Protein related to synthesis of hispidin of phellinus baumii and biological material and application thereof

Abstract

The application discloses a protein related to synthesis of hispidin of Phellinus baumii, named as SvPKS1, and the protein is any one of the following: A1: a protein with an amino acid sequence as shown in SEQ ID No. 2; A2: a protein with at least 80% identity with the amino acid sequence of SEQ ID No. 2 and with the synthesis activity of hispidin and analogs or derivatives thereof. The application provides the SvPKS1 protein and a coding gene, and the gene is introduced into a coffee acid-producing yeast strain, so that the heterologous synthesis of hispidin can be realized. The application has wide application space and market prospect in the field of synthetic biology of hispidin and derivatives thereof.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, particularly to proteins and related biomaterials and applications associated with the synthesis of hispidin from Phellinus linteus. Background Technology

[0002] Phellidin, or Sanghuang, is the fruiting body of a medicinal fungus belonging to the genus Phellidin in the order Phelliales of the phylum Basidiomycota and the family Phellinaceae. It possesses various medicinal properties, including anti-inflammatory and anti-tumor effects. Previous studies have identified polyphenols as important active ingredients in Phellidin, among which styrylpyrone compounds are unique to fungi in the genus Phellidin. Hispidin is not only a marker component of styrylpyrone compounds but also an important intermediate. Fungi in the genus Phellidin can synthesize active ingredients such as Inscavin A, Phelligridin D, and Phelligridimer A using hispidin as a substrate. Therefore, identifying the genes related to hispidin synthase is of great significance for improving the quality of Phellidin.

[0003] Hispidin is not only an important active ingredient, but also shows great promise in the field of bioluminescence; research published in patent number WO2019045139 has discovered bioluminescent mushrooms (… Neonothopanus gardneri Using caffeic acid as a substrate, hispidin is synthesized under the catalysis of hispidin synthase (HispS), and further released into 520nm visible green light under the catalysis of hispidin-3-hydroxylase (H3H) and luciferase (Luz). As the earliest species discovered to produce hispidin, the synthesis mechanism of hispidin in vivo is still unclear; therefore, it is of great significance to discover new genes that synthesize hispidin. Summary of the Invention

[0004] The purpose of this invention is to solve the problems in the existing technology by using high-throughput sequencing analysis technology combined with molecular biology experiments to discover the hispidin synthase gene in the Phellinus genus.

[0005] To achieve the above objectives, this invention proposes a protein related to the synthesis of hispidin from Sanghuang, named SvPKS1, wherein the protein is any one of the following: A1: A protein with the amino acid sequence shown in SEQ ID No. 2; A2: A protein having at least 80% identity with the amino acid sequence of SEQ ID No. 2 and having synthetic activity of hispidin and its analogues or derivatives.

[0006] Preferably, A2 is a protein that has 80% identity with the protein shown by the amino acid shown in SEQ ID No. 2 in the sequence listing through deletion, truncation, substitution, etc., and is related to the synthesis of hispidin and its analogues and derivatives.

[0007] The sequence ID No.2 in the sequence listing consists of 2573 amino acid residues.

[0008] Identity refers to the identity of the amino acid sequence.

[0009] Online alignment can be performed using BLASTP on the NCBI website. Set the Expect value to 10, set all filters to OFF, use BLOSUM62 as the matrix, and set the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85, respectively, to calculate the identity value of the amino acid sequence.

[0010] Preferably, the hispidin analogue refers to a compound obtained by coordinating modification of hispidin, or treatment with a silane coupling agent, or polymer coating, or main chain modification or end modification, or cyclization modification, or polyethylene glycolation, or glycosylation, or esterification.

[0011] Preferably, the hispidin derivative refers to a compound with a hispidin skeleton structure synthesized using hispidin as an intermediate.

[0012] Biomaterials related to the SvPKS1 protein are also within the scope of protection of this invention.

[0013] This invention proposes a nucleic acid molecule, which is any one of the following: B1: The nucleic acid molecule encodes a protein such as SvPKS1; B2: The sequence obtained by codon optimization of the nucleic acid molecule described in B1.

[0014] Preferably, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID No.1, consisting of 7722 bases.

[0015] Preferably, the sequence obtained by codon optimization of the nucleic acid molecule is used.

[0016] This invention proposes a biomaterial, which is any one of the following: C1: An expression cassette containing the nucleic acid molecule; C2: A recombinant vector containing the nucleic acid molecule; C3: Recombinant microorganisms containing the aforementioned nucleic acid molecules; C4: Transgenic plant tissue containing the nucleic acid molecules; C5: A transgenic plant organ containing the nucleic acid molecule; C6: A transgenic plant containing the nucleic acid molecule.

[0017] This invention proposes a recombinant microorganism, which is any one of the following: Y1: Recombinant microorganisms containing the aforementioned nucleic acid molecules; Y2: Recombinant microorganisms constructed from the aforementioned biological materials.

[0018] This invention provides a method for preparing hispidin or its analogues or derivatives, comprising the following steps: culturing the recombinant microorganism under suitable expression conditions to synthesize hispidin or its analogues or derivatives.

[0019] Preferably, the recombinant microorganism is yeast.

[0020] This invention proposes the use of the aforementioned protein, or nucleic acid molecule, or biological material, or recombinant microorganism in the synthesis of hispidin or its analogues or derivatives.

[0021] The beneficial effects of this invention are as follows: This invention provides an SvPKS1 protein and its encoding gene. When this gene is introduced into a yeast strain that produces caffeic acid, it can achieve heterologous synthesis of hispidin. The amino acid sequence of this enzyme has only 24.71% homology with HispS in the existing luminescent mushroom, and has a significantly unique sequence structure. This invention will have broad application space and market prospects in the field of synthetic biology of hispidin and its derivatives.

[0022] The features and advantages of the present invention will be described in detail through embodiments and in conjunction with the accompanying drawings. Attached Figure Description

[0023] Figure 1 This is a graph showing the detection of hispidin content in Phellinus linteus and the expression level analysis of candidate genes for synthesis. In this diagram, A shows the hispidin content analysis in the mycelium and fruiting body of Phellinus linteus; B shows the expression level analysis of candidate genes for hispidin synthesis. Figure 2 This is a docking analysis diagram of Sanghuang SvPKS1 protein and caffeoyl-CoA; Figure 3 This is a secondary mass spectrometry analysis of Hispidin. Detailed Implementation

[0024] Example 1 An SvPKS1 protein, the amino acid sequence of which is shown in SEQ ID No. 2.

[0025] Example 2 A nucleic acid molecule with the nucleotide sequence shown in SEQ ID No. 1.

[0026] This invention utilizes high-throughput sequencing analysis combined with molecular biological experiments to identify the hispidin synthase gene in the *Phellinus* genus. The specific steps are as follows: (1) By studying the *Phellinus spp.* (a type of fungus) Sanghuangporus vaninii High-quality genome sequencing and assembly were performed, and functional gene annotation of the genome was carried out to obtain candidate genes for hispidin synthase. (2) By analyzing the differences in hispidin content in mycelium and fruiting body of Phellinus linteus, and performing transcriptomic analysis on the two samples, candidate genes for hispidin synthase were further screened through correlation analysis and molecular docking prediction. (3) By expressing the candidate gene of hispidin synthase from Phellinus linteus in yeast, the gene function was verified by detecting whether hispidin was synthesized in the yeast fermentation broth.

[0027] The Varuninia cylindrica species involved in step (1) Sanghuangporus vaninii The strain is preserved in our laboratory, numbered ZAAS-S11, and is also deposited at the China Culture Collection Center for Microbial Cultures, with accession number CGMCC No. 41355.

[0028] In step (1), the high-quality sequencing strategy is to use PacBio HiFi high-precision sequencing and ONT ultra-long read sequencing, combined with Hi-C assisted assembly, to obtain a high-quality genome.

[0029] The databases used for functional gene annotation in step (1) are GO, KEGG, COG, Pfam, Swiss-prot, TrEMBL, and Nr.

[0030] In step (2), the mycelium is obtained by inoculating the fungal strain on PDA medium and culturing it at a constant temperature with shaking (25℃, 200rpm) for 10-20 days to obtain the mycelium of Sanghuang.

[0031] In step (2), the fruiting bodies are obtained by inoculating the mycelium into the bag, making an incision after the mycelium has covered the entire bag, and collecting the fruiting bodies after 30-40 days of constant temperature and humidity cultivation.

[0032] The formula for the solid substrate of the mushroom bags is as follows: 40%~60% mulberry sawdust, 11%~30% cottonseed hulls, 13%~21% wheat bran, 1.5%~2.5% white sugar, and 1.5%~2.5% gypsum. The moisture content of the culture medium for the mushroom bags is 55%~68%.

[0033] The constant temperature and humidity refers to a temperature of 20~35℃ and a humidity of 75%~95% during the constant temperature and humidity culture.

[0034] In step (2), the extraction reagent for hispidin is methanol, and the material-to-liquid ratio is 1:20. The extraction conditions are boiling water bath for 1 hour, centrifugation at 9500 rpm and 4°C for 15 minutes, and then aspirating 50 μL of the supernatant into a sample vial for use in the instrument.

[0035] In step (2), hispidin content was detected using an AB liquid chromatography-mass spectrometry system, SCIEX Triple Quad™ 5500+, with a Waters ACQUITY UPLC HSS T3 column (catalog number: 0258312091). The mobile phase consisted of water (A) containing 0.1% formic acid and acetonitrile (B) containing 0.1% formic acid. The mobile phase ratios were as follows: 90A:10B for 0-1 minutes, 5A:95B for 1-12 minutes, 5A:95B for 12-14 minutes, and 90A:10B for 14-15 minutes. The injection time for each injection was 15 minutes.

[0036] As attached Figure 1 As shown in Figure A, the hispidin content in the fruiting body was 79040.6 ng / g, which is much higher than the hispidin content in the mycelium (214.1 ng / g).

[0037] In step (2), three biological replicates are set up for each sequencing sample in the transcriptome sequencing.

[0038] In step (2), the transcriptome sequencing platform was Illumina NovaSeq 6000, and the relative expression level of genes was measured by FPKM.

[0039] In step (2), the association analysis is to perform an association analysis between the Hispidin content in the mycelium and fruiting body of Phellinus linteus and the expression level of candidate hispidin synthase PKS family genes.

[0040] As attached Figure 1 As shown in B, there are four members in the PKS family, numbered EVM0007106, EVM0003224, EVM0001823, and EVM0006098. Only the expression trend of the EVM0007106 gene is consistent with the Hispidin content trend, and this gene is named SvPKS1.

[0041] In step (2), molecular docking prediction refers to the molecular docking analysis of caffeoyl-CoA and SvPKS1 obtained in the previous step using the Induced-Fit program in MOE software, and the interaction between the protein and the ligand is evaluated by the binding affinity (S value) in MOE.

[0042] As attached Figure 2 As shown, the molecular docking predicted S value is -8.4658, indicating strong binding.

[0043] The caffeic acid-producing yeast strain used in step (3) was Saccharomyces cerevisiae YCA113-2B and the yeast expression vector pESC-Ura3, both of which were provided by Professor Yu Hongwei's research group at Zhejiang University.

[0044] In step (3), the homologous recombinase used to ligate the candidate gene into the pESC-Ura3 vector was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd. (Catalog No.: 10922ES20). The restriction sites were EcoRI and SacI. The restriction enzyme was purchased from ThermoScientific (Catalog No.: FD0054). The primers were (AATTTTTGAAAATTCGAATTCATGGCCGGTGCAGACGCT, AGATTGTTAATTAAGAGCTCCTAAGCATTCACTTCTTTTGCCTTC).

[0045] The yeast transformation method was as follows: YCA113-2B was inoculated into 5 mL of liquid YPD medium and cultured overnight at 30°C with shaking. When the density reached 5×106 cells / mL, it was inoculated into 50 mL of liquid YPD medium and cultured at 30°C and 250 rpm for 3 hours. After washing the cells with sterile water, they were resuspended in 100 mM lithium acetate to a final concentration of approximately 2×109 cells / mL of competent cells. Transformation was performed using the Coolaber Transformation Kit (SK2400-200T) strictly following the instructions. After transformation, the yeast was plated on SD-Ura defective culture plates and cultured at 30°C for 48 hours to obtain positive colonies.

[0046] Positive colonies were picked and inoculated into 50 mL of liquid YPD medium. After 60 hours of incubation, the bacterial cells were collected, and 1 mL of pure water was added. The mixture was vortexed for 30 seconds. The cells were then sonicated on ice at 40 kHz for 1 hour, followed by freezing at -20°C for 2 hours to precipitate. After centrifugation at 9500 rpm and 4°C for 15 minutes, 4 mL of the supernatant was collected and concentrated to dryness. After further concentration, 100 μL of 80% methanol was added to dissolve the supernatant, and the mixture was sonicated on ice until completely dissolved. After centrifugation at 9500 rpm and 4°C for 15 minutes, 50 μL of the supernatant was transferred to a sample vial for analysis. The analysis was performed using a SCIEX Triple Quad™ 5500+ LC-MS system with a Waters ACQUITY UPLC HSS T3 column (catalog number: 0258312091). The mobile phase and operating parameters were the same as above. (See attached...) Figure 3 As shown in the secondary spectrum of B, Hispidin was detected in the yeast cell extract, which is consistent with the standard spectrum. Figure 1 This demonstrates that expressing the SvPKS1 protein in yeast enables the synthesis of this substance.

[0047] SEQ ID No.1 SEQ ID No.2

[0048] The above embodiments are illustrative of the present invention and are not intended to limit the present invention. Any simple modifications to the present invention are within the scope of protection of the present invention.

Claims

1. An isolated protein, characterized in that, The protein is any one of the following: (A1) A protein with the amino acid sequence shown in SEQ ID No. 2; (A2) A protein having at least 80% identity with the amino acid sequence of SEQ ID No.2 and having hispidin or hispidin analog or hispidin derivative synthetic activity.

2. The protein as described in claim 1, characterized in that: The hispidin analogues refer to compounds obtained by coordinating hispidin with silane coupling agents, polymer coating, main chain modification, terminal modification, cyclization, polyethylene glycolation, glycosylation, or esterification.

3. The protein as described in claim 1, characterized in that: The hispidin derivatives refer to compounds with a hispidin skeleton structure synthesized using hispidin as an intermediate.

4. A nucleic acid molecule, characterized in that, It is any one of the following: (B1) The nucleic acid molecule encodes the protein as described in any one of claims 1 to 3; (B2) The sequence obtained by codon optimization of the nucleic acid molecule described in (B1).

5. The nucleic acid molecule according to claim 4, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID No.

1.

6. A biomaterial, characterized in that, It is any one of the following: (C1) An expression cassette comprising the nucleic acid molecule of claim 4; (C2) A recombinant vector comprising the nucleic acid molecule of claim 4; (C3) Recombinant microorganisms comprising the nucleic acid molecule of claim 4; (C4) Transgenic plant tissue comprising the nucleic acid molecule of claim 4; (C5) A transgenic plant organ comprising the nucleic acid molecule of claim 4; (C6) A transgenic plant containing the nucleic acid molecule of claim 4.

7. A recombinant microorganism, characterized in that, It is any one of the following: (Y1) Recombinant microorganisms comprising the nucleic acid molecules of claim 4; (Y2) Recombinant microorganisms constructed from the biomaterials of claim 6.

8. A method for preparing hispidin or its analogues or derivatives, characterized in that, The method includes the following steps: culturing the recombinant microorganism as described in claim 8 under suitable expression conditions to synthesize hispidin or its analogues or derivatives.

9. The use of the protein of any one of claims 1 to 3, or the nucleic acid molecule of claim 4, or the biological material of claim 7, or the recombinant microorganism of claim 8 in the synthesis of hispidin or hispidin analogues or hispidin derivatives.

Images