A combined module for enhancing the symbiotic nitrogen fixation ability of rhizobium and application

By constructing a combined module of a promoter that specifically responds to symbiotic nitrogen fixation signals and the transcriptional regulator tetR in soybean rhizobia, the problem of reduced symbiotic nitrogen fixation capacity of rhizobia under glyphosate stress was solved, and efficient symbiotic nitrogen fixation of soybean in a glyphosate environment was achieved.

CN121380142BActive Publication Date: 2026-04-07THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511946627.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-23
Publication Date
2026-04-07
Estimated Expiration
2045-12-23

AI Technical Summary

Technical Problem

Glyphosate stress affects the symbiotic compatibility between rhizobia and the host soybean, reduces the number of rhizobia and nitrogen fixation capacity, and limits the application of biological nitrogen fixation in agriculture.

Method used

A combined module containing an inducible promoter element Pi that specifically responds to symbiotic nitrogen fixation signals and a transcription factor encoding gene tetR was constructed. This module was then transformed into soybean rhizobia using the recombinant expression vector pA-Pi-tetR to enhance its symbiotic nitrogen fixation capacity under glyphosate stress.

Benefits of technology

Under glyphosate stress, the recombinant engineered strains significantly improved the symbiotic nitrogen fixation capacity of soybeans, restored the symbiotic compatibility between rhizobia and the host, and enhanced nodulation capacity and nitrogenase activity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121380142B_ABST
    Figure CN121380142B_ABST
Patent Text Reader

Abstract

This invention provides a combined module and its application for enhancing the symbiotic nitrogen fixation ability of rhizobia, belonging to the field of synthetic biology. The combined module for enhancing the symbiotic nitrogen fixation ability of rhizobia includes sequentially connected inducible promoter elements Pi that specifically respond to symbiotic nitrogen fixation signals and elements from... Sinorhizobium Fred transcriptional regulatory factor encoding genes tetR The present invention inserts the combined module into the initial vector to construct a recombinant expression vector, and then uses the triparental conjugation method to transfer the recombinant expression vector into different soybean rhizobium chassis to obtain two nitrogen-fixing recombinant engineered strains. Compared with wild-type rhizobium, the recombinant engineered strains of the present invention can restore the effect of glyphosate stress on the symbiotic nitrogen-fixing ability of rhizobium.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of synthetic biology technology, and in particular relates to a combined module and its application that enhances the symbiotic nitrogen fixation ability of rhizobia. Background Technology

[0002] Symbiotic nitrogen fixation between rhizobia and legumes is a highly efficient and energy-saving green nitrogen fixation method; however, its practical application is limited by various factors. With the widespread cultivation of glyphosate-resistant transgenic soybeans (such as Zhonghuang 6106), glyphosate is used extensively as a complementary herbicide. Therefore, glyphosate stress has become a novel limiting factor affecting the symbiotic compatibility between rhizobia and the host soybean. Previous studies have shown that glyphosate stress affects rhizobia (such as...) Sinorhizobium fredii Glyphosate inhibits the colonization, nodulation, and nitrogen fixation capabilities of soybeans and rhizobia, thus suppressing the efficiency of the soybean-rhizobium symbiotic nitrogen fixation system. Specifically, glyphosate significantly reduces the rhizobium population number (CFU), and its toxicity is selective for different rhizobium strains. Glyphosate exposure may disrupt early signal exchange between soybeans and rhizobia, interfering with chemotaxis and nodulation gene expression in rhizobia by altering the composition of root exudates (such as flavonoids). Although glyphosate use reduces weed competition, its negative impact on rhizobia limits the widespread application of biological nitrogen fixation in agriculture.

[0003] While currently available synthetic biology-derived nitrogen-fixing bacteria can effectively enhance nitrogen fixation in plants, there are no reports on the construction of recombinant engineered strains tolerant to glyphosate stress, a novel limiting factor. Therefore, utilizing synthetic biology techniques to construct functional modules with highly efficient symbiotic nitrogen-fixing capabilities under glyphosate stress, thereby enhancing the glyphosate tolerance of rhizobia, will lay an important foundation for the development of highly effective rhizobium agents. Summary of the Invention

[0004] In view of this, the purpose of this invention is to provide a combined module and its application for enhancing the symbiotic nitrogen fixation ability of rhizobia. This invention constructs an artificial symbiotic nitrogen fixation module that can significantly improve the symbiotic nitrogen fixation ability of rhizobia under glyphosate stress, for the creation of a highly efficient symbiotic nitrogen fixation system.

[0005] This invention provides a combined module for enhancing the symbiotic nitrogen fixation ability of rhizobia, comprising sequentially connected inducible promoter elements Pi that specifically respond to symbiotic nitrogen fixation signals and elements from... S. fredii transcriptional regulatory factor encoding genes tetR

[0006] Preferably, the nucleotide sequence of the combined module is shown in SEQ ID NO.1.

[0007] This invention provides a recombinant expression vector pA-Pi -tetRIt includes the aforementioned combined module and the initial carrier, wherein the initial carrier is pBBR1MCS-2.

[0008] Preferably, the combined module is cloned to the initial carrier. Hind III and BamH Between I restriction enzyme sites.

[0009] This invention provides a recombinant engineered strain expressing the aforementioned combined module, using the recombinant expression vector pA-Pi. -tetR It is obtained by transferring it into the host bacteria.

[0010] Preferably, the host bacterium is *Soybean Rhizobium*. S. fredii CCBAU 45436 or soybean slow-growing rhizobium B. diazoefficiens USDA 110.

[0011] This invention provides the aforementioned combination module and the aforementioned recombinant expression vector pA-Pi. -tetR The application of the recombinant engineered strain in improving the symbiotic nitrogen fixation capacity of soybeans under glyphosate stress.

[0012] This invention provides the application of the recombinant engineered strain as a fertilizer for leguminous crops.

[0013] This invention provides a method for improving the symbiotic nitrogen fixation capacity of soybeans under glyphosate stress, wherein the recombinant engineered strain is inoculated into the roots of soybeans to carry out symbiotic nitrogen fixation.

[0014] Preferably, the inoculation amount of the recombinant engineered strain is: 0.5-1.5 ml of bacterial suspension of the recombinant engineered strain per soybean plant, wherein the OD of the bacterial suspension is... 600 It ranges from 0.1 to 0.5.

[0015] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a combined module for enhancing the symbiotic nitrogen fixation ability of rhizobia, including an inducible promoter element Pi that specifically responds to the symbiotic nitrogen fixation signal and a component from... S. fredii transcriptional regulatory factor encoding genes tetR The present invention inserts the combined module into the initial vector to construct the expression recombination vector pA-Pi- tetR ; and the recombinant vector pA-Pi- was synthesized using a triparental conjugation method. tetR Transfer to soybean rhizobium chassis to promote rapid growth of rhizobium S. fredii CCBAU 45436 or soybean slow-growing rhizobium B. diazoefficiens Two nitrogen-fixing recombinant engineered strains, 45436 (pA), were obtained from USDA 110. - Pi- tetR ) and USDA 110 (pA-Pi-tetR The results showed that, compared with wild-type rhizobia, the recombinant engineered strain of the present invention could restore the effect of glyphosate stress on the symbiotic nitrogen fixation ability of rhizobia and improve the symbiotic nitrogen fixation ability of soybean under glyphosate stress. Attached Figure Description

[0016] Figure 1 The recombinant expression vector pA-Pi- tetR The construction diagram shows the insertion site as follows. BamH I and Hind III.

[0017] Figure 2 The recombinant vector pA-Pi- tetR The positive colony PCR verification results show that M in A is a 5K DNA marker and 1 is the gene fragment Pi- tetR In B, 1 is the empty vector pBBR1MCS-2, and 2 is the recombinant vector pA-Pi- tetR .

[0018] Figure 3 The PCR verification results for the artificial high-efficiency symbiotic nitrogen fixation module transferred into the rhizobium chassis are shown, where 1 is the empty vector pBBR1MCS-2 and 2 is the recombinant engineered strain 45436 (pA-Pi- tetR ), 3 is the recombinant engineered strain USDAl10 (pA-Pi- tetR ).

[0019] Figure 4 The growth capacity of recombinant engineered bacteria and rhizobium chassis was determined, where A represents recombinant engineered strain 45436 (pA-Pi-). tetR Comparison of Rhizobium chassis CCBAU 45436; B is recombinant engineered strain USDA 110 (pA-Pi- tetR Comparison between the Rhizobium chassis and USDA 110. Detailed Implementation

[0020] This invention provides a combined module for enhancing the symbiotic nitrogen fixation ability of rhizobia, comprising an inducible promoter element Pi that specifically responds to symbiotic nitrogen fixation signals and a component derived from... S. fredii transcriptional regulatory factor encoding genes tetR

[0021] In this invention, the nucleotide sequence of the combined module is shown in SEQ ID NO.1, specifically as follows:

[0022] AAGGTGGTCCACCTGCACGGCGATGCCCTTGCCGCCGGCCGCGGTCGCGAGTTCCGCCGTTTCCTCGATTGTCTCGGGCCGCTGGTATTCCGAGGCCTGCTCGCGCGTCGTTCGTCCCGTGACATAGACCGTTGCGCCTGCAGCGCCGAGTTCCACCGCGATGCCGCGCCCTGCACCGCGCGTTGCACCTGCGACCAGCGCCACCTTGCCTTCGAGCTTCATCTCGTCCTCCCGAGAAAAATCTGGCCTTCATCGACCGACAGATATATAAACGCTTATTCGGTTATAAATAAAGGCCAAAAATGCCCCGCCCCAAAACCGTGCCGAACGAAGAGGTGCTCGACGCCGCCCTTGGCATCATGCGCAAGGTGGGTCCGGAAGGCCTGACCTTCGCGGCCCTTTCCGCCGTCTGCGGCCTTTCCGCCTCAACCCTGGTGCAGCGTTTCGAGACCAAGTCCGGCCTCATCCAGGCGGCATTGCTGCAGGCTTGGGACCGTCTCGACCGCCTGACGGCAGAGCTGGCGGCCAATGCGCCGAAGACGCCGGCGGGTGCCGTCGCCCTGCTCGCCGGCCTGTCCGGCGACTATGGCGCAATCGAAAGCTATGCGGACGATCTCCTGATCCTGCGGGAGGACCTGCGCGATCCGCTCTTGCGCGCCCGCGGCGCCGCCTGGCGCGACGTGCTCTCCACCGCCCTTGAGGAGCGCTTCGCACGCGTACCGACCGCCCCCACCGGCATCGGCCTGATGATGGCCGCCCAATGGCAGGGCGCGCTCCTCTGGTGGAGCTTCGACCCGTGCGTGCCGGTCACCGATTTCGTCGAGGAAAGCCTCGAGCGCTTCGTCGCCGCATTCGCGGCGGAGCGGGAAACGCATTCGAACTGA。

[0023] The nucleotide sequence of the inducible promoter Pi is shown by the nucleotides at positions 1 to 302 in SEQ ID NO.1; the functional gene tetRThe nucleotide sequence is shown in SEQ ID NO.1, positions 303-884.

[0024] This invention provides a recombinant expression vector pA-Pi -tetR The system includes the aforementioned combination module and an initial vector, wherein the initial vector is pBBR1MCS-2, and pBBR1MCS-2 is a broad-host vector; the combination module is preferably cloned into the initial vector. Hind III and BamH Between the I restriction sites, the present invention preferably employs seamless cloning technology to clone the combined module onto the initial vector.

[0025] The present invention also provides a recombinant engineered strain expressing the aforementioned combined module, wherein the recombinant expression vector pA-Pi is used. -tetR It is obtained by transferring it into a host bacterium. In this invention, the host bacterium is preferably *Soybean Rhizobium*. S. fredii CCBAU 45436 or soybean slow-growing rhizobium B. diazoefficiens USDA 110. Specifically, the recombinant expression vector pA... - Pi- tetR Transplanting soybean rhizobia S. fredii CCBAU 45436 yielded recombinant engineered strain 45436 (pA) - Pi- tetR ); the expression recombination vector pA - Pi- tetR Transplanting soybean slow-growing rhizobia B. diazoefficiens USDA 110 yielded recombinant engineered strain USDA 110 (pA - Pi- tetR In this invention, the recombinant expression vector pA is preferably expressed via triparental conjugation. - Pi- tetR It is transferred into the host bacteria.

[0026] The present invention also provides the aforementioned combination module and the aforementioned recombinant expression vector pA-Pi. -tetR The application of the recombinant engineered strain in improving the symbiotic nitrogen fixation capacity of soybeans under glyphosate stress.

[0027] This invention also provides the application of the recombinant engineered strain as a fertilizer for leguminous crops.

[0028] This invention provides a method for improving the symbiotic nitrogen fixation capacity of soybeans under glyphosate stress, wherein the recombinant engineered strain is inoculated into the roots of soybeans to carry out symbiotic nitrogen fixation.

[0029] In this invention, the preferred inoculation amount of the recombinant engineered strain is 0.5-1.5 ml of a bacterial suspension of the recombinant engineered strain per soybean plant. The OD value of the bacterial suspension is... 600 The concentration is 0.1~0.5, preferably 0.2~0.3. In this invention, it is preferred to inoculate the recombinant engineered strain when the seedling has grown its first true leaf.

[0030] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0031] Example 1

[0032] Pi- tetR Construction of recombinant expression vectors and nitrogen-fixing recombinant engineered strains

[0033] (I) Experimental Methods

[0034] A highly efficient artificial symbiotic nitrogen fixation module, Pi-, was obtained through artificial synthesis. tetR This module, from upstream to downstream, includes genes encoding inducible promoter Pi and TetR family transport regulatory proteins selected from *Rhizobium fischeri*. tetR The gene module Pi- tetR The nucleotide sequence is shown in SEQ ID NO: 1, and the full length of the fragment is 884 bp.

[0035] The expression recombinant vector pA-Pi- expresses the combined module tetR The primers used to amplify the combined module are as follows:

[0036] Upstream primer: GTCGACGGTATCGATAAGCTTaaggtggtccacctgcacggc (SEQ ID NO.2)

[0037] Downstream primer: CGCTCTAGAACTAGTGGATCCtcagttcgaatgcgtttcc (SEQ ID NO.3)

[0038] In this embodiment, the expression vector and the combination module are connected using seamless cloning technology. The double restriction sites of the expression vector pBBR1MCS-2 are respectively... BamH I and HindⅢ, its sticky ends and the primer ends of the combined module should have 21 homologous bases, thus the PCR product obtained will have homologous arms composed of 21 bases homologous to the vector sequence at both ends. The specific ligation system is as follows: add 3 μl of linearized vector pBBR1MCS-2, add 2 μl of gene fragment Pi-tetR, add 5 μl of 2× ClonExpress Mix, the total system is 10 μl. Gently pipette the mixture to mix, then incubate at 50℃ for 5 min, and then immediately place it on ice to cool. The above recombinant product is transformed into E. coli by heat shock transformation, the specific steps are as follows: Thaw competent cells DH5α on ice, add 10 μl of recombinant product to 100 μl of competent cells, gently tap the tube wall to mix, and incubate on ice for 30 min. After heat shock in a 42℃ water bath for 90 sec, immediately place it on ice to cool for 5 min. Add 900 μl of LB liquid medium (without antibiotics), incubate at 37°C for 1 h (220 rpm), then centrifuge at 5000 rpm for 5 min and discard the 900 μl supernatant. Resuspend the bacterial cells in the remaining medium and spread them gently on LB plates containing kanamycin (Km) using a sterile spreader. Incubate upside down at 37°C for 16 h, then select single clones for PCR verification and screening to obtain recombinant Escherichia coli strains expressing the recombinant vector pA-Pi-tetR.

[0039] The successfully constructed expression recombination vector pA-Pi- tetR Soybean rhizobium was introduced using a triparental conjugation method. S. fredii CCBAU 45436 and slow-growing rhizobia B. diazoefficiens USDA 110. The specific steps are as follows: First, activate the expression recombinant vector pA-Pi- tetR Recombinant *E. coli* strains (donor strains, prepared according to the above experimental steps), recombinant *E. coli* containing the co-plasmid pRK2013, and recipient strains CCBAU 45436 and USDA 110 were used. After the bacterial suspension reached the logarithmic growth phase, 1 mL of donor bacteria and 1 mL of co-plasmid were centrifuged to collect the bacterial cells. These were then mixed with 1 mL of recipient strains CCBAU45436 and USDA 110, respectively, and centrifuged. Finally, the bacterial suspension was resuspended in 100 μL of YMA liquid medium. 50 μL of the resuspension was dropped onto an antibiotic-free YMA plate. After drying, the suspension was incubated at 30°C for 3 days. Then, a loopful of bacterial growth was scraped from the 3-day-old YMA plate, mixed with YMA medium, and serially diluted. Then, 10... -3100 μL of bacterial culture was spread on a double-antibody YMA plate containing Km and Tmp, and incubated in a 30°C incubator. The plate was cultured in CCBAU 45436 for 3-4 days and USDA 110 for 5-7 days. After single colonies grew, colony PCR amplification was performed using the verification primers pBBR-F / R of the pBBR vector for verification.

[0040] (II) Experimental Results

[0041] The recombinant expression vector pA-Pi- tetR The construction diagram is as follows Figure 1 As shown, the recombinant vector was transformed into Escherichia coli DH5α, resulting in single colonies. Positive single colonies were selected for PCR verification, and the results are as follows. Figure 2 As shown, the electrophoresis results indicated that positive colonies amplified a fragment of approximately 900 bp, proving the successful construction of the recombinant expression vector pA-Pi. -tetR .

[0042] The recombinant expression vector pA-Pi -tetR The colonies were transferred to different rhizobium trays, and single colonies were picked for PCR verification. The results are as follows. Figure 3 As shown, the electrophoresis results indicated that positive colonies amplified a fragment of approximately 900 bp, proving that two recombinant engineered bacteria 45436 (pA) expressing an artificial, highly efficient symbiotic nitrogen-fixing module were obtained. - Pi- tetR ) and USDA110 (pA-Pi - tetR ).

[0043] Example 2

[0044] Determination of the growth ability of recombinant engineered strains under autotrophic culture conditions

[0045] (I) Experimental Methods

[0046] The growth capacity of two successfully constructed recombinant engineered strains was determined, with wild-type rhizobia as a reference. The specific methods are as follows.

[0047] The test strains were activated on YMA solid plates. After single colonies grew, wild-type rhizobia CCBAU 45436 and USDA110, and recombinant engineered strain 45436 (pA) were selected. - Pi- tetR ) and USDA110 (pA-Pi -tetR Single colonies of the fast-growing rhizobium CCBAU45436 and the recombinant engineered strain 45436 (pA) were inoculated into 5 mL of YMA liquid medium and cultured in a shaker at 30°C and 200 rpm. -Pi- tetR Cultured for 2 days; slow-growing rhizobium USDA110, recombinant engineered strain USDA110 (pA-Pi) -tetR Incubate for 5 days. When the bacterial culture changes from clear to turbid, transfer it to a sterile 15 mL centrifuge tube and centrifuge at 8000 rpm for 5 min. After obtaining the bacterial cells, discard the supernatant in a laminar flow hood, resuspend the cells in an equal volume of 0.85% physiological saline, centrifuge, wash the cells twice, and then resuspend the cells in YMA liquid medium, adjusting the OD of the culture. 600 The concentration was set to 0.1. Then, the prepared bacterial solution was added to a 100-well plate specifically for measuring growth curves, with 250 μL added to each well. Each bacterial strain was replicated in 5 wells. Blank medium was used as a negative control, and fast-growing rhizobium 45436 and slow-growing rhizobium USDA110 were used as positive controls. After adding the samples, the 100-well plate was accurately placed in a Bioscreen C fully automated growth curve analyzer for incubation. The measurement parameters were set to 30℃, 220 rpm, with a detection interval of 2 h and a total duration of 5 days. After the measurement, the data were compiled, with time as the x-axis and OD... 600 The vertical axis is used to plot the growth curve of rhizobia.

[0048] (II) Experimental Results

[0049] Compared with wild-type rhizobia, the expression of the recombinant vector pA - Pi- tetR The growth capacity of the two recombinant engineered strains was no different from that of wild-type rhizobia, indicating that the introduction of the combined module did not affect the growth of the rhizobia chassis. Figure 4 ).

[0050] Example 3

[0051] Detection of the host growth-promoting and symbiotic nodulation abilities of recombinant engineered strains inoculated on soybean under glyphosate stress conditions

[0052] (I) Experimental Methods

[0053] ① Seed disinfection and germination: Select seeds of uniform size and smooth color and place them in an Erlenmeyer flask. Perform the following procedures in a clean bench: rinse with anhydrous ethanol for 1 min; rinse once with sterile water; wash with 5% sodium hypochlorite solution diluted 1:5 for 2 min; rinse once with sterile water; rinse the seeds 5 times with sterile water containing a fungicide (PPM); rinse twice with sterile water; use sterile forceps to spread the seeds evenly on a large Petri dish containing 0.6% water agar; finally, wrap the Petri dish with a black plastic bag and place it in a 28℃ incubator in the dark for 3 days to wait for seed germination.

[0054] ② Soybean transplanting: After soybeans germinate, select seeds with uniform germination and good growth on a petri dish for transplanting. Place the seeds root-down into the upper cup containing vermiculite, and fill the lower cup with water. Place the petri dish in an artificial climate chamber for cultivation (humidity 60%, light 16 h, darkness 8 h; temperature: daytime 26℃, nighttime 22℃).

[0055] ③ Rhizobium inoculation: Prepare the inoculation solution by shaking the rhizobium to be inoculated into soybeans in advance; when the seedlings have grown their first true leaves, centrifuge the inoculation solution at 8000 rpm for 10 min, discard the supernatant, then resuspend the bacterial cells in 0.85% physiological saline and wash twice, centrifuge at 8000 rpm for 10 min, discard the supernatant, and finally resuspend the bacterial cells in YMA liquid medium. OD of the bacterial solution is... 600 Adjust the temperature to 0.2, inoculate 1 ml of bacterial solution at the base of each soybean plant, mark the water container, and continue culturing in an artificial climate chamber. During this period, water is replenished regularly every week, and each group has 8 replicates.

[0056] ④ Glyphosate spraying treatment: One week after soybeans are inoculated with rhizobium, the plants will grow two or three true leaves. Spray the prepared glyphosate solutions of different concentrations evenly onto the leaves of the plants (cover the vermiculite surface with a plastic bag before spraying to prevent the glyphosate solution from falling directly onto the vermiculite during the spraying process), and continue to cultivate in an artificial climate chamber for 2 weeks.

[0057] ⑤ Evaluation of the symbiotic effect between rhizobia and soybean: After 4 weeks of soybean culture, the soybean roots were removed as a whole and rinsed with running water to remove the vermiculite from the roots. Various indicators were then measured, such as the number of nodules, the fresh weight of root nodules, nitrogenase activity, plant height and fresh weight of the above-ground parts of the plant.

[0058] (II) Experimental Results

[0059] Compared to no application of 0 mM glyphosate, the symbiotic nodulation effect of rhizobium 45436 and USDA 110 with Zhonghuang 6106 was affected by the application of 50 mM glyphosate, with nodulation capacity decreasing by 21.4% and 30.2% respectively, indicating that glyphosate application affected the symbiotic compatibility between rhizobium and the host. However, under glyphosate application conditions, compared with the inoculation effect of wild-type rhizobium 45436 and USDA 110, the two recombinant engineered strains 45436 (pA... - Pi- tetR ) and USDA110 (pA - Pi- tetR The growth-promoting effect and symbiotic nodulation ability of the plant were significantly improved. The plant height increased by 26.6% and 31.8%, respectively, and the fresh weight increased by 31.6% and 24.5%, respectively. The nodulation ability increased by 36.4% and 40.0%, respectively, and the nitrogenase activity increased by 72.6% and 47.8%, respectively (Table 1).

[0060] Table 1. Effects of different glyphosate strains on soybean inoculation under different concentrations of glyphosate stress.

[0061]

[0062] Note: Different letters indicate significant differences. p ≤ 0.05; Nitrogenase activity units are nmol C2H4 / (mg root nodule·h).

[0063] As can be seen from the above embodiments, transferring the artificial combination module provided by the present invention into two different types of soybean rhizobium chassis significantly improves the symbiotic compatibility between rhizobium and host soybean under glyphosate stress, resulting in rhizobium strains with high symbiotic nitrogen fixation capacity under glyphosate stress, laying an important foundation for the development of highly efficient rhizobium agents.

[0064] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A combined module for enhancing the symbiotic nitrogen fixation ability of rhizobia and a recombinant expression vector pA-Pi -tetR Or, the application of recombinant engineered strains expressing the combined module in improving the symbiotic nitrogen fixation capacity of soybeans under glyphosate stress, characterized in that, The combined module includes sequentially connected inducible promoter elements Pi that respond specifically to symbiotic nitrogen fixation signals and elements from... Sinorhizobium fredii transcriptional regulatory factor encoding genes tetR; The recombinant expression vector pA-Pi -tetR The assembly includes the aforementioned combined module and the initial carrier, wherein the initial carrier is pBBR1MCS-2. The recombinant engineered strain, through the recombinant expression vector pA-Pi -tetR Obtained by transfer into host bacteria; the nucleotide sequence of the combined module is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The combined module was cloned to the initial vector. Hind III and BamH Between I restriction enzyme sites.

3. The application according to claim 1, characterized in that, The host bacterium is *Soybean Rhizobium*. S. fredii CCBAU 45436 or soybean slow-growing rhizobium B. diazoefficiens USDA 110.

4. A method for improving the symbiotic nitrogen fixation capacity of soybeans under glyphosate stress, characterized in that, Recombinant engineered strains expressing the combined module were inoculated into soybean roots for symbiotic nitrogen fixation; The recombinant engineered strain, through the recombinant expression vector pA-Pi -tetR Obtained by introducing into the host bacteria; The recombinant expression vector pA-Pi -tetR It includes a combination module and an initial carrier, wherein the initial carrier is pBBR1MCS-2; The combined module includes sequentially connected inducible promoter elements Pi that respond specifically to symbiotic nitrogen fixation signals and elements from... Sinorhizobium fredii transcriptional regulatory factor encoding genes tetR The nucleotide sequence of the combined module is shown in SEQ ID NO.

1.

5. The method according to claim 4, characterized in that, The inoculation amount of the recombinant engineered strain is: 0.5-1.5 ml of bacterial suspension of the recombinant engineered strain per soybean plant, wherein the OD of the bacterial suspension is... 600 It ranges from 0.1 to 0.5.