OsSPL14 gene and application of protein coded by OsSPL14 gene in regulation and control of diameter of plant root system

By driving the expression of the OsSPL14 gene through the OsCYCB1.1 promoter, the root diameter of rice was regulated, solving the technical problem of rice root improvement, achieving significant thickening of rice roots and improvement of stress resistance, and cultivating new high-yield and stable-yield varieties.

CN121362778APending Publication Date: 2026-01-20INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202410974202.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-07-19
Publication Date
2026-01-20

AI Technical Summary

Technical Problem

How to effectively regulate the diameter of plant roots to improve the root morphology of rice and increase its yield and stress resistance.

Method used

By utilizing the OsCYCB1.1 promoter, a root-specific gene, to drive the expression of the OsSPL14 gene, the diameter of rice roots can be regulated, thereby increasing the diameter of rice roots through genetic engineering.

Benefits of technology

It significantly increased the diameter of adventitious roots and the number of cortical cells in rice, improved the rice root system, and cultivated new rice varieties with high yield, stable yield, high quality, and good stress resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The invention discloses an application of an OsSPL14 gene and a protein coded by the OsSPL14 gene in regulating and controlling the diameter of a plant root system, and belongs to the technical field of gene engineering. The technical problem to be solved by the invention is how to regulate and control the root diameter of a plant. In order to solve the technical problem, the invention provides application of the protein or a substance for regulating and controlling the expression of a protein coding gene or a substance for regulating and controlling the activity or content of the protein in regulating and controlling the diameter of a plant root system. The protein has an amino acid sequence of sequence 2. The invention discloses that OsSPL14 is an important gene for regulating and controlling the diameter of the rice root for the first time. The expression of the OsSPL14 is driven by using a specific promoter, so that the regulation effect of the OsSPL14 in a rice root system can be specifically exerted, and the diameter of the adventitious root of the rice is increased. The OsSPL14 provided by the invention has important significance in cultivating a new rice variety with high and stable yield, high quality and good stress resistance.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering, and relates to OsSPL14 application of a gene and a protein encoded by the gene in regulating plant root diameter. Specifically, it relates to cloning of a rice OsSPL14 gene by a positive genetics approach, and to regulating rice root diameter and controlling development of rice adventitious roots by driving expression of the gene by a root-specific promoter of the gene OsCYCB1.1, and to application of the gene in improving root architecture of rice. BACKGROUND

[0002] Rice is the most important food crop in China, and more than 65% of the population in China take rice as their staple food. Plant roots are important organs for absorbing water and nutrients, and can synthesize and secrete hormones, enzymes, organic acids and the like. Water and nutrients absorbed and transported by roots are used for growth and development of the above-ground parts as well as for providing water, nutrients and plant hormones required for growth and development of the above-ground parts. Root morphological characteristics are closely related to yield of rice, and it has been shown that a healthy and vigorous root system is more conducive to absorption and utilization of water and nutrients by rice, and makes rice survive better under stress, with the advantages of high yield and stable yield. Root breeding is increasingly important in rice breeding, and rice root breeding is to take rice roots as the research object, and to improve related root characteristics by certain techniques to shape an ideal root type, aiming to breed rice varieties with high yield, stable yield, high quality and good stress resistance.

[0003] Genetic research on rice root characteristics mainly includes basic root characteristics such as root length, root diameter, root number, root volume and root surface area. In-depth research on rice root characteristics, according to breeding objectives, and by means of molecular biology and the like, can improve rice roots by genetic improvement, and optimize functions of rice roots, so as to achieve high yield, stress resistance and the like. SUMMARY

[0004] The technical problem to be solved by the present application is how to regulate the root diameter of a plant.

[0005] To solve the above technical problem, the present application provides application of a protein or a substance for regulating expression of a gene encoding the protein or a substance for regulating activity or content of the protein in any one of the following, A1), in regulating the root diameter of a plant; A2), in preparing a product for regulating the root diameter of a plant; A3), in plant breeding or assisted plant breeding; A4), in preparing a product for plant breeding or assisted plant breeding; The protein can be any one of the following proteins: a1) a protein with an amino acid sequence shown as SEQ ID NO. 2; a2) a protein with an amino acid sequence shown as SEQ ID NO. 2, which is obtained by substitution, deletion and / or addition of amino acid residues of the amino acid sequence shown as SEQ ID NO. 2, and has more than 90% identity with the amino acid sequence shown as SEQ ID NO. 2 and has the same function; a3) a fusion protein obtained by connecting a tag to the N terminal and / or C terminal of a1) or a2).

[0006] In the application, the regulation can be improvement or promotion or up-regulation.

[0007] In the application, the regulation can also be reduction or inhibition or down-regulation.

[0008] In the application, the protein can be derived from rice.

[0009] In the application, SEQ ID NO. 2 consists of 417 amino acid residues.

[0010] The above-mentioned protein can be artificially synthesized, or a gene encoding the protein can be synthesized first and then expressed biologically.

[0011] The connection in a3) can be through a peptide bond.

[0012] The protein tag refers to a polypeptide or protein fused and expressed with a target protein by DNA in vitro recombination technology, so as to facilitate the expression, detection, tracking and / or purification of the target protein. The protein tag can be a Flag protein tag, a His protein tag, an MBP protein tag, an HA protein tag, a myc protein tag, a GST protein tag and / or a SUMO protein tag, etc.

[0013] In the application, the purpose of plant breeding can be to obtain a target plant with a root diameter higher than that of the parent.

[0014] In the application, the evaluation index of plant breeding includes the root diameter of the plant.

[0015] In the application, the substance for regulating the activity or content of the protein can be a substance for improving the expression of the gene encoding the protein.

[0016] In the application, the substance for regulating the activity or content of the protein can also be a substance for knocking out the gene encoding the protein and / or a substance for regulating the expression of the gene encoding the protein.

[0017] In the application, the substance for regulating gene expression can be a substance for regulating at least one of the following six regulations: 1) regulation at the transcription level of the gene; 2) regulation after the transcription of the gene (i.e. regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e. regulation of mRNA transport from the nucleus to the cytoplasm of the gene); 4) regulation of translation of the gene; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e. regulation of the activity of the protein translated from the gene).

[0018] In the application, the regulation of gene expression can be inhibition or reduction of the gene expression, which can be achieved by gene knockout or by gene silencing.

[0019] The gene knockout refers to the phenomenon of inactivating a specific target gene by homologous recombination. The gene knockout is inactivating a specific target gene by changing the DNA sequence. The gene silencing refers to the phenomenon of making a gene not expressed or lowly expressed without damaging the original DNA. The gene silencing is based on the premise of not changing the DNA sequence, and makes a gene not expressed or lowly expressed. The gene silencing can occur at two levels. One is the transcription level gene silencing caused by DNA methylation, heterochromatinization and position effect, etc. The other is the post-transcriptional gene silencing, i.e. inactivating a gene by specifically inhibiting the target RNA after the transcription of the gene, including antisense RNA, co-suppression, quelling, RNA interference (RNAi) and microRNA (miRNA) mediated translation inhibition, etc.

[0020] In the application, the substance for regulating gene expression can be an agent for inhibiting or reducing the gene expression. The agent for inhibiting or reducing the gene expression can be an agent for knocking out the gene, such as an agent for knocking out the gene by homologous recombination or an agent for knocking out the gene by CRISPR-Cas9. The agent for inhibiting or reducing the gene expression can comprise a polynucleotide targeting the gene, such as siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0021] Further, in the application, the substance for regulating the expression of a protein-coding gene or the substance for regulating the activity or content of the protein is a biological material, which can be any of the following: B1) a nucleic acid molecule encoding the protein; B2) an expression cassette containing the nucleic acid molecule of B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3).

[0022] Furthermore, in the aforementioned application, the nucleic acid molecule in B1) can be any one of the following DNA molecules: g1)-g3) g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID NO.3, numbers 3241-4494; g2) The nucleotide sequence of the coding strand is the DNA molecule of SEQ ID NO.1; g3) DNA molecules that have more than 80% identity with the DNA molecules described in g1) or g2) and regulate the diameter of plant roots.

[0023] Furthermore, in the aforementioned application, the expression cassette described in B2) refers to DNA capable of expressing the protein in a host cell, which may include not only a promoter to initiate transcription of a protein-coding gene, but also a terminator and / or enhancer sequence to terminate transcription of a protein-coding gene.

[0024] Furthermore, in the aforementioned application, the promoter in the expression box described in B2) is... CYCB1.1 The promoter, the CYCB1.1 The nucleotide sequence of the promoter is positions 6-3234 of SEQ ID NO.3.

[0025] In some embodiments of this application, the recombinant vector described in B3) may be... pCAMBIA1300-proCYCB1.1- OsSPL14 cDNA-rbcs Plasmid. pCAMBIA1300-proCYCB1.1-OsSPL14 cDNA-rbcs It is a circular plasmid, and its nucleotide sequence is SEQ ID NO.3. Positions 6-3234 of SEQ ID NO.3 are... CYCB1.1 The nucleotide sequence of the promoter, positions 3241-4494 are... OsSPL14Coding sequence. pCAMBIA1300-proCYCB1.1-OsSPL14 cDNA-rbcs The plasmid can express a protein of SEQ ID NO. 2.

[0026] Further, in the application, B4) the recombinant microorganism can be yeast, bacteria, algae and fungi.

[0027] Further, in the application, B6) the plant tissue can be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos and anthers.

[0028] Further, in the application, B7) the transgenic plant organ can be roots, stems, leaves, flowers, fruits and seeds of the transgenic plant.

[0029] Further, in the application, the transgenic plant cell line, transgenic plant tissue and transgenic plant organ can or can not include propagation material.

[0030] In the present application, the expression amount of the protein-encoding gene in the plant can be up-regulated or the activity or content of the protein can be increased by introducing an expression vector containing the protein-encoding gene, thereby increasing the root diameter of the plant.

[0031] The present application also provides a method for obtaining a plant with increased root diameter, which comprises obtaining a target plant with a higher root diameter than a receptor plant by increasing the content or activity of the protein in the receptor plant.

[0032] Further, the method comprises introducing a nucleic acid molecule encoding the protein into the receptor plant to increase the content or activity of the protein in the receptor plant.

[0033] Further, in the method, the nucleic acid molecule can be any one of the following g1) - g3): g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID NO. 3 3241-4494; g2), the nucleotide sequence of the coding strand is a DNA molecule of SEQ ID NO. 1; g3), the DNA molecule has more than 80% identity to the DNA molecule of g1) or g2), and regulates the root diameter of the plant.

[0034] The present application also provides a method for increasing the root diameter of a plant, which comprises increasing the root diameter of a receptor plant by increasing the content or activity of the protein in the receptor plant.

[0035] Further, the method comprises introducing a nucleic acid molecule encoding the protein into the receptor plant to increase the content or activity of the protein in the receptor plant.

[0036] Further, in the method, the nucleic acid molecule can be any one of the following g1) - g3): g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID NO. 3 3241-4494; g2), the nucleotide sequence of the coding strand is a DNA molecule of SEQ ID NO. 1; g3), the DNA molecule has more than 80% identity with the DNA molecule of g1) or g2), and regulates the diameter of the plant root system.

[0037] Further, in the method, the nucleic acid molecule is introduced into the recipient plant in the form of a vector.

[0038] In some embodiments of the present application, the vector is pCAMBIA1300-proCYCB1.1- OsSPL14 cDNA-rbcs a plasmid.

[0039] The above-mentioned protein and its related biological materials are also the protection content of the present application. The biological material can be described in B1) - B7) above.

[0040] Further, in the present application, the plant is selected from monocotyledonous plants.

[0041] Further, in the present application, the monocotyledonous plant is selected from grasses.

[0042] Further, in the present application, the grass is selected from the genus Oryza.

[0043] Further, in the present application, the genus Oryza can be selected from rice.

[0044] In the present application, identity refers to the identity of amino acid sequence or nucleotide sequence. The identity of amino acid sequence (or nucleotide sequence) can be determined using the homology search site on the Internet, such as the BLAST page of the NCBI homepage website. For example, the identity of a pair of amino acid sequences can be calculated by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively in Advanced BLAST 2.1, and then the value of identity (%) can be obtained.

[0045] The above-mentioned 80% or more than 80% identity can be 80%, 85%, 90% or more than 95% identity.

[0046] The 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 85% or more identity can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 95% or more identity can be at least 95%, 96%, 97%, 98%, or 99% identity.

[0047] The beneficial technical effects obtained by the present application are as follows: This application is being published for the first time. OsSPL14 The role of genes in regulating rice root diameter. This is achieved through the use of specific promoters. OsSPL14 The expression of [the substance] can specifically exert [its effect]. OsSPL14 The regulatory role of genes in rice roots, increasing the diameter of adventitious roots and improving the root system, is an effective genetic locus for root breeding. Improving root traits to create ideal root types is an effective method for breeding new rice varieties that are high-yielding, stable-yielding, high-quality, and resilient. OsSPL14 Genes have high application value in rice root regulation and rice breeding. Attached Figure Description

[0048] Figure 1Figure 6. Root phenotypes of proCYCB1.1-OsSPL14 transgenic materials. A is wild type Shigella white hair (SSBM), scale bar is 200 μm. B is wild type Shigella white hair (SSBM) adventitious root tip cross section dyed with calcofluor white cell wall staining solution, then the picture was taken under the microscope field, scale bar is 150 μm. Green and red asterisks represent the number of cortex layers and cortex cells respectively, and the red arrow points to the root diameter; calcofluor white is a staining product of Sigma-Aldrich Company, the item number is 18909-100ML-F. C is wild type Shigella white hair (SSBM) adventitious root tip cross section dyed with calcofluor white cell wall staining solution, then the picture was taken under the microscope RFP channel, the excitation wavelength is 540-580 nm, scale bar is 150 μm. D is transgenic seedling adventitious root tip, scale bar is 200 μm. E is transgenic seedling adventitious root tip cross section dyed with calcofluor white cell wall staining solution, then the picture was taken under the microscope field, scale bar is 150 μm, green and red asterisks represent the number of cortex layers and cortex cells respectively, and the red arrow points to the root diameter. F is transgenic seedling adventitious root tip cross section dyed with calcofluor white cell wall staining solution, then the picture was taken under the microscope RFP channel, the excitation wavelength is 540-580 nm, scale bar is 150 μm. Figure 2Statistical analysis of root phenotype data of proCYCB1.1-OsSPL14 transgenic materials. A, the average root diameter of wild type Ishikari-shiroke (SSBM) and proCYCB1.1-OsSPL14 transgenic materials, the values represent the mean ± standard deviation, which were calculated from three independent biological replicates, and the sample size was 7; ** and *** represent the significant level (P < 0.01) and extremely significant level (P < 0.001) in t test, respectively; B, the number of root cortex cell layers of wild type Ishikari-shiroke (SSBM) and proCYCB1.1-OsSPL14 transgenic materials, the values represent the mean ± standard deviation, which were calculated from three independent biological replicates, and the sample size was 7; ** and *** represent the significant level (P < 0.01) and extremely significant level (P < 0.001) in t test, respectively; C, the number of root cortex cells of wild type Ishikari-shiroke (SSBM) and proCYCB1.1-OsSPL14 transgenic materials, the values represent the mean ± standard deviation, which were calculated from three independent biological replicates, and the sample size was 7; ** and *** represent the significant level (P < 0.01) and extremely significant level (P < 0.001) in t test, respectively; D, the stele diameter of wild type Ishikari-shiroke (SSBM) and proCYCB1.1-OsSPL14 transgenic materials, the values represent the mean ± standard deviation, which were calculated from three independent biological replicates, and the sample size was 5; ** and *** represent the significant level (P < 0.01) and extremely significant level (P < 0.001) in t test, respectively. DETAILED DESCRIPTION

[0049] The application will be further described in conjunction with the specific embodiments. The examples given are only for the purpose of illustrating the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the application.

[0050] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels, unless otherwise specified.

[0051] In the following examples, the rice Ishikari-shiroke (SSBM) is preserved by the applicant, and is described in the literature “Xu, L., Zhao, H., Wan, R. et al.Identification of vacuolar phosphate efflux transporters in land plants. Nature Plants 5, 84–94 (2019)” is available to the public from the applicant, the resulting biological material can only be used for the verification of this application, and cannot be used for other purposes.

[0052] The quantitative test in the following examples is set up in triplicate, and the average value is taken unless otherwise specified.

[0053] The method of extracting DNA involved in the following examples uses TPS method for crude extraction of DNA, and the TPS formula is as follows: Tris-HCl (pH8.0)100 mM EDTA (pH8.0)10 mM KCl1 M The method of extracting rice DNA is as follows: 1) Take rice leaves 1-3 cm 2 After cutting, put it into a sterilized 2 mL centrifuge tube, add 300 μL of rice DNA extraction solution (TPS), grind the sample with a grinding rod, and mix the sample thoroughly.

[0054] 2) DNA sample extraction solution 65℃ water bath for 15-30 minutes (try to omit the water bath step, which can also be done), every 10 minutes or so, mix well by inverting.

[0055] 3) 12000 rpm / min centrifugation, room temperature centrifugation for 5-10 minutes.

[0056] 4) Take about 150-200 μL of supernatant to another new 2 mL centrifuge tube, add an equal volume of isopropanol, and mix well by inverting.

[0057] 5) 12000 rpm centrifugation for 10 minutes, discard the supernatant, add 500 μL of 70% ethanol to resuspend the precipitate for washing.

[0058] 6) 12000 rpm centrifugation for 10 minutes, discard the supernatant, and dry by inverting.

[0059] 7) After the alcohol completely evaporates, add RNase aqueous solution (10 mg / l) 100 μL to dissolve the DNA The extraction of RNA and the synthesis of reverse transcription cDNA in the following examples use the commercial kit name: EastepTM Super Total RNA Extraction Kit, manufacturer: Promega, product number: LS1040, and the specific steps refer to the corresponding instructions.

[0060] Example 1, construction OsSPL14 Up-regulated rice transgenic plants OsSPL14 The genomic sequence of the gene is SEQ ID NO. 1, and the coding sequence (CDS) is SEQ ID NO. 3, 3241-4494 (including the stop codon). The amino acid sequence of the OsSPL14 protein is SEQ ID NO. 2.

[0061] The inventors of the present application use the root of rice Ishikari-shiroke (SSBM for short in Chinese) as the material, extract the total DNA of rice by TPS method, extract the total RNA by commercial kit and obtain the cDNA by reverse transcription, and the reference sequence is from the rice genome sequence and rice miRNA database in NCBI GenBank database.

[0062] According to OsSPL14 The reference sequence is designed to amplify the primer, and the rice cDNA is used as the template to amplify the coding region sequence of the rice OsSPL14-1 gene by PCR. OsSPL14-2 And OsSPL14 The vector is treated by Kpn1 and BamH1 double enzyme digestion and purified, and then the fragment is homologously recombined into pCAMBIA1300 by seamless cloning, and the correct clone obtained is named pCAMBIA1300-OsSPL14 cDNA by transforming the competent cells of E. coli DH5α, PCR verification, sequencing confirmation.

[0063] The PCR primer sequences used are as follows (the underlined part is the enzyme digestion recognition site, and the capital letters are the coding region sequence of the rice OsSPL14 ): OsSPL14-1: 5'-cgg ggtacc ATGGAGATGGCCAGTGGAGG-3'; OsSPL14-2: 5'-cgc ggatccCTA CAGAGACCAATCCATCGTGTTGC-3'; Amplification of root-specific promoter CYCB1.1 The promoter DNA sequence of the gene, CYCB1.1 specifically expressed in the root tip meristem, lateral root and lateral root primordium , Not expressed in leaves。 Design PCR amplification primers for its promoter sequence, using rice DNA as a template, and use... proCYCB1.1-1 and proCYCB1.1-2 Primers for cloning rice CYCB1.1 The promoter DNA sequence was obtained, and the vector was purified after double digestion with EcoR1 and Kpn1. Homologous recombination of the fragment was then performed via seamless cloning. pCAMBIA1300- OsSPL14 cDNA The correct clone was obtained by transforming E. coli competent cells DH5α, and verified by PCR and sequencing. It was named […]. pCAMBIA1300-proCYCB1.1-OsSPL14 cDNA .

[0064] pCAMBIA1300-proCYCB1.1-OsSPL14 cDNA It is a circular plasmid, and its nucleotide sequence is SEQ ID NO.3, where positions 6-3234 of SEQ ID NO.3 are... CYCB1.1 The nucleotide sequence of the promoter, positions 3241-4494 are... OsSPL14 The encoded sequence terminates with NOS (serial numbers 4519-4771 of SEQ ID NO.3). pCAMBIA1300- proCYCB1.1-OsSPL14 cDNA The plasmid contains the bacterial selection marker kanamycin (SEQ ID NO.3, positions 10062-10583) and the plant selection marker hygromycin (SEQ ID NO.3, positions 11597-12619).

[0065] The PCR primer sequences used are as follows (underlined marks indicate restriction enzyme recognition sites, uppercase letters are...). CYCB1.1 (Promoter sequence) ProCYCB1.1-1:5'-ccatgattac gaattc TATAGACTAAGCCATTGAGGCGT-3' ProCYCB1.1-2:5'-ctggccatctccat ggtacc AGAGCTGATCTCGATGACATGCT-3' The expression vector was introduced into Agrobacterium tumefaciens EHA105 using electroporation to obtain recombinant Agrobacterium. This recombinant Agrobacterium was then further transformed into Ishikari Shirabumi (SSBM) using Agrobacterium-mediated genetic transformation to obtain T0 generation transgenic rice. Agrobacterium-mediated genetic transformation of rice is a relatively conventional and known formula and commonly used reagent in the market; therefore, no special treatment was performed in this application, and will not be described in detail.

[0066] T0 generation was extracted using the TPS method. OsSPL14 The genomic DNA of the roots of transgenic rice was used as a template, and primers were applied. OsSPL14-3 and OsSPL14-4The primer pair is subjected to PCR amplification to obtain a PCR product. If the PCR amplification product is a 381 bp DNA fragment, the corresponding rice is a transgenic rice positive seedling of OsSPL14 PCR amplification primer sequences are as follows: OsSPL14-3 : 5'-cttcgaccaaaccagcaaca-3' OsSPL14-4 : 5'-gtcttgtagttgccgtcgtc-3' After identification, 10 T0 generation transgenic rice plants of OsSPL14 are obtained, and are named proCYCB1.1- OsSPL14-1 to proCYCB1.1-OsSPL14-10 respectively. Total RNA is extracted from the roots of the transgenic seedlings and wild type rice SSBM respectively, and first strand cDNA is reverse transcribed from the total RNA. The relative expression amount of OsSPL14 gene in the roots is detected by qRT-PCR with the cDNA as a template, and the internal reference gene OsACTIN , OsACTIN qRT-PCR primer sequences (5'-3') of OsSPL14 are as follows, OsSPL14-F: TGGATGTCTCGCAGGGGTC; OsSPL14-R: GCCACAGGATTGCCATCAAA; OsACTIN-F: TTATGGTTGGGATGGGACA; OsACTIN-R: AGCACGGCTTGAATAGCG.

[0067] The SYBR Green quantitative kit of Roche Company is used for detection in the experiment.

[0068] The PCR reaction system is as follows, 10 μL system cDNA template 1 μL Primer F (10 μmol) 0.2 μL Primer R (10 μmol) 0.2 μL 2xSYBR Green Mix 5 μL H2O 3.6 μL The PCR reaction condition is as follows: 95℃ 5 min, 95℃ 10 sec, 60℃ 10 sec, 72℃ 10 sec, 40 cycles.

[0069] The results show that the relative expression amount of proCYCB1.1-OsSPL14-1 to proCYCB1.1-OsSPL14-10 in the roots of the transgenic rice plants is higher than that in the wild type riceOsSPL14 The expression level of the selected one of the representative strains was significantly increased compared to the wild type. proCYCB1.1- OsSPL14-1 Subsequent research and analysis were carried out.

[0070] Example 2, OsSPL14 Phenotype analysis of rice root of transgenic rice plants An appropriate amount of transgenic rice proCYCB1.1-OsSPL14-1 and wild type SSBM seeds were soaked in water, and the seeds were soaked at 37°C until they were white (2-4 days), and the water was changed in the morning and evening. The white rice seeds were sown on nylon mesh with rice full nutrient solution (pH about 5.5) in a rice incubator (daytime 30°C, nighttime 22°C, light intensity 3000 Lux, light time 12 hours) for 7 days, and then 10 transgenic strains proCYCB1.1-OsSPL14-1 and 10 wild type SSBM strains with consistent growth were selected and transferred to a rice culture tank (10 L) for further culture in rice full nutrient solution for 4 weeks. After the culture, 2 cm long adventitious roots of the transgenic seedlings and wild type roots were taken, embedded with 3% agarose, and then sliced with a Leica vibration slicer. The slices were stained with a Carl Kolvor fluorescent whitening agent, which is a non-specific fluorescent dye that can bind to cellulose and chitin in the cell wall.

[0071] Table 1. Formula of rice full nutrient solution

[0072] The results are shown in Figure 1 and Figure 2 Compared with the wild type, proCYCB1.1-OsSPL14 the transgenic strains with up-regulated expression have thicker adventitious roots (A in Figure 1 and Figure 2 The average diameter of the wild type root was 656 μm, while the average diameter of the transgenic seedling root was 1031 μm, which was significantly increased by 1.57 times compared with the wild type control.

[0073] The number of layers of cortical cells of the transgenic seedling was also significantly increased. The average number of layers of cortical cells of the wild type root was 11, while the average number of layers of cortical cells of the transgenic seedling root was 16, which was increased by 5 layers compared with the wild type control (B in Figure 1 and Figure 2 ).

[0074] Because the outermost layer of cells in the cortex is not arranged in an orderly manner, we selected the number of cells in the second layer near the epidermis to represent the number of cells in the cortex of rice roots. The number of layers of cells in the cortex of transgenic seedlings also increased significantly. The average number of second-layer cortex cells in wild-type roots was 60 cells, while the average number of cortex cells in transgenic root was 89 cells, which was 1.48 times that of the wild-type control (P < 0.05) Figure 1 and Figure 2 C).

[0075] The diameter of the central cylinder in transgenic seedlings also increased significantly. The average diameter of the central cylinder in wild-type roots was 564 μm, while the average diameter of the central cylinder in transgenic roots was 934 μm, which was 1.65 times that of the wild-type control (P < 0.05) Figure 1 and Figure 2 D).

[0076] The above experimental results show that OsSPL14 is an important gene that regulates the size of rice root diameter. By using a specific promoter to drive the expression of OsSPL14 , the regulatory effect of OsSPL14 in rice roots can be specifically exerted, the size of rice adventitious root diameter is improved, and rice root system is improved. It is an effective genetic locus for root breeding, and through certain techniques to improve related root traits to shape the ideal root type, it is an effective method to cultivate new rice varieties with high yield, stable yield, high quality, and good stress resistance.

[0077] The above describes the present application in detail. For those skilled in the art, without departing from the spirit and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wide range of equivalent parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In short, according to the principle of the present application, this application intends to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application.

Claims

1. Use of a protein or a substance that regulates expression of a gene encoding the protein or a substance that regulates activity or content of the protein in any of the following, A1) in regulating root diameter of a plant; A2) in preparing a product for regulating root diameter of a plant; A3) in plant breeding or plant assisted breeding; A4) in preparing a product for plant breeding or plant assisted breeding; the protein is any of the following: a1) a protein whose amino acid sequence is shown in SEQ ID NO. 2; a2) a protein that has more than 90% identity with the amino acid sequence shown in a1) and is related to root diameter of a plant, obtained by substitution, deletion and / or addition of amino acid residues in the amino acid sequence shown in a1); a3) a fusion protein obtained by linking a tag to the N terminus or / and C terminus of a1) or a2).

2. Use according to claim 1, characterized in that, the substance that regulates expression of a gene encoding the protein or a substance that regulates activity or content of the protein is a biological material, and the biological material is any of the following: B1) a nucleic acid molecule encoding the protein as claimed in claim 1; B2) an expression cassette containing the nucleic acid molecule as claimed in B1); B3) a recombinant vector containing the nucleic acid molecule as claimed in B1) or an expression cassette as claimed in B2); B4) a recombinant microorganism containing the nucleic acid molecule as claimed in B1), or an expression cassette as claimed in B2), or a recombinant vector as claimed in B3); B5) a transgenic plant cell line containing the nucleic acid molecule as claimed in B1), or an expression cassette as claimed in B2), or a recombinant vector as claimed in B3); B6) a transgenic plant tissue containing the nucleic acid molecule as claimed in B1), or an expression cassette as claimed in B2), or a recombinant vector as claimed in B3); B7) a transgenic plant organ containing the nucleic acid molecule as claimed in B1), or an expression cassette as claimed in B2), or a recombinant vector as claimed in B3).

3. Use according to claim 2, characterized in that, the nucleic acid molecule as claimed in B1) is a DNA molecule as claimed in any of g1) to g3) below: g1) a DNA molecule whose coding sequence on the coding strand is SEQ ID NO. 3 from 3241 to 4494; g2) a DNA molecule whose nucleotide sequence on the coding strand is SEQ ID NO. 1; g3) a DNA molecule that has more than 80% identity with the DNA molecule as claimed in g1) or g2) and regulates root diameter of a plant.

4. A method of obtaining a plant with increased root diameter, characterized in that, the method comprises obtaining a plant with higher root system by increasing content or activity of the protein as claimed in claim 1 in a recipient plant.

5. The method of claim 4, wherein, the method comprises introducing a nucleic acid molecule encoding the protein as claimed in claim 1 into a recipient plant to increase content or activity of the protein as claimed in claim 1 in the recipient plant.

6. The method of claim 5, wherein, the nucleic acid molecule is any of g1) to g3) below: g1) a DNA molecule whose coding sequence on the coding strand is SEQ ID NO. 3 from 3241 to 4494; g2) a DNA molecule whose nucleotide sequence of the coding strand is SEQ ID NO. 1; g3) a DNA molecule having 80% or more identity with the DNA molecule of g1) or g2), and which regulates the root diameter of a plant.

7. A method of increasing the diameter of a plant root system, characterized by, The method comprises increasing the root diameter of a recipient plant by increasing the content or activity of the protein of claim 1 in the recipient plant.

8. The method of claim 7, wherein, The method comprises introducing into a recipient plant a nucleic acid molecule encoding the protein of claim 1 to increase the content or activity of the protein of claim 1 in the recipient plant.

9. The method of claim 8, wherein, The nucleic acid molecule is any one of g1) - g3) below: g1) a DNA molecule whose coding sequence of the coding strand is SEQ ID NO. 3 3241-4494; g2) a DNA molecule whose nucleotide sequence of the coding strand is SEQ ID NO. 1; g3) a DNA molecule having 80% or more identity with the DNA molecule of g1) or g2), and which regulates the root diameter of a plant.

10. The protein of claim 1 and biological materials related thereto.

Citation Information

Cited By

  • Application of ZmRIN4 protein in regulation and control of corn root development

    CN119462871A