Application of scavenger receptor SCARA3 in resisting H9N2 subtype avian influenza virus infection

Abstract

The invention belongs to the technical field of genetic engineering of animal molecular breeding, and particularly relates to application of a scavenger receptor SCARA3 in resisting H9N2 subtype avian influenza virus (AIV) infection. The invention discovers that the expression quantity of the SCARA3 gene in the DF-1 cell infected by the H9N2 AIV is obviously reduced. The silent SCARA3 can significantly inhibit the replication of the H9N2 avian influenza virus in host cells, which indicates that the SCARA3 gene is a susceptible gene of the H9N2 AIV, and the gene knockdown / knockout can significantly improve the resistance of chicken to the H9N2 AIV. The SCARA3 gene provided by the invention can be used as a target spot for resisting replication of the H9N2 subtype avian influenza virus, can be used as a disease-resistant molecular marker, is used for carrying out assistant breeding on new varieties resisting infection of the H9N2 subtype avian influenza virus, and has important application value in genetic assistant disease-resistant breeding.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of genetic engineering and biological medicine, and particularly relates to application of silencing SCARA3 in improving chicken resistance to H9N2 subtype avian influenza virus infection. BACKGROUND

[0002] Avian influenza (AI) is an infectious disease of poultry caused by avian influenza virus (AIV), which poses a serious threat to the development of livestock and poultry industry and human health. Among them, H9N2 subtype AIV is an important low pathogenicity subtype, which has a wide distribution and significant influence in the global poultry industry. H9N2 subtype AIV infection usually shows mild to moderate respiratory symptoms, such as cough, nasal fluid, etc. Although H9N2 subtype AIV has low pathogenicity to infected chicken population, it can have a significant impact on production performance, such as decreased egg production of laying hens, slowed growth rate of broilers and reduced feed conversion rate (Zhu Wenlong 2019, Ge Feifei 2014, Jiang Ning 2021). Due to the problems of vaccine inoculation and antibiotic treatment, etc., there is still a lack of effective means to prevent and treat the disease. SUMMARY

[0003] The purpose of the present application is to provide a gene that can improve chicken resistance to H9N2 subtype avian influenza virus infection, which can be used as a molecular marker for disease resistance, and can be used for assisted breeding of new varieties against H9N2 subtype avian influenza virus infection, which has important application value in genetic assisted disease resistance breeding.

[0004] In order to achieve the above purpose, the following technical measures are taken in the present application:

[0005] The application of a preparation for inhibiting chicken SCARA3 gene expression in improving chicken resistance to H9N2 subtype avian influenza virus infection; the SCARA3 gene includes the SCARA3 gene with NCBI accession number NC_052534.1 in chicken or the SCARA3 gene homologous to the gene in chicken.

[0006] In the above application, preferably, the inhibition method includes but is not limited to siRNA interference technology, knockout technology, etc. for chicken SACRA3 gene.

[0007] The protection content of the present application also includes: preparing a cell model resistant to H9N2 subtype avian influenza virus infection by silencing chicken SCARA3 gene.

[0008] Compared with the prior art, the present application has the following advantages:

[0009] The application discloses a method for inhibiting the expression of SCARA3 gene in a chicken embryo fibroblast cell line (DF-1) by using siRNA interference technology, and finds that the cells with inhibited SCARA3 gene expression can resist H9N2 subtype avian influenza virus infection by affecting the replication of the H9N2 subtype avian influenza virus, and the gene can be used as a new anti-disease target of the H9N2 subtype avian influenza virus. The application provides a new target for developing a new vaccine drug for effectively and safely preventing and treating the H9N2 subtype avian influenza virus, and provides a new candidate gene for breeding research of the anti-H9N2 subtype avian influenza virus, and has a wide application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0010] Figure 1 : SCARA3 is significantly down-regulated in DF-1 cells after H9N2 AIV infection

[0011] qPCR detection of SCARA3 gene mRNA expression level in DF-1 cells 24 hours after H9N2 AIV infection

[0012] Figure 2: Effect of silencing SCARA3 gene on mRNA expression of H9N2 AIV nucleoprotein NP gene

[0013] (A) qPCR detection of SCARA3 gene silencing model construction in DF-1 cells

[0014] (B) qPCR detection of SCARA3 gene silencing on mRNA expression of H9N2 AIV nucleoprotein NP gene

[0015] Figure 3 : Effect of SCARA3 gene silencing on H9N2 AIV nucleoprotein NP protein expression

[0016] Western blotting detection of SCARA3 gene silencing on inhibition of H9N2 AIV nucleoprotein NP protein expression DETAILED DESCRIPTION

[0017] Unless otherwise specified, the technical solutions described in the application are conventional solutions in the field; and unless otherwise specified, the reagents or materials are from commercial channels.

[0018] Example 1: Detection of SCARA3 gene expression level in cells after H9N2 AIV infection

[0019] 1. DF-1 cell culture

[0020] The specific steps are as follows:

[0021] (1) DF-1 cell recovery: take out the frozen cells in the liquid nitrogen tank, quickly thaw the cells in a 37°C water bath, and shake the frozen tube during the thawing process to make the cells pass through the ice crystal period; the thawed cell mixture is transferred to a 15 mL centrifuge tube, and 10 mL of cell culture medium DMEM is added, centrifuged at 1000 r / min for 5 min, and the supernatant is discarded; 1 mL of cell full medium is added, and after resuspending the cells, they are inoculated into a culture bottle for culture, and the medium is supplemented to about 3 mL; gently shake the culture to evenly distribute the cells on the bottom of the bottle, and place it in a 37°C, 5% CO2 incubator, and observe the cell growth state at any time.

[0022] (2) DF-1 cell passage: observe the cells, and when the cells in the culture bottle are basically full and the cell density reaches more than 90%, the cells need to be passaged. The basic operation of the passage is as follows: the cell culture medium in the culture bottle is sucked off, PBS is added to wash the cells, and the operation is repeated twice; after the PBS is discarded, an appropriate amount of 0.25% trypsin is added to cover the bottom of the bottle, and the cells are placed in the incubator for 2 min. Observe the cell digestion under a microscope. When the cells start to shrink and round, add twice the volume of cell culture medium to stop digestion; blow the cells in the culture bottle to form a single cell suspension and collect the cells; collect the cell suspension into a 15 mL centrifuge tube, centrifuge at 1000 r / min for 5 min, and discard the supernatant; add cell full medium, resuspend the cells by blowing, and transfer the cells into a new culture bottle, supplement an appropriate amount of cell culture medium, and place it in a 37°C, 5% CO2 incubator. Observe the cell growth state at any time.

[0023] (3) DF-1 cell freezing: select cells that are growing vigorously, and after the cells have grown in the culture bottle, follow the cell passage operation steps, resuspend the cells with freezing solution after centrifugation, and divide them into appropriate freezing tubes. Each freezing tube contains a maximum of 1 mL of cells, and the freezing tubes are labeled and placed in a 4°C refrigerator for 30 min before being transferred to -20°C for 1 h. Finally, the freezing tubes are placed in a liquid nitrogen tank, suspended in the mouth of the liquid nitrogen tank, and stored overnight. The next day, store them in liquid nitrogen.

[0024] (4) DF-1 cell infection: the day before transfection, the appropriate amount of cells were inoculated in 24-well cell culture plates, and when the cell density reached 50%-60% and the cell state was good, the cell infection test was performed, and a normal cell control group was set. Remove the original cell culture fluid, wash with PBS buffer for 3 times, and try to remove the original cell culture fluid as much as possible; according to the H9N2 AIV virulence detection results, select the infection dose of MOI 0.01 and supplement the cell culture fluid (containing 1 μg / mL trypsin) to 0.5 mL, and place the 24-well cell culture plate in a 37°C, 5% CO2 constant temperature incubator for 24h. Remove the original cell culture fluid, wash with PBS buffer for 3 times, and try to remove the original cell culture fluid as much as possible; collect the cells with 0.4 mL TRIzol and store at -20°C for standby.

[0025] 2. Extraction of total RNA from cells

[0026] Cell extraction RNA method: add 200 μL of chloroform to 1 mL of Trizol cell suspension, shake vigorously, stand at room temperature for 3 min, centrifuge at 4°C, 12000 r / min for 15 min; transfer the supernatant to a new 1.5 mL RNAase-free centrifuge tube, add an equal volume of isopropanol, invert the centrifuge tube several times, mix thoroughly, and stand at -20°C for 15 min, centrifuge at 4°C, 12000 r / min for 15 min, discard the supernatant; add 1 mL of 75% anhydrous ethanol (750 μL of anhydrous ethanol + 250 μL of DEPC water), gently shake the precipitate to rinse the precipitate, centrifuge at 4°C, 9500 r / min for 5 min, discard the supernatant; add 1 mL of anhydrous ethanol, rinse the precipitate, centrifuge at 4°C, 9500 r / min for 5 min, discard the supernatant, and dry at room temperature for 10 min; add an appropriate amount of DEPC water to dissolve the RNA precipitate, mix gently after dissolving, and measure the concentration and purity of the extracted total RNA with NanoDrop-2000.

[0027] 3. Detection of SCARA3 expression level in H9N2 AIV infected cells

[0028] (1) Synthesis of cDNA first strand

[0029] According to the reverse transcription kit instructions of Qiagen Company, the specific operation is as follows:

[0030] Remove genomic DNA reaction

[0031]

[0032] Mix well, and the PCR reaction program is as follows: PCR reaction conditions: 42°C, 2 min.

[0033] Reverse transcription

[0034]

[0035] After mixing, the sample was loaded. PCR reaction conditions: 37 ℃, 15 min; 85 ℃, 5 sec. After the reaction, a portion of the obtained cDNA sample was diluted 5-fold and aliquoted, and stored at -20 ℃ for later use.

[0036] The SCARA3 gene sequence was obtained from NCBI, and primers were designed using Primer 5.0 software. The primer sequences are as follows: SCARA3-F: CCATCACCTCCCAGCTTGAT, SCARA3-R: GAAGAGCCGCGTGTAGTTCT

[0037] The relative expression level of SCARA3 in cells infected with H9N2 AIV was detected by qPCR. The reaction system is as follows:

[0038] After mixing and centrifuging, the mixture was transferred to the qPCR instrument. The qPCR reaction program was as follows: 95℃: 3 min; (95℃: 25 s; 58℃: 25 s; 72℃: 25 s) × 40

[0039] Example 2: Construction of a SCARA3 gene silencing model

[0040] The specific operational steps are as follows: DF-1 cells in logarithmic growth phase were prepared into a cell suspension and seeded in 24-well plates. Experimental groups [Si-NC(H9N2)], [Si-SCARA3(H9N2)], a positive control group [H9N2], and a negative control group [BLANK] were set up, with 3 biological replicates for each group. The transfection procedure is as follows:

[0041] (1) 1 h before transfection, aspirate the cell culture medium, wash the cells twice with PBS without antibiotics, aspirate the PBS, and add 0.5 mL of Opti-MEM®I Reduced Serum Medium;

[0042] (2) Take 1.5 μL of jetPRIME® and mix it into 25 μL of jetPRIME® buffer;

[0043] (3) Take 2 μL of si-JNK1 and si-NC respectively and mix them into 25 μL of jetPRIME® buffer, and let stand at room temperature for 5 min;

[0044] (4) Mix the solutions 2 and 3 and let stand at room temperature for 10 minutes to form a complex;

[0045] (5) Respectively take 50 μL mixed solution to the prepared cells, gently shake the cell culture plate to mix evenly, replace the complete culture medium (containing 1% double antibody) 4-6 h after transfection;

[0046] (6) 39℃, 5% CO2 cell incubator for 24 h, and then carry out subsequent tests.

[0047] The reaction system for detecting whether the SCARA3 silencing model is successfully constructed by qPCR is as follows:

[0048]

[0049] After mixing and centrifuging, the machine is started, and the qPCR reaction program is as follows: 95℃: 3min; (95℃: 25s; 58℃: 25s; 72℃: 25s) ×40

[0050] Example 3: Silencing SCARA3 gene inhibits H9N2 AIV replication

[0051] 1. Refer to Examples 1 and 2 for cell recovery, culture and construction of silencing model.

[0052] 2. The method for extracting RNA from cells is as described in step 2 of Example 1.

[0053] 3. qPCR detects the expression of H9N2 nucleoprotein NP protein in DF-1 cells after SCARA3 silencing,

[0054] The primers used are as follows: NP-F: ATGGAAACTGGTGGGGAACG, NP-R: GCCTTCGTAGTCGCTGAGTT

[0055] The reaction system and program refer to Example 2.

[0056] 4. Western blot detects the expression of H9N2 nucleoprotein NP protein in DF-1 cells after SCARA3 silencing, and the specific operation steps are as follows:

[0057] (1) Preparation of samples

[0058] Add PMSF (proteinase inhibitor) in RIPA Buffer for several minutes before experiment, the final concentration of PMSF is 1 mmol / L, insert in ice for pre-cooling. Discard the culture solution, wash 1-2 times with pre-cooled PBS. Add 80 μL protein lysate containing PMSF to each well of cells, stand on ice for 2 min, scrape the cells with cell scraper. Suck out the lysed cell solution with disposable 1 mL syringe, inject into 1.5 mL centrifuge tube, and blow repeatedly until clear. Place on ice for 10 min, centrifuge at 10000 r / min at 4℃ for 5 min, remove cell debris, transfer the supernatant to 1.5 mL centrifuge tube and store at -80℃.

[0059] (2) Electrophoresis

[0060] ①After installing two 1.5 mm glass plates, prepare 10% separation gel according to Table 3-6, carefully pour along the edge of the glass plate, when the gel surface rises to about 2 cm from the top of the glass plate, then slowly add a layer of anhydrous ethanol or distilled water on the separation gel;

[0061] ②After the separation gel is fully solidified, discard the upper liquid, and use water-absorbing paper to dry the liquid in the glass plate;

[0062] ③Add the prepared 5% concentrated gel on the separation gel, insert the matching comb;

[0063] ④After the concentrated gel is completely solidified, remove the comb, install the electrophoresis device, add the electrophoresis buffer, load, connect the power supply, and adjust the voltage to 80 V;

[0064] ⑤When the bromophenol blue runs to the junction of the concentrated gel and the separation gel, adjust the voltage to 120 V;

[0065] ⑥When the bromophenol blue completely runs out of the bottom of the separation gel, turn off the power supply, take out the gel, and perform Western blot test.

[0066] ① Transfer: After SDS-PAGE electrophoresis, take the gel after SDS-PAGE electrophoresis without staining, and directly transfer the protein band to the PVDF membrane using the Bio-RAD Mini Trans-Blot Electrophoretic Cell transfer device. The specific operation is as follows: wear gloves, cut 2 pieces of 8-layer filter paper and 1 piece of 0.45 μm PVDF membrane, and the size of the PVDF membrane should be slightly larger than the gel. Add a small amount of transfer buffer to a tray, and soak the filter paper and sponge in it. Soak the PVDF membrane in methanol for 2 min, and then move it into the transfer buffer. Place the sponge, filter paper, and electrophoresed gel on the glass plate in turn, and then use a glass rod to flatten the gel and drive away the bubbles. Then, place the PVDF membrane on the gel again, and use the glass rod to drive away the bubbles once more. Then, place the filter paper and sponge on the PVDF membrane. Transfer the whole to the transfer clamp, and place it in the electric transfer device (the black negative side corresponds to the gel, and the red positive side corresponds to the PVDF membrane).

[0067] ② Transfer at a constant voltage of 100 V for 60 min, and place ice bags around the electric transfer device or place the electric transfer device in an ice box filled with ice.

[0068] ③ Blocking: Prepare the blocking solution by adding 1 g of skimmed milk powder or BSA (for one piece of membrane) to 20 mL of 1x TBST, and mix well. Then, pour the solution into a preservation box. Take out the membrane with tweezers, and place it in the preservation box with the protein side facing down. Incubate at room temperature for 2 h on a shaking table, or incubate overnight at 4°C.

[0069] ④ Primary antibody binding to target protein: Take out the membrane from the blocking solution, and cut off the excess edges. Then, place it in the primary antibody solution (1:1000 dilution) with the protein side facing down. Incubate at room temperature for 4 h on a shaking table, or incubate overnight at 4°C.

[0070] ⑤ Secondary antibody binding to antigen-antibody complex: Add 8 mL of 1x TBST to the preservation box, and wash for 3 times, each for 5 min. Then, discard the washing solution, and add the secondary antibody solution (1:5000 dilution). Incubate at room temperature for 2 h on a shaking table.

[0071] All statistical analyses in the above data were performed by Graph Pad Prism 8. The data were evaluated by t-test analysis, and P value <0.05 was statistically significant (*), and P value <0.01 was significantly statistically different (**).

[0072] SEQ ID NO. 1

[0073] Nucleotide sequence of the SCARA3 gene:

[0074]

Claims

1. The SCARA3 gene is the chicken SCARA3 gene, and the nucleotide sequence encoded by the gene is shown in SEQ ID NO.

1.

2. The use of chicken SCARA3 gene inhibitors, characterized in that, Drugs used to prepare for the prevention or treatment of H9N2 subtype avian influenza virus infection.

3. The use according to claim 2, characterized in that, The chicken SCARA3 gene inhibitors include siRNAs that interfere with SCARA3 protein expression via RNAi, or nucleic acid molecules or their expression vectors that target and knock out the chicken SCARA3 gene through gene editing.

4. The use according to claim 2, characterized in that, The sense strand of the siRNA is: AGAUGUACUAUGAGGAGAAG, and the antisense strand is: UUCUCCUCAUAGUACAUCUGG.

5. A medicament for preparing a drug to prevent or treat H9N2 AIV infection, characterized in that, This includes nucleic acid molecules that target and knock down / knock out the chicken SCARA3 gene to interfere with SCARA3 protein expression.

6. Genetically engineered cells resistant to H9N2 AIV infection, characterized in that, The cells in question are DF-1 cells with the SCARA3 gene knocked down.

7. The application of the DF-1 cell line in screening drugs against H9N2 AIV infection, characterized in that, A test group and a control group were set up. The test group had the test compound added to DF-1 cells, while the control group had DF-1 cells without the test compound added. The expression levels of the H9N2AIV gene in the test group and the control group were compared to screen for test compounds that significantly reduced the expression level of the H9N2AIV gene.

8. Application of the DF-1 cell line, characterized in that, A cell model used for H9N2 AIV infection research.

Images