Application of 4-octyl itaconic acid in preparation of medicine for preventing and / or treating thrombotic diseases

Abstract

The invention discloses an application of 4-octyl itaconic acid in preparation of a medicine for preventing and / or treating thrombotic diseases. A large number of experiments prove that 4-octyl itaconic acid can prevent and treat thrombus induced by carrageenan and relieve endothelial injury caused by endotoxin, expression of adhesion factors and inflammatory factors in endothelial cells and generation of active oxygen can be reduced, and the 4-octyl itaconic acid is small in drug toxicity, high in safety and free of toxic and side effects. The compound has a wide application prospect in clinical prevention and treatment of thrombotic diseases.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, in particular to the application of 4-octyl itaconic acid in the preparation of a drug for preventing and / or treating thrombotic diseases. BACKGROUND

[0002] Thrombosis is a pathological process in which blood clots at the site of endothelial denudation or repair, and partially or completely blocks blood vessels, leading to interruption of blood supply. Acute myocardial infarction, ischemic stroke, pulmonary embolism, and disseminated intravascular coagulation caused by thrombosis often endanger the life safety of patients.

[0003] The occurrence of thrombosis is related to three key links: endothelial damage, slow blood flow, and high blood coagulation. After the damage of vascular endothelium, collagen is exposed, which activates endogenous coagulation. Slow blood flow makes platelets easy to adhere and deposit. The increase of platelets and coagulation factors or congenital anticoagulation defects (such as factor V Leiden, homocysteinemia, surgery, pregnancy, contraceptive drugs, anti-phospholipid antibodies, etc.) further increases the coagulability. Hypertension, elevated LDL-C, smoking, diabetes, obesity, aging, infection, HIV, and inflammation-oxidative stress can accelerate endothelial damage and platelet activation, and ultimately form thrombosis.

[0004] At present, the commonly used anti-thrombotic drugs such as aspirin and ticagrelor often have side effects such as asthma, gastrointestinal bleeding, arrhythmia, and high uric acid. In the context of the rapid rise of thrombosis rate with aging and sub-health lifestyle, there is an urgent need to provide a new anti-thrombotic drug candidate with lower side effects and anti-inflammatory effects for the elderly and sub-health population. SUMMARY

[0005] To solve the problems in the prior art, the present application provides the application of 4-octyl itaconic acid in the preparation of a drug for preventing and / or treating thrombotic diseases.

[0006] The first aspect of the present application provides the application of 4-octyl itaconic acid in the preparation of a drug for preventing and / or treating thrombotic diseases.

[0007] The second aspect of the present application provides the application of 4-octyl itaconic acid in the preparation of an anti-thrombotic drug.

[0008] The third aspect of the present application provides the application of 4-octyl itaconic acid in the preparation of a product for inhibiting the expression of adhesion factors and / or inflammatory factors in endothelial cells.

[0009] The fourth aspect of the present application provides the application of 4-octyl itaconic acid in the preparation of a product for inhibiting the adhesion of endothelial cells and monocytes.

[0010] The fifth aspect of the present application provides use of 4-octyl itaconic acid in the preparation of a product for inhibiting reactive oxygen species generation in endothelial cells.

[0011] The sixth aspect of the present application provides an antithrombotic preparation.

[0012] The seventh aspect of the present application provides a pharmaceutical composition.

[0013] To achieve the above object and other related objects, the present application provides the following technical solutions. Use of 4-octyl itaconic acid in the preparation of a medicament for preventing and / or treating thrombotic diseases, wherein the 4-octyl itaconic acid has a structural formula of and a CAS number of 3133-16-2. Use of 4-octyl itaconic acid in the preparation of an antithrombotic medicament, wherein the 4-octyl itaconic acid has a structural formula of . Use of 4-octyl itaconic acid in the preparation of a product for inhibiting expression of adhesion factors and / or inflammatory factors in endothelial cells, wherein the 4-octyl itaconic acid has a structural formula of . Preferably, the adhesion factors include ICAM1 and / or VCAM1.

[0014] Preferably, the inflammatory factors include IL-1β and / or TNF-α. Use of 4-octyl itaconic acid in the preparation of a product for inhibiting adhesion of endothelial cells to monocytes, wherein the 4-octyl itaconic acid has a structural formula of . Use of 4-octyl itaconic acid in the preparation of a product for inhibiting reactive oxygen species generation in endothelial cells, wherein the 4-octyl itaconic acid has a structural formula of . For any of the above uses, as a preferred solution, the effective use concentration of the 4-octyl itaconic acid is 5 μM-50 μM. As a more preferred solution, the effective use concentration of the 4-octyl itaconic acid is 25 μM-50 μM.

[0015] For any of the above uses, as a preferred solution, the effective use dosage of the 4-octyl itaconic acid is 10 mg / kg / d-50 mg / kg / d.

[0016] As a more preferred solution, the effective use dosage of the 4-octyl itaconic acid is 25 mg / kg / d-50 mg / kg / d.

[0017] An antithrombotic preparation, wherein the active ingredient has a structural formula of 4-octyl itaconic acid. As a preferred solution, the form of the preparation is injection, tablet, spray, granule, capsule, oral liquid or patch.

[0018] As a preferred solution, the content of the 4-octyl itaconic acid in the preparation is 5 μM-50 μM.

[0019] As a more preferred solution, the content of the 4-octyl itaconic acid in the preparation is 25 μM-50 μM.

[0020] A pharmaceutical composition comprising 4-octyl itaconic acid with a structural formula of and a pharmaceutically acceptable carrier. Compared with the prior art, the present application has the following beneficial effects: The present application has determined through a large number of experiments that the 4-octyl itaconic acid can prevent and treat thrombosis induced by carrageenan, relieve endothelial injury caused by endotoxin, reduce the expression and activity of adhesion factors and inflammatory factors in endothelial cells and the generation of reactive oxygen species, has less drug toxicity and higher safety, and has a broad application prospect in the prevention and treatment of thrombotic diseases in the clinic. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 The toxicity determination results of 4-octyl itaconic acid at different concentrations (0 μM, 5 μM, 10 μM, 25 μM, 50 μM) on human umbilical vein endothelial cells under the condition of being cultured for 24 hours in Example 1.

[0022] Figure 2 The mRNA levels of inflammatory factors and adhesion factors detected by RT-qPCR when the 4-octyl itaconic acid treated human umbilical vein endothelial cells exposed to 10 μg / ml of endotoxin in Example 2.

[0023] Figure 3 The protein levels of inflammatory factors and adhesion factors detected by Western blot when the 4-octyl itaconic acid treated human umbilical vein endothelial cells exposed to 10 μg / ml of endotoxin in Example 3.

[0024] Figure 4 The mutual adhesion between human umbilical vein endothelial cells and human monocytic leukemia cells reduced by 4-octyl itaconic acid in Example 4.

[0025] Figure 5 The intracellular reactive oxygen species level observed by fluorescence microscope when the 4-octyl itaconic acid treated human umbilical vein endothelial cells exposed to 10 μg / ml of endotoxin in Example 5; DAPI is a nuclear stain, and DCFH-DA is a reactive oxygen species probe.

[0026] Figure 6The images show the length of the thrombus formed in the tail of wild-type male mice after treatment with 4-octyl itaconic acid and the statistical results of the ratio of the thrombus length in the tail to the tail length in Example 6.

[0027] Figure 7 The results of the detection of serum alanine aminotransferase, aspartate aminotransferase and alkaline phosphatase levels in wild-type male mice after 4-octyl itaconic acid treatment for carrageenan-induced thrombosis in Example 6 are as follows. Detailed Implementation

[0028] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0029] Example 1: Assay of 4-octyl itaconic acid cytotoxicity

[0030] 1. Experimental Methods (1) Five generations of human umbilical vein endothelial cells were cultured and a cell suspension was prepared using DMEM culture medium containing 10% fetal bovine serum. 5000 cells were seeded into 96-well plates with a cell suspension volume of 200 μL per well.

[0031] (2) After 24 h of plate culture, human umbilical vein endothelial cells were randomly divided into 5 groups. 4-OI was used to treat the 5 groups of cells at final concentrations of 0 μM, 5 μM, 10 μM, 25 μM and 50 μM, respectively. Each group was set up with 6 replicates and treated for a total of 24 h.

[0032] (3) After the treatment, add 20 μL of MTT solution (final concentration of 5 mg / mL, prepared with double-free medium) to each well, incubate for 4 hours, then stop the culture, carefully aspirate the medium in the well, add 150 μL of DMSO to each well, and shake on a shaker at room temperature for 15 min to fully dissolve the crystals.

[0033] (4) Detect the light absorption value of each well at a wavelength of 550 nm on an enzyme-linked immunosorbent assay (ELISA) monitor and record the results.

[0034] 2. Experimental Results like Figure 1 As shown, there was no significant difference in endothelial cell activity under different concentrations of 4-octylitaconic acid treatment. This indicates that 4-octylitaconic acid has low endothelial cell damage and high safety.

[0035] Example 2: 4-Octylated itaconic acid reduces the expression of adhesion factor and inflammatory factor mRNA in human umbilical vein endothelial cells.

[0036] 1. Experimental method (1) In a 12-well plate, 500 human umbilical vein endothelial cells were added to each well for adherent culture.

[0037] (2) After stable adhesion, the human umbilical vein endothelial cells were randomly divided into a control group (denoted as C), a modeling group (denoted as LPS), and a treatment group (denoted as LPS+4-OI); among them, the control group was not added with reagents, the modeling group was added with endotoxin (LPS) at a final concentration of 10 μg / ml, and the treatment group was added with endotoxin at a final concentration of 10 μg / ml and 50 μM 4-octyl itaconic acid; three replicate wells were set for each group, and a total of 24 h was treated.

[0038] (3) After the treatment was completed, the culture medium in the well was aspirated and washed with PBS, and the PBS in the well was aspirated after washing.

[0039] (4) Add RNA extraction reagent to the well plate, 200 μL per well, and repeatedly blow and beat, and then transfer to an EP tube after the viscosity changes.

[0040] (5) Add 40 μL of chloroform in the EP tube, shake, and then centrifuge at 12000 r / min in a 4 centrifuge for 10 min.

[0041] (6) After centrifugation, add equal isopropanol to the supernatant, shake, and then place in a -20 degree refrigerator overnight.

[0042] (7) After overnight, thaw and centrifuge at 12000 r / min in a 4 centrifuge for 10 min, aspirate the supernatant after centrifugation, add 500 μL of 75% ethanol, shake, and then centrifuge at 12000 r / min in a 4 centrifuge for 10 min.

[0043] (8) After centrifugation, aspirate the supernatant, add 500 μL of anhydrous ethanol, shake, and then centrifuge at 12000 r / min in a 4 centrifuge for 10 min.

[0044] (9) After centrifugation, aspirate the supernatant, and place it on a clean bench to dry with ethanol. After drying, add 20 μL of deionized water to dissolve, and detect the RNA concentration with a UV spectrophotometer.

[0045] (10) After calculating the volume at a concentration of 1000 ng / mL, add deionized water to the PCR tube to make up the total volume to 15 μL, and then add 5 μL of reverse transcription reagent (manufacturer: thermofisher, item number: A72710) for reverse transcription to obtain cDNA.

[0046] (11) In 96-well plates, 10 μL of fluorescent quantitative reagent (manufacturer: Yeasen, product number: CAT1201ES03), 7 μL of deionized water, 1 μL of primer, and 2 μL of cDNA were mixed. The sense primer for detecting IL-1β was ATGATGGCTTATTACAGTGGCAA (SEQ ID NO: 1), and the antisense primer was GTCGGAGATTCGTAGCTGGA (SEQ ID NO: 2); The sense primer for detecting TNF-α was CCTCTCTCTAATCAGCCCTCTG (SEQ ID NO: 3), and the antisense primer was GAGGACCTGGGAGTAGATGAG (SEQ ID NO: 4); The sense primer for detecting ICAM-1 was ATGCCCAGACATCTGTGTCC (SEQ ID NO: 5), and the antisense primer was GGGGTCTCTATGCCCAACAA (SEQ ID NO: 6); The sense primer for detecting VCAM-1 was CCTGGGAAGATGGTCGTGAT (SEQ ID NO: 7), and the antisense primer was TGGAGCTGGTAGACCCTCG (SEQ ID NO: 8).

[0047] (12) After mixing, qPCR was performed using Lightcycler, and the relative mRNA expression of each gene was analyzed.

[0048] 2. Experimental results As shown in Figure 2 , after the addition of LPS, the mRNA levels of adhesion factors and inflammatory factors increased, and the addition of 4-octyl itaconic acid could reduce the expression of adhesion factors and inflammatory factors mRNA. It shows that 4-octyl itaconic acid can produce a good inhibitory effect on the secretion of inflammatory factors and adhesion factors at the mRNA level.

[0049] Example 3 4-octyl itaconic acid reduces the expression of adhesion factors and inflammatory factors in human umbilical vein endothelial cells

[0050] 1. Experimental method (1) In 6-well plates, 50000 human umbilical vein endothelial cells were added to each well and adherent culture.

[0051] (2) After stable adhesion, human umbilical vein endothelial cells were randomly divided into control group, modeling group, 25 μM treatment group and 50 μM treatment group; among them, the control group was not added with reagent, the modeling group was added with endotoxin with a final concentration of 10 μg / ml, the 25 μM treatment group was added with endotoxin with a final concentration of 10 μg / ml and 25 μM 4-OI, and the 50 μM treatment group was added with endotoxin with a final concentration of 10 μg / ml and 50 μM 4-OI; three duplicate holes were set in each group, and a total of 24 h was handled.

[0052] (3) After the treatment was completed, the cells in each group were washed with PBS for 2 times. After adding protein lysate for complete lysis, centrifugation was performed at 12000 r / min for 10 min at 4°C, the supernatant was taken and transferred to a refrigerator at -20°C for storage.

[0053] (4) The total protein concentration was determined by BCA method, 30 μg of total protein was quantified, and the protein sample loading volume was calculated.

[0054] (5) SDS-polyacrylamide gel constant voltage electrophoresis was performed at 124 V for about 90 min.

[0055] (6) The protein blot was transferred to the NC membrane under the condition of constant voltage 100 V.

[0056] (7) According to the protein molecular weight, the target band was obtained, and 5% skim milk was blocked at room temperature for 1 h.

[0057] (8) After blocking, the corresponding primary antibody (ICAM1 antibody (manufacturer: roteintech, product number: 11444-1-AP); VCAM1 antibody (manufacturer: Proteintech, product number: 10831-1-AP); IL-1β antibody (manufacturer: Abclonal, product number: A22257); TNF-α antibody (manufacturer: Abclonal, product number: A22227)) was added and incubated at 4°C overnight.

[0058] (9) The next day, the primary antibody was recovered, the band was washed with PBST for 3 times, 8 min each time, and the band was placed in the secondary antibody for incubation at room temperature for 1 h.

[0059] (10) The secondary antibody was recovered, the band was washed with PBST for 3 times, 8 min each time, and the immunoblot was detected by ECL chemiluminescence kit and imaging equipment.

[0060] 2、Experimental results As Figure 3As shown, the addition of LPS increased the levels of adhesion factor and inflammatory cytokine proteins, while the addition of 25 μM or 50 μM 4-octylitaconic acid reduced their expression. This indicates that 4-octylitaconic acid can inhibit the secretion of inflammatory and adhesion factors at the protein level.

[0061] Example 4: 4-Octyl itaconic acid reduces the adhesion between human umbilical vein endothelial cells and human monocytic leukemia cells.

[0062] 1. Experimental Methods (1) Human umbilical vein endothelial cells were cultured in 24-well plates and cultured and grouped according to the method in Example 3.

[0063] (2) THP-1 mononuclear cells were labeled with CFSE solution with a final concentration of 5 μM and incubated in a 37°C incubator in the dark for 30 min. Then, the labeled THP-1 mononuclear cells were diluted with DMEM medium to 50,000 cells / well and added to the control group, model group, 25 μM treatment group and 50 μM treatment group respectively. The labeled THP-1 mononuclear cells were co-cultured with human umbilical vein endothelial cells of each group at 37°C for 1 h.

[0064] (3) Wash three times with PBS. Observe the adhesion of mononuclear cells in each group under a Leica microscope and take pictures for recording.

[0065] 2. Experimental Results like Figure 4 As shown, the addition of LPS significantly increased the number of human umbilical vein endothelial cells and monocytes adhering to each other, while the addition of 25 μM or 50 μM 4-octylitaconic acid reduced the number of endothelial cells and monocytes adhering to each other. This indicates that 4-octylitaconic acid can reduce the adhesion between endothelial cells and monocytes.

[0066] Example 5: 4-Octylated itaconic acid reduces the production of reactive oxygen species (ROS) in human umbilical vein endothelial cells.

[0067] 1. Experimental Methods (1) Human umbilical vein endothelial cells were seeded into 48-well plates and cultured and grouped according to the method in Example 3. After 24 h of treatment, the cells in each group were washed twice with PBS.

[0068] (2) The washed cells were fixed with 4% paraformaldehyde for 30 min, and then washed twice with PBS.

[0069] (3) Each group of cells was incubated in the dark for 30 min with DCFH-DA solution with a final concentration of 5 μM and DAPI solution with a final concentration of 1 μg / mL, and then washed three times with PBS. The staining of each group of cells was then observed and photographed under a Leica microscope.

[0070] 2. Experimental results As shown in Figure 5 Figure 4, after the addition of LPS, the ROS level in human umbilical vein endothelial cells increased, while the addition of 25 and 50 μΜ 4-octyl itaconic acid reduced the expression of ROS in human umbilical vein endothelial cells. It is shown that 4-octyl itaconic acid can effectively reduce the generation of reactive oxygen species in endothelial cells.

[0071] Example 6 4-octyl itaconic acid reduces the length of thrombus formed in the tail of wild-type male mice after carrageenan-induced thrombus

[0072] 1. Experimental method (1) The mice were divided into 4 groups, namely the control group, the model group, the 4-octyl itaconic acid (25 mg / kg) group and the 4-octyl itaconic acid (50 mg / kg) group, each group of 6, and the carrageenan and 4-octyl itaconic acid solutions were prepared with PBS.

[0073] (2) On the first day, the mouse thrombus model was established by intraperitoneal injection of carrageenan (50 mg / kg) to the model group, the 4-octyl itaconic acid (25 mg / kg) group and the 4-octyl itaconic acid (50 mg / kg) group, and the mice in the control group were injected with an equal amount of PBS intraperitoneally. 24 hours later, the mice injected with carrageenan formed thrombus in the tail; then every 24 hours, the 4-octyl itaconic acid (25 mg / kg) group was administered 4-octyl itaconic acid at a dose of 25 mg / kg, the 4-octyl itaconic acid (50 mg / kg) group was administered 4-octyl itaconic acid at a dose of 50 mg / kg, and the control group and the model group were administered an equal amount of PBS, for a total of 2 days of administration.

[0074] (3) After the end, all the mice were euthanized, 1 mL of plasma was collected and centrifuged at 2000g for 30 minutes to obtain 120 μL of serum, and then the serum glutamic-pyruvic transaminase, glutamic-oxalacetic transaminase and alkaline phosphatase levels were detected in the biochemical analyzer to verify whether 4-OI had an impact on the normal physiological functions of the liver and kidney of the mice.

[0075] (4) After the plasma was collected, the length of the thrombus in the tail of each mouse was measured and photographed, and the ratio of the length of the thrombus to the length of the tail was calculated.

[0076] 2. Experimental results As shown in Figure 6As shown, compared to the control group, mice in the other three groups developed significant thrombi after intraperitoneal injection of carrageenan. Further comparison of the ratio of thrombus length to tail length revealed that mice treated with different concentrations of 4-octylitaconic acid had significantly shorter tail thrombus lengths compared to untreated mice in the model group. This indicates that 4-octylitaconic acid can effectively reduce tail thrombus formation in mice, further demonstrating its good therapeutic effect on thrombosis.

[0077] like Figure 7 As shown, compared to the control group, mice in the model group showed elevated serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP) after intraperitoneal injection of carrageenan. However, the serum ALT, AST, and ALP levels in the two groups of mice treated with 4-octylitaconic acid did not change significantly compared to the control group. This indicates that 4-octylitaconic acid does not affect normal liver and kidney function in mice.

[0078] In summary, this invention demonstrates that 4-octyl itaconic acid has significant therapeutic effects on carrageenan-induced thrombosis and endotoxin-induced endothelial cell adhesion and inflammation.

[0079] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Use of 4-octyl itaconic acid for the preparation of a medicament for the prevention and or treatment of thrombotic disorders, characterized in that, The structural formula of the 4-octyl itaconic acid is .

2. Use of 2.4-octyl itaconic acid for the preparation of an antithrombotic medicament, characterized in that, The structural formula of the 4-octyl itaconic acid is .

3. Use of 4-octyl itaconic acid for the preparation of a product for inhibiting the expression of adhesion factors and or inflammatory factors in endothelial cells, characterized in that, The structural formula of the 4-octyl itaconic acid is .

4. Use according to claim 3, characterized in that, The adhesion factors include ICAM1 and or VCAM1.

5. Use according to claim 3, characterized in that, The inflammation factors include IL-1β and or TNF-α.

6. Use of 4-octyl itaconic acid for the preparation of a product for inhibiting the adhesion of endothelial cells to mononuclear cells, characterized in that, The structural formula of the 4-octyl itaconic acid is .

7. Use of 4-octyl itaconic acid for the preparation of a product for inhibiting the generation of reactive oxygen species in endothelial cells, characterized in that, The structural formula of the 4-octyl itaconic acid is .

8. An antithrombotic preparation, characterized by comprising a compound of the formula (I) or a pharmaceutically acceptable salt thereof. The active ingredient thereof includes 4-octyl itaconic acid with the structural formula ​ 9. The formulation of claim 8, wherein, The preparation is in the form of injection, tablet, spray, granule, capsule, oral liquid or patch.

10. A pharmaceutical composition, characterized by, 4-octyl itaconic acid having the structural formula and a pharmaceutically acceptable carrier.

Images