Gene mutant capable of overcoming distant hybridization lethal and detection primer thereof

By introducing specific mutations into the tobacco NtHL1S gene and utilizing CRISPR/Cas9 and KASP markers, the problem of lethality in distant hybridization of tobacco was solved, realizing a rapid and accurate breeding method, reducing breeding costs and time, and providing an effective means of molecular marker-assisted breeding.

CN121344002APending Publication Date: 2026-01-16YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511641945.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-11
Publication Date
2026-01-16

AI Technical Summary

Technical Problem

The lethality of distant hybridization in tobacco limits the exchange of superior genes and the progress of breeding. Existing technologies lack effective molecular marker-assisted methods, resulting in a time-consuming, costly, and inaccurate breeding process.

Method used

By introducing specific mutations into the tobacco NtHL1S gene using CRISPR/Cas9 gene editing technology, competitive allele-specific PCR (KASP) markers were developed for rapid detection and overcoming lethality in distant hybridization. Combined with Agrobacterium-mediated genetic transformation, F1 hybrids with normal growth were obtained for offspring screening.

Benefits of technology

It enables rapid and accurate overcoming of hybridization lethality between tobacco and African tobacco, reduces the time and cost of the breeding process, improves the accuracy of selection, and provides a key tool for molecular marker-assisted breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121344002A_ABST
    Figure CN121344002A_ABST
Patent Text Reader

Abstract

The invention provides a gene mutant capable of overcoming distant hybridization lethal and a detection primer thereof. According to the gene mutant capable of overcoming distant hybridization lethal, an NtHL1S gene is mutated, and bases at the 472nd site and the 473rd site are replaced with A; the gene mutant directly participates in regulation and control, and the distant hybridization lethal phenomenon, especially the hybridization lethal phenomenon between common tobacco and African tobacco, is overcome by inhibiting expression of the NtHL1S gene in the tobacco for the first time. According to the method disclosed by the invention, the tobacco gene NtHL1S is mutated by utilizing a CRISPR / Cas9 method, and the situation that the hybridization lethal phenomenon between common tobacco and African tobacco disappears due to the mutation of the NtHL1S gene is found. A primer combination is developed aiming at an NtHL1S gene mutation site, and is used for transformation of a target site for gene identification, and rapid screening of a target single plant in molecular marker-assisted selective breeding offspring materials.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant breeding technology, specifically relating to a gene mutant that overcomes lethality from distant hybridization and its detection primers. Background Technology

[0002] Climate change, emerging diseases, and the loss of resistance due to the long-term use of traditional resistance loci necessitate the search for new superior genetic loci in wild tobacco resources. However, hybridization lethality is prevalent between and within different species in tobacco, severely limiting the exchange and utilization of superior genes. Currently, in-depth research on the mechanisms of hybridization lethality is lacking, resulting in a rather narrow genetic background for existing tobacco varieties and materials, which is detrimental to the breeding of breakthrough varieties. Hybridization lethality in tobacco exhibits different phenotypes in the seedling stage, and different hybrid combinations show different phenotypes. Based on its external phenotype, tobacco hybridization lethality can be divided into five types: Type I to Type V (Yamada et al., 1999). Hybridization lethality has been observed in hybridizations between cultivated tobacco and most species in the Suaveolentes section (Kostoff, 1930), including African tobacco (N. africana) (Knapp et al., 2004). The vast majority of offspring from hybridizations between cultivated tobacco and African tobacco do not survive. Some studies suggest that one or more genes on the Q chromosome of the cultivated tobacco genome control the hybrid lethal response in African tobacco (Tezuka et al., 2012). Therefore, creating mutants using these genes could overcome hybrid lethality between cultivated tobacco and most species in the Suaveolentes group, providing an important bridge for utilizing advantageous traits in wild tobacco species.

[0003] Traditional methods for transferring superior traits involve hybridization and backcrossing, planting offspring, and then selecting target plants based on fertility observations after flowering. This process requires planting a large number of offspring and takes a long time. Utilizing modern molecular markers for genotypic selection during the seedling stage can significantly reduce the financial, material, and labor costs involved in the selection process and improve the accuracy of selection. This is crucial for modern hybridization breeding and seed production.

[0004] Single nucleotide polymorphisms (SNPs) are widely distributed throughout the genome and are the most common form of genetic variation among plant individuals. Common SNPs include base substitutions, transversions, insertions, and deletions. While most SNPs, widely distributed throughout the genome, do not directly determine phenotype, their close linkage to phenotype-determining loci makes them important molecular markers. SNPs have become one of the most ideal molecular markers for studying the genetics of complex traits in plants.

[0005] Kompetitive allele-specific PCR (KASP) is a method of SNP genotyping that uses specific matching of primer terminal bases. The basic principle is that two primers with different terminal bases each carry a fluorescent adapter sequence. Based on the different fluorescent signals carried by the amplified products, a large number of samples can be rapidly detected to accurately determine their genotypes. Since its introduction, KASP technology has rapidly gained market share due to its high flexibility, accuracy, and cost-effectiveness, playing an important role in crop-assisted breeding. Currently, there are no reports of using codominant KASP markers for selection in the transgenic breeding of tobacco distant hybridization lethal genes. Summary of the Invention

[0006] This invention provides a gene mutant that overcomes lethality from distant hybridization and its detection primers for site-directed mutagenesis in common tobacco. NtHL1 S Genes can completely overcome the lethality of distant hybridization in tobacco.

[0007] The first aspect of this invention is to provide a gene mutant that overcomes lethality from distant hybridization, which is a gene mutant that overcomes lethality from distant hybridization. NtHL1 S The gene undergoes a mutation, replacing the bases at positions 472 and 473 with A.

[0008] A second aspect of the present invention is to provide an expression cassette containing the above-described gene mutant.

[0009] A third aspect of the present invention is to provide a recombinant vector containing the above-described gene mutant or the above-described expression cassette.

[0010] A fourth aspect of the present invention is to provide a recombinant microorganism comprising the above-described gene mutant, the above-described expression cassette, or the above-described recombinant vector.

[0011] The fifth aspect of this invention is to provide a method for overcoming the lethality of distant hybridization in tobacco, which involves creating the above-mentioned gene mutant through gene editing, using the mutant plant as the male or female parent, and hybridizing it with other wild tobacco varieties to obtain a hybrid F1 with normal growth for offspring screening.

[0012] In the above methods, the nucleotide sequence of the vector target in the gene editing process is shown in SEQ ID NO.4 and SEQ ID NO.5.

[0013] In the above method, the nucleotide sequence of the upstream primer used to detect the target site of the vector is shown in SEQ ID NO.6, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.7.

[0014] In the above method, the gene mutant is linked to a molecular marker for detection, and the primer combination for detecting the molecular marker includes a PCR primer set or a KASP primer set.

[0015] In the above method, the nucleotide sequences of the PCR primer set are shown in SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, and the nucleotide sequences of the KASP primer set are shown in SEQ ID NO.11, SEQ ID NO.12 and SEQ ID NO.10.

[0016] A sixth aspect of the present invention is to provide detection primers comprising the PCR primer set and / or the KASP primer set described in the above-described methods.

[0017] Compared with the prior art, the present invention has the following beneficial effects: This invention's gene mutant directly participates in regulation, for the first time by inhibiting tobacco... NtHL1 S Gene expression can overcome the lethality of distant hybridization, especially the lethality of hybridization between common tobacco and African tobacco.

[0018] The method of this invention mutates the tobacco gene using the CRISPR / Cas9 method. NtHL1 S , discovered NtHL1 S Gene mutations have caused the disappearance of the lethal cross between regular tobacco and African tobacco.

[0019] The method of this invention obtains a gene editing vector using CRISPR / Cas9 gene editing, and then obtains it through Agrobacterium-mediated gene editing. NtHL1 S Mutants that have undergone gene editing can be applied to tobacco hybridization breeding.

[0020] The method of this invention develops primer sets targeting mutation sites in mutants, including PCR primer sets and KASP primer sets, which can be used for identification of hybrid lethal genes in plants and screening of target individual plants in molecular marker-assisted breeding. Attached Figure Description

[0021] Figure 1 The hybrid lethal phenotype (28DAS) of the F1 generation of the cross between tobacco inbred line K326 and African tobacco.

[0022] Figure 2 It is a tobacco K326 mutant ( nthl1 s33 The hybrid lethality phenotype of F1 hybridized with African tobacco was overcome (28DAS).

[0023] Figure 3 The results of SNP genotyping using the KASP primer combination of this invention are shown.

[0024] Figure 4 The results show the screening of the F2 progeny segregating population using the KASP primer combination of this invention. Detailed Implementation

[0025] The present invention will be further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention.

[0026] A gene mutant that overcomes lethality from distant hybridization, which is a response to... NtHL1 S The gene is mutated to replace the base CT at positions 472-473 with A, and its nucleotide sequence is shown in SEQ ID NO.3.

[0027] NtHL1 S The nucleotide sequence of the gene is shown in SEQ ID NO.1. NtHL1 S The amino acid sequence obtained from gene translation is shown in SEQ ID NO.2.

[0028] Nucleotide sequence of the gene mutant (SEQ ID NO.3):

[0029] A method to overcome the lethality of distant hybridization in tobacco involves obtaining a gene-editing vector through gene editing, obtaining the aforementioned gene mutant through Agrobacterium-mediated hybridization, and using the mutant plant as the male or female parent to hybridize with other wild tobacco varieties to obtain a normal-growing F1 hybrid for offspring selection.

[0030] The vector target in the gene editing process is NtHL1 S The nucleotide sequence of the positive strand of the gene is 354-375 bp ccgggctggatgcgtcaaatccc (SEQ ID NO.4) and 457-479 bp ggaaatctaaagtatctgggagg (SEQ ID NO.5). The nucleotide sequence of the upstream primer used to detect the vector target is shown in SEQ ID NO.6: 5'-TTCATGGATCAAGGTGGATGA-3', and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.7: 5'-TTGTACCTTGATAATCCACTGC-3'.

[0031] The gene mutant is linked to a molecular marker for detection. Molecular marker screening is used to specifically detect the gene mutant and the mutated gene in tobacco material derived from the gene mutant. Primer combinations for detecting the molecular marker include PCR primer sets or KASP primer sets. The nucleotide sequences of the PCR primer sets are shown in SEQ ID NO. 8, SEQ ID NO. 9, and SEQ ID NO. 10, and the nucleotide sequences of the KASP primer sets are shown in SEQ ID NO. 11, SEQ ID NO. 12, and SEQ ID NO. 10.

[0032] The primers used in the examples were completed by Beijing Qingke Biotechnology Co., Ltd., and the sequencing was completed by Quintiles (Wuhan) Biotechnology Co., Ltd.

[0033] Example 1 Tobacco NtHL1 S Gene function research and the creation of mutants using CRISPR / Cas9 methods A search for tobacco in the National Center for Biotechnology Information (nih.gov) database NtHL1 S The (LOC138891172) gene, whose nucleotide sequence is shown in SEQ ID NO.1, encodes a protein containing 1211 amino acids.

[0034] In order to clarify tobacco NtHL1 S The function of the (LOC138891172) gene in tobacco was investigated using CRISPR / Cas9 gene editing. NtHL1 S (LOC138891172) gene sequence, knocking out the function of this gene in tobacco.

[0035] In this invention, the tobacco inbred line K326 was selected as the recipient material for gene editing. NtHL1 S Construction of the CRISPR / Cas9 gene editing vector: The gene editing vector of this invention is pBWA(V)HS-NtHL1 S, the base vector of this vector is pBWA(V)HS. This invention designs target sites on primers, ligates them into the base vector via enzyme digestion to form a single-target intermediate vector, and then obtains a dual-target vector through enzyme digestion and ligation. The specific construction process is as follows: (1) NtHL1 S The gene sequence is input into http: / / targetDesign (scau.edu.cn) for target design. NtHL1 S The CRISPR / Cas9 vector target is shown in SEQ ID NO.4 for the 354-375 bp nucleotide sequence of the gene's positive strand and in SEQ ID NO.5 for the 457-479 bp nucleotide sequence.

[0036] (2) Two pairs of primers for the intermediate vector targeting the mutation site were designed. The sequences of the Y1 site primer pair were Y1+: 5'-cagtGGTCTCatgcagggatttgacgcatccagcc-3' (SEQ ID NO.13) and Y1-: 5'-cagtGGTCTCaaaacggctggatgcgtcaaatccc-3' (SEQ ID NO.14); and the sequences of the B1 site primer pair were B1+: 5'-cagtGGTCTCatgcaggaaatctaaagtatctggg-3' (SEQ ID NO.15) and B1-: 5'-cagtGGTCTCaaaaccccagatactttagatttcc-3' (SEQ ID NO.16). The Y1+ and Y1- primers were annealed to form complementary DNA oligos, and the B1+ and B1- primers were annealed to form complementary DNA oligos. The specific steps are as follows: The reaction system consists of 50 μL of a mixture including 5 μL / μL upstream primer, 5 μL / μL downstream primer, 5 μL / μL of 10× Annealing buffer, and 35 μL of sterile double-distilled water. The annealing program is as follows: 95℃, 5 min; 90℃, 1 min; 80℃, 1 min; 70℃, 1 min; 60℃, 1 min; 50℃, 1 min; 40℃, 1 min; 30℃, 1 min; 20℃, 1 min; 10℃, 1 min.

[0037] (3) Enzyme digestion-ligation system. The pBWA(V)HS vector was digested and ligated with the prepared dsDNA. The pBWA(V)HS vector was digested and ligated using ECO31I enzyme and T4 DNA ligase. The 10 μL digestion-ligation system included: 2 μL of annealed dsDNA product, 1.5 μL of empty vector plasmid, 0.5 μL of ECO31I enzyme, 0.5 μL of T4 DNA ligase, 1 μL of T4 ligation DNA buffer, and 4.5 μL of sterile double-distilled water. Digestion was carried out at 37℃ for 2 h.

[0038] (4) Transformation of recombinant plasmids. Take 200 μL of competent E. coli DH5α cells and mix with 5 μL of ligation product, and incubate on ice for 30 min; quickly place in a 42℃ constant temperature water bath, heat shock for 90 s, and incubate on ice for 2 min; add 500 μL of LB liquid medium and mix well; incubate at 37℃ and 200 rpm for 45 min to allow the cells to recover to normal growth state; spread the bacterial solution evenly on LB solid medium plates; after 30 min, incubate overnight at 37℃.

[0039] (5) Recombinant plasmid extraction. Pick a single colony from an LB solid medium plate and inoculate it into kanamycin-resistant LB liquid medium with a final concentration of 50 μg / mL. Incubate overnight at 37°C. Take 4 mL of activated bacterial solution and centrifuge at 10,000 rpm for 2 min at room temperature. Discard the supernatant completely. Take 250 μL of Solution I reagent containing ribonuclease A and resuspend the bacterial block completely. Take 250 μL of Solution II reagent to lyse the bacterial block and gently invert several times until the bacterial cells are transparent. Take 350 μL of Solution III reagent and invert several times until a white, firm flocculent substance is formed. Centrifuge at 12,000 rpm for 10 min at room temperature and collect the supernatant. Take the nucleic acid purification column from the kit and place it on the collection tube. Take the clear supernatant into the nucleic acid purification column and centrifuge at 12,000 rpm for 1 min at room temperature. Discard the filtrate. Take 500 μL of Buffer W1 into the nucleic acid purification column and centrifuge at 12,000 rpm for 30 s at room temperature. Discard the filtrate. Take 700 μL of Buffer W1. W2 is added to the nucleic acid purification column, centrifuged at 12000 rpm for 30 s at room temperature, and the filtrate is discarded. This process is repeated once. The nucleic acid purification column is placed on a collection tube and centrifuged at 12000 rpm for 2 min at room temperature to remove as much residual liquid as possible. The collection tube is discarded, and the nucleic acid purification column is placed in a 1.5 mL EP tube. 50 μL of elution buffer is added to elute the DNA attached to the nucleic acid purification column membrane (the elution buffer can be preheated in a 65℃ constant temperature water bath to facilitate DNA elution). The mixture is allowed to stand at room temperature for 2 min. Centrifuged at 12000 rpm for 2 min at room temperature to elute the DNA attached to the nucleic acid purification column membrane. The mixture is then stored at -40℃ for later use. A small amount of the recovered product is taken, and the plasmid extraction quality is detected by 1% agarose gel electrophoresis. Two single clones of each extracted plasmid are sent for sequencing.

[0040] (6) Construction of dual-target vector. The two single-target vectors obtained in step (5) were digested and ligated using LguI enzyme and T4 DNA ligase to obtain a dual-target vector. The ligation system was 10 μL, including: 1 μL of target Y1 plasmid DNA product, 1.5 μL of target B1 plasmid DNA product, 0.5 μL of LguI enzyme, 0.5 μL of T4 DNA ligase, 1 μL of T4 ligation DNA buffer, and 5.5 μL of sterile double-distilled water. The digestion was carried out at 37℃ for 2 h. The recombinant plasmid was transformed as described in step (4). The transformed single clones were selected for bacterial testing. The bacterial testing system was 20 μL, including: 10 μL of 2×Mix, 1 μL of M13F primer, 1 μL of vector-specific primer, and 8 μL of sterile double-distilled water. Single clone 2 with a bacterial testing band of about 800 bp was selected, the plasmid was extracted, and sequencing was performed to obtain the correctly constructed dual-target vector.

[0041] Agrobacterium-mediated genetic transformation of tobacco: (1) Preparation of sterile seedlings Take an appropriate amount of K326 seeds in a 2.0 mL centrifuge tube, add 1.5 mL of room temperature distilled water and soak for 12-24 hours. Wash away any unripe seeds and impurities floating on the surface. Sterilize the seeds in a clean bench. First, add 1.5 mL of 75% medical alcohol, invert the centrifuge tube for 45 seconds, let it stand, and discard the alcohol with a pipette after the seeds have settled. Add 1.5 mL of sterile water, invert twice, let it stand, and discard the water with a pipette after the seeds have settled. Repeat this step twice. Then, add 1.5 mL of 84 disinfectant (NaClO), invert the centrifuge tube for 4 minutes, let it stand, and discard the 84 disinfectant with a pipette after the seeds have settled. Add 1.5 mL of sterile water, invert twice, let it stand, and discard the water with a pipette after the seeds have settled. Repeat this step 5 times. Finally, spread the sterilized seeds evenly on MS plates (medium: MS + 30 g / L sucrose + 7 g / L agar + pH 5.8), dry the surface of the MS plates, seal them, and place them in a 25°C light incubator for culture.

[0042] After the seeds germinate and begin to grow true leaves (about 2 weeks), individual tobacco plants are transferred to tissue culture boxes for further cultivation. Tobacco seedlings can be used for infection when they have 10 cotyledons (about 4 weeks) in the tissue culture boxes.

[0043] (2) Preparation of bacterial culture Agrobacterium competent cells (C58C1) were removed from an 80°C freezer, thawed on ice, and then the vector pBWA(V)HS NtHL1 was added. S 24μL; quick freeze in liquid nitrogen for 1 minute, transfer to a 37℃ water bath for 5 minutes, then in an ice bath for 2 minutes, add 1mL LB liquid medium to the mixture, and incubate at 28℃ and 220rpm for 3-4 hours; spread the culture on LB solid medium containing 100mg / L kanamycin and 25mg / L rifampin, and incubate upside down at 28℃ for 2-3 days, where Agrobacterium clones containing the target vector can be seen.

[0044] Select Agrobacterium clones containing the target vector, streak them on LB agar plates containing kanamycin and rifampin, and incubate at 28°C for 2-3 days; scrape off the streaks and inoculate them into LB agar containing kanamycin and rifampin, incubate at 28°C with shaking at 220 rpm, and infect when the bacterial concentration reaches OD = 0.5-0.8; place tobacco leaves in a 500 mL wide-mouth bottle, add an appropriate amount of 75% ethanol, and rinse for 1 min; discard the ethanol, add 0.1% HgCl2 solution, and shake on a shaker at room temperature for 15-30 minutes; discard the solution and rinse 6 times with sterile water.

[0045] (3) Tobacco conversion Remove the leaves and wash away surface liquid with sterile absorbent paper. Cut the sterile leaves into 1cm x 1cm pieces with scissors. Place the cut tobacco leaf pieces (from the K326 cultivar) into a sterile LB liquid culture medium suspension containing the target vector and let stand for 15-20 minutes. Remove the tobacco leaves, absorb excess bacterial solution with sterile filter paper, and place them in a medium containing 6... The tobacco leaves were cultured in the dark at 25°C for two days in MS medium containing BA (0.02 mg / L) and NAA (2 mg / L). The leaves were then transferred to differentiation medium, with the cut surfaces in contact with the medium. The differentiation medium was MS medium containing 6 BA (0.5 mg / L), NAA (0.1 mg / L), hygromycin (20 mg / L), and cephalosporin (500 mg / L). Subculture was performed every 2-3 weeks. Callus tissue gradually formed at the cut surfaces, and eventually, buds differentiated. The buds that grew to 3-5 cm were cut off and transferred to MS medium to induce rooting. After rooting, the gene-edited plants were removed from the rooting medium, the medium was washed off with tap water, and then transplanted into sterile nutrient soil.

[0046] Sequencing to screen mutant materials: To determine the variations at the mutation sites, detection primers for mutant materials were designed flanking the target sites. The primer sequences include NtHL1. S162F and NtHL1 S1056R, primer sequence is as follows: NtHL1 S162F:5'-TTCATGGATCAAGGTGGATGA-3' (SEQ ID NO.6), NtHL1 S1056R: 5'-TTGTACCTTGATAATCCACTGC-3' (SEQ ID NO. 7).

[0047] After T0 generation transformed tobacco seedlings have grown for about one week, leaves from 20 seedlings were selected and DNA was extracted using the DNeasyPlant MiniKit (QIAGEN). The DNA was then extracted using the primers NtHL1 designed in the previous steps. S162F / NtHL1 S1056R was used for amplification, and the amplification product was purified and then used with NtHL1. Sequencing was performed using S162F primers. Analysis of the sequencing results yielded an edited material with the mutation of this invention occurring at the target site. This material was continuously planted for two generations, with two edited materials exhibiting the mutation of this invention selected from each generation to obtain the T2 generation mutant material.

[0048] The T2 generation plants include two segregation types, one of which is Cas9. Positive plants (transgenic plants), another type is Cas9. To avoid the continuous editing of the K326 wild-type allele introduced by hybridization by sgRNA and Cas9, which would lead to complex mutation types, negative-negative plants (non-transgenic plants) need to be selected from T2 generation plants through genotyping to avoid the mutations caused by sgRNA and Cas9 continuously editing the allele. These plants can then be hybridized with African tobacco.

[0049] The genotyping steps for T2 generation plants are as follows: After extracting leaf DNA using the CTAB method, the DNA was then analyzed using the Cas9 gene-specific primer Cas9. F (SEQ ID NO.17) and Cas9 R (SEQ ID NO.18) was used for PCR amplification.

[0050] Cas9 F: 5' TGTCCCAGGATTAGAATGATTAGGC 3', Cas9 R: 5' AGCCCTCTTCTTTCGATCCATCAAC 3'.

[0051] After performing agarose gel electrophoresis on the PCR products, Cas9 was distinguished based on the results. Positive plants and Cas9 Negative-colored plants.

[0052] Further targeting Cas9 NtHL1 in negative-colored plants The targets of the S gene were sequenced; the genetic information of the T2 generation mutation type was determined based on the sequencing results.

[0053] Example 2: Phenotypic identification of F1 cells from hybridization of mutant materials with African tobacco The T2 generation plant material that does not contain the Cas9 gene, as identified in Example 1, was used. nthl1 s33 As a parent, it was crossed with African tobacco plants to obtain F1 seeds. More than 10,000 F1 seeds were sown in culture pots, and seed germination and seedling growth were observed. 28 days after sowing (28DAS), the F1 plants resulting from the cross between K326 and African tobacco showed lethality, with most cotyledons turning yellow and some plants even dying. Figure 1 ), and mutant nthl1 s33 The lethality of F1 plants hybridized with African tobacco disappeared, and the plants grew normally. Figure 2 ).

[0054] Example 3: Development and application of primer combinations for molecular marker screening In this invention, PCR primer sets or KASP primer sets are developed for the obtained mutant mutation sites.

[0055] The PCR primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO. 8-10, as shown in Table 1.

[0056] Table 1 Primer sequences in PCR primer combinations

[0057] PCR primer set used to amplify tobacco NtHL1 S The SNP site is inserted at 474-475bp, where two TT bases are inserted.

[0058] The KASP primer set uses the S primer set; the S primer set consists of three primers with nucleotide sequences as shown in SEQ ID NO.11, SEQ ID NO.12, and SEQ ID NO.10, as shown in Table 2.

[0059] Table 2 Primer sequences in KASP primer combinations

[0060] The KASP primer set for screening tobacco mutants consists of three primers: a first upstream primer, a second upstream primer, and a downstream primer, used to amplify a single SNP site. The last base at the 3' end of the first upstream primer corresponds to the SNP genotype of tobacco K326; the last base at the 3' end of the second upstream primer corresponds to the tobacco... NtHL1 S The SNP genotype of the mutant. In the primer set, the first upstream primer contains a FAM fluorescent tag sequence at its 5' end, and the second upstream primer contains a HEX fluorescent tag sequence at its 5' end.

[0061] The KASP33_S primer set was used to amplify the SNP site at 472-473 bp in tobacco, where it was replaced with A.

[0062] In this embodiment, PCR primer combinations were used to detect the seedling material of the F2 population of tobacco plants. The F2 population material consisted of mutants. nthl1 s33 F2 populations are obtained through hybridization and self-pollination with any other cultivated tobacco. The selection process for the F2 population includes the following steps: a) Extract DNA from the leaves of F2 tobacco plants; b) Perform PCR amplification of tobacco DNA using the above-mentioned PCR primer set; c) Detect the amplification results, determine the genotype of the SNP sites amplified by each PCR primer set in tobacco, and screen for SNP sites that are compatible with the PCR primer set. nthl1 s33 Intermediate breeding materials of genotypes.

[0063] In this embodiment, molecular marker screening uses a kit to detect seedling materials of F2 tobacco plants; the kit includes a PCR primer set or a KASP primer set.

[0064] When the kit includes the KASP primer set, the kit also includes a PCR premix; the PCR premix contains a first fluorescent probe, a first quencher probe, a second fluorescent probe, and a second quencher probe.

[0065] The nucleotide sequence of the first fluorescent probe is identical to that of the first tag sequence in the KASP primer set, and the 5' end of the first fluorescent probe is connected to the first fluorescent group; the nucleotide sequence of the first quencher probe is inversely complementary to the nucleotide sequence of the first tag sequence, and the 3' end of the first quencher probe is connected to the quencher group.

[0066] The nucleotide sequence of the second fluorescent probe is identical to that of the second tag sequence in the KASP primer set. The 5' end of the second fluorescent probe is connected to the second fluorescent group. The nucleotide sequence of the second quencher probe is inversely complementary to the nucleotide sequence of the second tag sequence. The 3' end of the second quencher probe is connected to the quencher group.

[0067] The first tag sequence is GAAGGTGACCAAGTTCATGCT (SEQ ID NO.19); the second tag sequence is GAAGGTCGGAGTCAACGGATT (SEQ ID NO.20); the first fluorescent group is FAM, and the second fluorescent group is HEX.

[0068] In this embodiment, a kit is used to screen F2 tobacco seedlings. The screening method includes the following steps: a) Extract DNA from the leaves of F2 tobacco plants; b) Add KASP primers and PCR premix to the DNA of F2 tobacco plant leaves for KASP amplification; c) Detect fluorescence signals to determine the genotypes of SNP sites amplified by each KASP primer set in the new sterile and maintainer lines of tobacco, and screen for SNP sites using PCR primer sets. nthl1 s33 Intermediate breeding materials of genotypes. nthl1 s33 Intermediate breeding material of genotype is the donor parent. nthl1 s33 The offspring of crosses and backcrosses between tobacco and common tobacco, such as the recipient parent K326.

[0069] The method for SNP labeling using the KASP33S primer set provided in this embodiment includes: Preparation of KASP primer working solution: Take 12 μL (100 μM) each of the upstream primer (first upstream primer and second upstream primer) and 30 μL (100 μM) of the downstream primer, and make up to 100 μL with sterile ultrapure water. Mix thoroughly to obtain the KASP primer working solution.

[0070] PCR system: 2 μL DNA template (approximately 30 ng / μL), 0.08 μL KASP primer working solution, 2.5 μL KASP-TF V4.0 2X Master Mix (LGC Corporation, catalog number LGC-KBS-1050-132), and add sterile ultrapure water to a final volume of 5 μL.

[0071] PCR program: Step 1, pre-denaturation at 95℃ for 15 min; Step 2, denaturation at 95℃ for 20 s, followed by annealing at 65-57℃ (decreasing by 1℃ per cycle) for 60 s, for a total of 9 cycles; Step 3, denaturation at 95℃ for 20 s, followed by annealing at 57℃ for 1 min, for a total of 32 cycles; store at 10℃.

[0072] The experiment also included a blank control (NTC) without DNA template in the PCR system, with one blank control set for each primer set.

[0073] The PCR results are as follows: After the reaction, the amplified products were amplified using a fluorescence microplate reader (BMG Labtech, Germany, FLUOstar OPTIMA). The fluorescence signal data was read and the genotype was determined using SNP viewer software. The results of SNP genotyping are as follows: Figure 3 As shown, if the fluorescence signal data of the amplification product of the tested tobacco is close to the X-axis according to SNPviewer software analysis, then the genotype of the tested tobacco is the K326 parental type; if the fluorescence signal data of the amplification product of the tested tobacco is close to the Y-axis according to SNPviewer software analysis, then the genotype of the tested tobacco is... nthl1 s33Parental type; if the fluorescence signal data of the amplification product of the test tobacco is close to the diagonal line according to SNPviewer software analysis, then the genotype of the test tobacco is heterozygous; the fluorescence signal data of the amplification product of the negative control appears black when close to the origin according to SNPviewer software analysis. This proves that the SNP genotyping results screened using the KASP33S primer set provided in this embodiment are consistent with the genotype and have good genotyping effect.

[0074] Validation of SNP markers used for screening for male sterile tobacco cell lines: use nthl1 s33 Genotypes crossed with K326 and self-crossed F2 segregating populations were used for verification. nthl1 s33 SNP markers for genotype screening.

[0075] KASP detection was performed on the DNA of 82 plants using the KASP33S primer set, with two homozygous parents ( nthl1 s33 Using K326 and its F1 hybrids as controls, and ultrapure water without DNA as a negative control, the test results are as follows: Figure 4 As shown. Figure 4 In the genotyping results for each primer set, the sample in the upper left corner is... nthl1 s33 Homozygous genotypes: the sample in the bottom right corner is homozygous for K326, the sample in the middle diagonal position is heterozygous, and the sample in the bottom left corner is an unamplified sample. A total of 90 samples were collected, including 82 F2 tobacco DNA samples and 2... nthl1 s33 DNA sample, 2 K326 DNA samples, 2 nthl1 s33 DNA samples from ×K326 F1, and two ultrapure water samples without added DNA (as negative controls).

[0076] Compared with traditional marker screening, the KASP primer set developed in this invention has advantages such as high accuracy, low cost, and high detection efficiency, making it suitable for large-scale screening of male-sterile and maintainer lines in tobacco breeding. The identification method using the KASP primer set of this invention can perform early-generation screening for male-sterile and maintainer line breeding and hybridization, greatly shortening the breeding cycle for male-sterile line conversion and improving breeding efficiency.

[0077] While specific embodiments have been provided in this invention, it should be understood that further modifications can be made to the invention. In summary, in accordance with the principles of this invention, this application is intended to include any changes, uses, or improvements to the invention, including modifications made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A genetic mutant that overcomes distant hybrid lethality, characterized in that, This is a mutation to the gene by replacing the bases at positions 472 and 473 with A. NtHL1 S This is a mutation to the gene by replacing the bases at positions 472 and 473 with A.

2. An expression cassette comprising, containing the genetic mutant of claim 1.

3. A recombinant vector, characterized in that, containing the genetic mutant of claim 1 or the expression cassette of claim 2.

4. A recombinant microorganism, characterized in that, containing the genetic mutant of claim 1, the expression cassette of claim 2 or the recombinant vector of claim 3.

5. A method of overcoming the lethality of distant hybridization of tobacco, characterized in that, The genetic mutant of claim 1 is created by gene editing, and the mutant plant is used as a male parent or a female parent to cross with other wild tobacco varieties, and the normal hybrid F1 is used for offspring screening.

6. The method of claim 5, wherein, The nucleotide sequence of the vector target site in the gene editing process is shown as SEQ ID NO. 4 and SEQ ID NO.

5.

7. The method of claim 6, wherein, The nucleotide sequence of the upstream primer for detecting the vector target site is shown as SEQ ID NO. 6, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.

7.

8. The method of claim 5, wherein, The genetic mutant is connected with a molecular marker for detection, and the primer combination for detecting the molecular marker includes a PCR primer combination or a KASP primer combination.

9. The method of claim 8, wherein, The nucleotide sequence of the primer of the PCR primer combination is shown as SEQ ID NO. 8, SEQ ID NO. 9 and SEQ ID NO. 10, and the nucleotide sequence of the primer of the KASP primer combination is shown as SEQ ID NO. 11, SEQ ID NO. 12 and SEQ ID NO.

10.

10. A detection primer, characterized in that, It includes the PCR primer combination and / or the KASP primer combination in the method of claim 8 or 9.