification

[0161] PX459 vectors containing successfully ligated sgRNAs, namely PX459-sgRNA-US1, PX459-sgRNA-US2, PX459-sgRNA-US3, PX459-sgRNA-US4, and PX459-sgRNA-US5, and pHSV-1 donor plasmid were transfected into 293T cells at a ratio of 1:1:1:1:1:2. Six hours after transfection, HSV-1 cells were infected with HSV-1 at an MOI of 0.1. Three days later, fluorescent plaques were picked under a microscope and transferred to 400 μL of DMEM. After three freeze-thaw cycles, the cells were inoculated onto a monolayer of Vero cells. Four hours later, the medium was replaced with 1% fetal bovine serum, 1% penicillin-dextrose antibody, and 0.8% low-melting-point agarose. After 72 hours, when obvious cytopathic effects appeared in the cells, fluorescent plaques were picked. The experimental results are as follows: ​ As shown. The selected virus solution is then processed according to a 10... -1 10 -2 10 -3 and 10 -4 Diluted and inoculated into 96-well plates containing Vero cells, with four replicates for each dilution. After 36 hours, cells showing one plaque and spontaneous green fluorescence were collected from each well. The solution was subjected to three freeze-thaw cycles. The virus solution was then inoculated into Vero cells for amplification, and the viral genome was extracted. Detection primers (F-) designed in our laboratory were used. US1-US2-US3-US4-US5 and R- US1-US2-US3-US4-US5The sequence was amplified according to the system described in 1.2.1.1.1, and the product was sent to BGI for sequencing analysis. The results showed that it was consistent with expectations, with HSV-1 being 6160 bp and HSV-1 △US1-5 / EGFP. + It is 2547bp, and the experimental results are as follows: ​ As shown.

[0162] 1.2.3 Recombinant HSV-1△US1-5 / EGFP + Determination of viral recombinant plaque-forming units (PFU) of parental HSV-1

[0163] Vero cells were seeded into 12-well plates. Once the cells had grown into a monolayer, the original culture medium was discarded, and the virus was cultured in serum-free DMEM at a ratio of 1:1. -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8 10 -9 and 10 -10 Serial dilutions were performed, and 400 μL of the virus dilution solution was inoculated into Vero cells. A negative control was also designed. The 12-well plates were incubated at 37°C with 5% CO2 for 2 hours. The cell supernatant was discarded, and the cells were washed three times with PBS. 1 mL of maintenance medium containing 2% serum was added to each well, followed by 1.5 mL of low-melting-point agarose for fixation. After 72 hours, 10% paraformaldehyde was added, and the cells were fixed at room temperature for 4 hours. After washing, the cells were stained with 8% crystal violet for 30 minutes, washed again, and the number of plaques was recorded. The final recombinant virus titer was determined to be 1.3 × 10⁻⁶. 4 PFU / mL, parental virus titer MOI = 1.7 × 10⁻⁶ 8 PFU / mL, HSV-1 and HSV-1ΔUS1-5 / EGFP + The results of the toxicity test are as follows ​ As shown.

[0164] 1.2.4 Recombinant HSV-1△US1-5 / EGFP + Determination of in vitro growth curves of parental HSV-1 on Vero cells

[0165] Vero cells were seeded into 12-well plates. Once the cells reached a monolayer, the culture medium was discarded and replaced with serum-free DMEM. Recombinant virus and parental virus were inoculated into each well at 0.1 MOI. The 12-well plates were incubated at 37°C with 5% CO2 for 2 hours. Excess culture medium was discarded, and 1 mL of maintenance medium containing 2% serum was added to each well. Virus was collected at 0h, 12h, 24h, 36h, 48h, 60h, and 72h after inoculation. The virus was then subjected to three freeze-thaw cycles at -80°C for later use. Plaque-forming units (PFU) of the virus were measured at each time point, and growth curves were recorded and plotted. ​ As shown.

[0166] Example 2: Recombinant HSV-1△US1-5 / EGFP + Mouse experiments with deletion strains

[0167] 1. Vero cells were cultured in DMEM medium containing 10% fetal bovine serum at 37°C in a constant temperature incubator containing 5% CO2. When the cells reached a confluence of approximately 80%–90%, the supernatant was discarded, and the cells were washed twice with PBS. The recombinant HSV-1△US1-5 / EGFP cells were then added. + 100 μL of the deletion strain was inoculated into Vero cells, and DMEM culture medium was added to the appropriate volume. The cells were then incubated at 37°C in a 5% CO2 incubator. When approximately 80% of the cells showed cytopathic effects, the virus was harvested and subjected to three freeze-thaw cycles at -80°C. The viral titer was determined according to 1.2.3, with an MOI of 1.3 × 10⁻⁶. 4 PFU / mL.

[0168] Fifteen clean-grade 5-week-old female mice of similar weight that were negative for both HSV-1 antigen and antibody were selected. Five mice were randomly divided into groups and housed in cages. Newly purchased mice were fed for one week to allow them to adapt to the environment.

[0169] Blood samples of 100 μL were collected from each mouse as a control. Immunization was performed on days 1 and 21, respectively. Before immunization, the virus samples were treated with Freund's adjuvant at a 1:1 ratio. Both groups were then immunized with recombinant HSV-1△US1-5 / EGFP. + Mice were injected subcutaneously at multiple sites on the back of their parent strain, HSV-1. Blood was collected from mice the day before immunization. A control group of 5 mice was also included.

[0170] 2. Neutralization test

[0171] First, measure the TCID of the viral fluid. 50 TCID will be tested 50 The viral fluid was diluted to 200 TCID. 50 / 0.1mL of virus suspension.

[0172] 2.1. TCID Virus50 Assay method: Vero cells were seeded into 96-well plates. After the cells grew into a monolayer the next day, they were serially diluted 10-fold using virus solution in centrifuge tubes. -1 ~10 -10 The diluted virus was inoculated into 96-well plates, with eight replicates for each dilution. The original culture medium in the 96-well plates was discarded, and 100 μL of the diluted virus was inoculated into each well. The last two columns were set up as negative controls. The results were observed and recorded daily, and the results were calculated using the Reed-Muench method after five days.

[0173] 2.2 Collect blood from immunized mice, separate serum, inactivate the serum in a 58℃ water bath for 30 min, and serially dilute it in a 96-well plate for a total of 10 dilutions. The specific method is to add 50 μL of serum-free DMEM culture medium to the 96-well plate, then add 50 μL of the serum to be tested, mix well, and then aspirate 50 μL to the next well. Continue this dilution until 1:256 is reached. Each dilution is prepared in 4 wells. Add 50 μL of DMEM culture medium to the 11th well and 100 μL of serum-free DMEM culture medium to the 12th well.

[0174] 2.3 The diluted recombinant virus was mixed with serum obtained from mice immunized with the parent virus, and the serum obtained from mice immunized with the recombinant virus was mixed. 50 μL of the corresponding diluted virus was added to each well, except for well 12. The 96-well plate was placed in a 37°C incubator with 5% CO2 for 1 hour for neutralization. Negative, positive, and test serum toxicity controls, a virus control, and a normal cell control were also included. After 1 hour of neutralization, 100 μL of LDBK cell suspension was added to each well, and the plate was incubated at 37°C with 5% CO2. The results were observed after 5 days and calculated using the Reed-Muench method.

[0175] 3. Results

[0176] The TCID of HSV-1 was measured. 50 =10 8 / mL, HSV-1△US1-5 / EGFP + TCID 50 =10 4 / mL.

[0177] Blood samples were collected, serum was separated, and the neutralizing antibody titers of each group after viral challenge were measured. The results showed that the neutralizing titers of both groups of serum against the virus reached 2. 64 HSV-1△US1-5 / EGFP + The level of neutralizing antibodies in the group was not reduced due to the absence of the five genes US1-US2-US3-US4-US5.

[0178] The above description is merely a specific embodiment of the present invention, enabling those skilled in the art to understand or implement the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention is not to be limited to the embodiments described herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A recombinant human herpes simplex virus, characterized in that, The recombinant human simplex herpes virus is a strain of human simplex herpes virus type I which simultaneously lacks US1, US2, US3, US4 and US5 virulence genes.

2. The recombinant human herpes simplex virus according to claim 1, wherein, The construction method of the recombinant human simplex herpes virus comprises the following steps: S1, constructing a donor plasmid-1, comprising: amplifying left homologous arm fragments and right homologous arm fragments from a human simplex herpes virus type I genome, designing and synthesizing a gene fragment of an intermediate expression cassette, the gene fragment of the intermediate expression cassette comprising non-coding regions between US1, US2, US3, US4 and US5 genes and start and stop codons of the US1, US2, US3, US4 and US5 genes and adding a fluorescent tag sequence; performing enzyme digestion on the plasmid and connecting the left homologous arm gene fragment, transforming into cells to obtain the donor plasmid-3; performing enzyme digestion on the donor plasmid-3 and connecting the right homologous arm gene fragment, transforming into cells to obtain the donor plasmid-2; performing enzyme digestion on the donor plasmid-2 and connecting the intermediate expression cassette gene fragment, transforming into cells to obtain the donor plasmid-1; S2, constructing a cleavage plasmid: amplifying a gene fragment comprising US1, US2, US3, US4 and US5 virulence genes from a human simplex herpes virus type I genome, designing sgRNA primers for the US1, US2, US3, US4 and US5 virulence genes respectively, and respectively constructing a cleavage plasmid 1, a cleavage plasmid 2, a cleavage plasmid 3, a cleavage plasmid 4 and a cleavage plasmid 5; S3, transfecting cells with the cleavage plasmid 1, the cleavage plasmid 2, the cleavage plasmid 3, the cleavage plasmid 4, the cleavage plasmid 5 and the donor plasmid-1 in a proportion; S4, after the transfection of cells is completed, HSV-1 virus is infected, and the recombinant virus is obtained through purification and verification.

3. The recombinant human herpes simplex virus of claim 2, wherein, In S1, the left homologous arm sequence is amplified by using left homologous arm primers shown as SEQ ID NO: 3 and SEQ ID NO: 4, and the right homologous arm sequence is amplified by using right homologous arm primers shown as SEQ ID NO: 5 and SEQ ID NO: 6; Optionally, the fluorescent tag sequence is added in the nucleotide sequence of the intermediate expression cassette; Optionally, the fluorescent tag sequence is added at a position of the US2 gene, the US3 gene or the US4 gene; Optionally, the fluorescent tag sequence is selected from gene sequences of fluorescent proteins. Optionally, the nucleotide sequence of the intermediate expression cassette is shown as SEQ ID NO:

17.

4. The recombinant human herpes simplex virus of claim 2, wherein, In S2, the nucleotide sequences of the sgRNA primers are shown as SEQ ID NO: 7 to SEQ ID NO:

16.

5. The recombinant human herpes simplex virus of claim 2, wherein, In S2, the construction method of the cleavage plasmid comprises: denaturation, annealing and extension of sgRNA primers, then connecting the primers with a plasmid, transforming into cells, and obtaining the cleavage plasmid through sequencing identification.

6. The recombinant human herpes simplex virus of claim 2, wherein, In S3, the molar ratio of the cutting plasmid 1, the cutting plasmid 2, the cutting plasmid 3, the cutting plasmid 4, the cutting plasmid 5 and the donor plasmid-1 is 1:0.9-1.1:0.9-1.1:0.9-1.1:0.9-1.1:1.8-2.2, preferably 1:1:1:1:1:

2.

7. The recombinant human herpes simplex virus of claim 2, wherein, In S4, the HSV-1 virus is infected at MOI=0.1 after 5-7 hours of transfection of the cells, and the plaque situation is observed after 2-3 days, and the fluorescent plaques are picked.

8. Use of the recombinant human herpes simplex virus according to any one of claims 1-7 in the preparation of a drug for preventing human herpes simplex virus.

9. A human herpes simplex virus vaccine, characterized in that, The recombinant human herpes simplex virus according to any one of claims 1-7 and an adjuvant.

10. An sgRNA for editing a human herpes simplex virus, comprising, wherein the sgRNA comprises a sequence selected from the group consisting of SEQ ID NOs: 1- 6. The nucleotide sequence of the sgRNA primer is shown in SEQ ID NO:7-SEQ ID NO:16.

Images