A SONAR gene that regulates heat tolerance, nodulation, and immunity in plants and its applications.

By regulating the expression of the SONAR gene in plants and utilizing CRISPR/Cas9 technology, we solved the problems of plant heat tolerance, nodule number, and immune pre-stimulation. This enabled us to improve the heat tolerance and nodule number of soybeans under normal temperature conditions and enhance immune pre-stimulation in the absence of pathogens, providing breeding materials for new soybean germplasm.

CN121378436BActive Publication Date: 2026-05-26YAZHOUWAN NATIONAL LABORATORY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
YAZHOUWAN NATIONAL LABORATORY
Filing Date
2025-12-24
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Existing technologies struggle to achieve heat resistance, nodulation and nitrogen fixation activity, and immune pre-stimulation in plants under ambient temperature/no-inoculation conditions. Furthermore, existing improvement schemes suffer from poor environmental stability, high metabolic burden, or incomplete compatibility with soybean growth/rhizobium symbiosis.

Method used

We provide SONAR gene overexpression and knockout technologies, and use the CRISPR/Cas9 system to regulate SONAR protein expression in plants, thereby improving heat tolerance and increasing nodule formation, and inducing immune pre-excitation in the absence of pathogens.

Benefits of technology

It significantly improves the plant's tolerance to high temperatures, increases the number of nodules, and enhances the expression and transcriptional response of immune-related genes in the absence of pathogens, thereby achieving immune pre-stimulation and providing biological materials for the cultivation of new soybean germplasm.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121378436B_ABST
    Figure CN121378436B_ABST
Patent Text Reader

Abstract

This invention discloses a SONAR gene and its applications in regulating plant heat tolerance, nodulation, and immunity, belonging to the field of genetic engineering. The invention provides the SONAR gene with the nucleotide sequence shown in SEQ ID NO.1, and constructs soybean plants overexpressing and knocking out the SONAR gene, as well as Arabidopsis plants overexpressing the SONAR gene. Experimental results show that overexpression of the SONAR gene significantly improves the tolerance of soybean and Arabidopsis to 40℃ high-temperature stress, and effectively increases the basal expression level and transcriptional response amplitude of immune-related genes under pathogen-free conditions, inducing plant immune pre-excitation. Knocking out the SONAR gene significantly increases the number of nodules in soybean plants. This invention provides a new regulatory target for plant heat tolerance, nodulation number, and immune pre-excitation, and provides biomaterials for the cultivation of new soybean germplasm.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, and in particular to a SONAR gene that regulates heat tolerance, nodulation, and immunity in plants and its applications. Background Technology

[0002] Global warming is subjecting crops to frequent and persistent heat stress. Soybeans, the world's fourth largest food crop and the most important source of vegetable oil and protein, are extremely sensitive to temperature anomalies. High temperatures not only inhibit pollen viability and yield but also significantly reduce nodule formation efficiency and nitrogenase activity, thereby weakening their crucial role in sustainable agriculture.

[0003] Structural variations (SVs) are considered an important genetic basis for adaptive evolution in plants. However, large-scale pericentric inversions have been reported in limited numbers in plants, and their combined effects on three-dimensional genome structure, epigenetic regulation, and phenotypic variation still lack systematic analysis.

[0004] Existing methods for improving heat tolerance mostly focus on downstream effector genes such as heat shock proteins (HSPs) or engineered antioxidant pathways, often resulting in poor environmental stability, high metabolic burden, or incompatibility with soybean growth / rhizobium symbiosis. Current nodulation regulation primarily focuses on pathway nodes such as NIN / NSPs, lacking an upstream membrane-localized regulatory factor capable of integrating stress and symbiosis. No published literature reports on lineage-new genes activated by pericentromere inversion that can simultaneously participate in heat tolerance response and nodulation regulation and possess cross-species transferability. Furthermore, regarding immune enhancement, most protocols rely on inducers or pathogen-associated treatments, making it difficult to achieve basal levels of immune priming while simultaneously considering agronomic traits under ambient / uninoculated conditions.

[0005] Therefore, there is an urgent need to provide a gene that regulates heat resistance response, nodulation nitrogen fixation activity, and immune pre-excitation, and its application. Summary of the Invention

[0006] The purpose of this invention is to provide a SONAR gene and its application for regulating plant heat tolerance, nodulation, and immunity, in order to solve the problems existing in the prior art. This invention provides a new regulatory target for plant heat tolerance, nodulation number, and immune pre-excitation, and provides biological materials for the breeding of new soybean germplasm.

[0007] To achieve the above objectives, the present invention provides the following solution:

[0008] The present invention provides a SONAR protein, the amino acid sequence of which is shown in SEQ ID NO.2.

[0009] The present invention also provides a gene encoding the above-mentioned SONAR protein, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0010] The present invention also provides an overexpression vector comprising the above-described coding gene.

[0011] The present invention also provides an engineered bacterium containing the above-described overexpression vector.

[0012] The present invention also provides a knockout vector that targets the above-mentioned coding gene.

[0013] The present invention also provides an engineered bacterium containing the above-described knockout vector.

[0014] The present invention also provides the use of the above-described SONAR protein, the above-described encoding gene, the above-described overexpression vector, or the above-described engineered bacteria in any of the following:

[0015] (1) Improve the heat resistance of plants;

[0016] (2) Cultivating transgenic plants with improved heat resistance;

[0017] (3) Inducing immune pre-stress in plants;

[0018] (4) Prepare products that induce plant immune pre-stress.

[0019] The present invention also provides the use of the above-described SONAR protein, the above-described encoding gene, the above-described knockout vector, or the above-described engineered bacteria in any of the following:

[0020] (1) Increase the number of nodules in soybeans;

[0021] (2) Cultivating transgenic soybeans with increased nodule count.

[0022] The present invention also provides a method for improving plant heat tolerance and / or inducing plant immune pre-excitation, comprising the step of overexpressing the SONAR gene in the plant;

[0023] The nucleotide sequence of the SONAR gene is shown in SEQ ID NO.1.

[0024] The present invention also provides a method for increasing the number of soybean nodules, comprising the step of knocking out the SONAR gene in the soybean;

[0025] The nucleotide sequence of the SONAR gene is shown in SEQ ID NO.1.

[0026] The present invention discloses the following technical effects:

[0027] This invention provides the SONAR gene with the nucleotide sequence shown in SEQ ID NO.1, and constructs soybean plants overexpressing and knocking out the SONAR gene, as well as Arabidopsis plants overexpressing the SONAR gene. Experimental results show that overexpression of the SONAR gene significantly improves the tolerance of soybean and Arabidopsis to 40℃ high-temperature stress, and effectively increases the basal expression level and transcriptional response amplitude of immune-related genes under pathogen-free conditions, inducing plant immune pre-excitation. Knocking out the SONAR gene significantly increases the number of nodules in soybean plants. This invention provides a new regulatory target for plant heat tolerance, nodule number, and immune pre-excitation, and provides biomaterials for the cultivation of new soybean germplasm. Attached Figure Description

[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0029] Figure 1 The image shows the results of SONAR overexpression level detection in the plants.

[0030] Figure 2 The image shows the RNA-seq sequencing results of SONAR knockout plants;

[0031] Figure 3 Figure 1 shows the experimental results of nodule count and nitrogenase activity in soybean plants overexpressing or knocking out SONAR. Specifically, a) shows the nodule phenotype of wild-type and SONAR-knockout adzuki soybean plants; b) shows the nodule count of wild-type and SONAR-knockout adzuki soybean plants; c) shows the nitrogenase activity of wild-type and SONAR-knockout adzuki soybean plants; d) shows the nodule phenotype of wild-type Wm82 plants and Wm82 plants overexpressing SONAR; e) shows the nodule count of wild-type and SONAR-overexpressing Wm82 plants; f) shows the nitrogenase activity of wild-type and SONAR-overexpressing Wm82 plants.

[0032] Figure 4 Results of heat stress experiments on soybean plants overexpressing or knocking out SONAR and Arabidopsis plants overexpressing SONAR;

[0033] Figure 5 This is a graph showing the transcriptome analysis results of SONAR gene overexpression in soybean;

[0034] Figure 6 This is a graph showing the transcriptome analysis results of SONAR gene overexpression in Arabidopsis thaliana. Detailed Implementation

[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0036] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0037] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0038] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0039] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0040] Example 1

[0041] 1. Gene identification and sequence information

[0042] This invention identified a 20.43 Mb pericentromere inversion by comparing 95 high-quality soybean genomes (28 of which were newly assembled tropical / subtropical materials). Against this inversion background, a previously unannotated gene locus highly expressed in all tissues was discovered and named SONAR (Spatially Organized Nexus of Adaptive Response). The CDS sequence of SONAR is shown in SEQ ID NO.1, and the amino acid sequence of its expressed protein is shown in SEQ ID NO.2.

[0043] SEQ ID NO.1:

[0044]

[0045] SEQ ID NO.2:

[0046] .

[0047] 2. Construction of knockout / overexpression materials

[0048] A SONAR-deficient soybean plant was constructed using CRISPR / Cas9 technology, and gRNAs were designed online following off-target scoring thresholds. The editing targets used were: target 1: TGTTCTCGAGACAAGCGACG (SEQ ID NO.3); target 2: CAGGAGTCGTGTACTACGAT (SEQ ID NO.4); target 3: ATCTCCATGGCTGATGACTC (SEQ ID NO.5). The edited soybean germplasm was red bean.

[0049] The SONAR gene was overexpressed using the pH7FWG2 vector with the CaMV 35S promoter. The sequence shown in SEQ ID NO.1 was inserted into the multiple cloning site of the pH7FWG2 vector, with NOS as the terminator. The edited soybean germplasm was Wm82, and the Arabidopsis thaliana was Col-0.

[0050] 3. Transformation plant cultivation

[0051] Soybean transformation: Transient transformation was performed using the Agrobacterium rhizogenes K599 root hair system. Positive plants were screened and then grown in a conventional greenhouse until they reached a stable growth period.

[0052] Arabidopsis transformation: The flowers were transformed using the Agrobacterium GV3101 flower immersion method, and positive plants were screened and then grown in a conventional greenhouse until they reached a stable growth period.

[0053] 4. Successful verification of the construction of the transformant plant

[0054] qRT-PCR was used to detect the expression level of SONAR in soybean plants overexpressing SONAR, and the results are as follows: Figure 1 As shown, the expression level of SONAR was significantly upregulated in the overexpressing plants (SONAR-OE-1 / 2 / 3).

[0055] RNA-seq sequencing was used to detect whether the target site in the knockout plants was successfully edited. The results were as follows: Figure 2 As shown, guanine (G) in knockout plants is edited into thymine (T).

[0056] 5. Regulates nodule formation and nitrogenase activity

[0057] Nodulation was induced by inoculation with Bradyrhizobium diazoefficiens USDA110, and nodule counts were performed; nitrogenase activity was determined using the acetylene reduction (ARA) method.

[0058] like Figure 3 As shown in a, b, and c, compared with wild-type red bean plants (ChiDOU_WT), the number of nodules in red bean plants with SONAR knockout (KO) (ChiDOU_CR) was significantly increased and the nitrogenase activity was significantly decreased.

[0059] like Figure 3 As shown in d, e, and f, compared with the wild-type Wm82 plant (Wm82_WT), the number of nodules in the Wm82 plant overexpressing SONAR (Wm82_OE) was significantly reduced, while the nitrogenase activity was not significantly different.

[0060] 6. High Temperature Stress and Phenotypic Assessment

[0061] Soybean plants were cultured at 26°C, and Arabidopsis plants were cultured at 22°C.

[0062] Soybean knockout plants, soybean overexpression plants, and wild-type plants were subjected to heat treatment at 40℃ for 12 days, while Arabidopsis overexpression plants and wild-type plants were subjected to heat treatment at 40℃ for 3 days. Plant growth was observed.

[0063] The results are as follows Figure 4 As shown, the expression level of the SONAR gene was significantly upregulated under high temperature treatment, and compared with the wild-type red bean plant (ChiDOU_WT), the red bean plant with SONAR knockout (KO) (ChiDOU_CR) wilted significantly, indicating that knocking out SONAR led to a decrease in heat tolerance.

[0064] Compared with wild-type Wm82 plants (Wm82_WT), Wm82 plants overexpressing SONAR (Wm82_OE) did not show yellowing or wilting, indicating that overexpression of SONAR leads to increased heat tolerance;

[0065] Compared with wild-type Arabidopsis thaliana Col-0 plants (Col-0_WT), Arabidopsis thaliana Col-0 plants (Col-0_OE) overexpressing SONAR showed significantly reduced yellowing and wilting, indicating that overexpression of SONAR leads to increased heat tolerance; this suggests that the function of SONAR in regulating plant heat tolerance is transspecies transferable.

[0066] 7. Immune pre-stimulation function and application

[0067] Roots / leaves of wild-type soybean Wm82 plants, Wm82 plants overexpressing SONAR, red bean plants, and wild-type and Arabidopsis thaliana plants overexpressing SONAR were collected at 22℃. Transcriptome analysis was performed to analyze the changes in the expression levels of immune-related genes in the plants.

[0068] The results are as follows Figure 5 and Figure 6 As shown, overexpression of SONAR in soybeans revealed upregulation of stress-related pathways in the transcriptome, including fatty acid metabolism, response to jasmonic acid signaling, phenylpropane metabolism, and cell wall formation. When SONAR was transfected into Arabidopsis thaliana, upregulation of immune responses and ubiquitin ligase-related genes was observed, such as ERF / AP2, HSP, and PUB28. GO / KEGG enriched entries included defense response, response to biotic stimulus, and immune system process.

[0069] The above results indicate that SONAR upregulation can increase the basal expression level and / or transcriptional response amplitude of immune-related genes, manifested as immune priming. Overexpression of SONAR increases the expression of immune / defense marker genes in plants without pathogen inoculation, thus achieving immune priming.

[0070] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A SONAR protein, characterized in that, The amino acid sequence of the SONAR protein is shown in SEQ ID NO.

2.

2. A gene encoding the SONAR protein according to claim 1, characterized in that, The nucleotide sequence of the encoding gene is shown in SEQ ID NO.

1.

3. An overexpression vector comprising the encoding gene of claim 2.

4. An engineered bacterium containing the overexpression vector of claim 3.

5. The use of the SONAR protein of claim 1, the encoding gene of claim 2, the overexpression vector of claim 3, or the engineered bacteria of claim 4 in any of the following: (1) Improve the heat resistance of plants; (2) Cultivating transgenic plants with improved heat resistance; (3) Inducing immune pre-stress in plants; (4) Prepare products that induce plant immune pre-stress; The plant in question is either soybean or Arabidopsis thaliana.

6. The use of knocking out the SONAR protein of claim 1 or the encoding gene of claim 2 in any of the following: (1) Increase the number of nodules in soybeans; (2) Cultivating transgenic soybeans with increased nodule count.

7. A method for improving plant heat tolerance and / or inducing plant immune pre-stress, characterized in that, This includes the step of overexpressing the SONAR gene in the plant; The nucleotide sequence of the SONAR gene is shown in SEQ ID NO.1; The plant in question is either soybean or Arabidopsis thaliana.

8. A method for increasing the number of nodules in soybeans, characterized in that, This includes the step of knocking out the SONAR gene in the soybean; The nucleotide sequence of the SONAR gene is shown in SEQ ID NO.1.