Poplar genetic transformation method suitable for outdoor environment

Abstract

The invention belongs to the technical field of genetic transformation, and particularly relates to a poplar genetic transformation method suitable for an outdoor environment. The method comprises the following steps: obtaining a poplar scion, cutting the poplar scion into 18cm cutting slips, soaking the cutting slips in an activated agrobacterium rhizogenes solution for 30 minutes to obtain an infected scion, performing soil culture or water culture, and transplanting the scion into a large container for continuous culture after transgenic positive roots grow out. The method provided by the invention does not need to depend on sterile conditions, genetic transformation can be realized through cuttage and water culture in an outdoor environment, and the method has the advantages of high throughput and large scale.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of plant transgenic technology, in particular to a poplar genetic transformation method suitable for outdoor environment, which has the advantages of broad spectrum, open type and high throughput. BACKGROUND

[0002] Poplar has important value in economy and ecology, but still faces some outstanding problems in forestry production, such as frequent occurrence of diseases and pests, demand for coordination improvement of fast-growing and high-wood properties, and improvement of stress tolerance. Traditional breeding methods have the disadvantages of long cycle and low efficiency, which cannot meet the urgent needs of current poplar industry development, so it is urgent to establish a poplar genetic transformation system with broad spectrum and high throughput, so as to efficiently carry out molecular genetic improvement.

[0003] Although some progress has been made in the genetic transformation of poplar, there are still key technical bottlenecks, such as lack of stability and efficiency. The commonly used leaf disc method mainly uses embryogenic callus as the recipient material, and the specific operation parameters of different poplar genotypes, including pre-culture time of recipient material, subculture times and time of callus, hormone types and concentrations, etc. There are great differences, and there is no universal and broad-spectrum genetic transformation operation technology suitable for different genotypes of poplar. At the same time, this method depends on complex aseptic operation, and has the problems of low transformation positive rate, low embryogenic callus induction rate and differentiation rate, easy pollution, etc., and cannot realize large-scale and high-throughput genetic transformation operation in non-sterile open environment. Therefore, it is of great significance to establish a poplar genetic transformation system with broad genotype applicability and open type and high throughput for molecular research and genetic improvement of poplar. SUMMARY

[0004] In order to solve the problems of poplar genetic transformation relying on leaf disc method, low transformation positive rate, poor universality of different genotypes and difficulty in scaling in the prior art, the present application provides a poplar genetic transformation method suitable for outdoor environment. This method does not need to rely on sterile culture conditions, and can achieve high infection efficiency of hairy root Agrobacterium in Populus deltoides, Populus tomentosa, Populus nigra and distant hybrid varieties between different species by means of open type non-sterile culture such as cutting and water culture, and can stably obtain a batch of genetically transformed plants, which significantly improves the efficiency and application value of genetic transformation. Compared with control plants, the root system parameters of transgenic plants are significantly increased, and the stress resistance of root system is significantly improved. This method uses betanidin synthesis gene RUBY as a positive identification marker gene, and the transgenic positive root contains betanidin and presents bright red color, which improves the convenience and efficiency of positive identification. This method does not need to rely on sterile conditions, and can realize genetic transformation by cutting and water culture in outdoor environment, obtain a large number of transgenic positive roots containing betanidin and presenting bright red color, and realize high throughput and scaling. In order to achieve the above purpose, the present application adopts the following technical scheme.

[0005] After the target gene is introduced into Agrobacterium rhizogenes and activated, an activated Agrobacterium rhizogenes bacterial solution is obtained; Selecting poplar cuttings of different clones and placing them in the activated Agrobacterium rhizogenes bacterial solution for 30 min to obtain infected poplar cuttings; The infected cuttings are inserted into the substrate by direct insertion or cultured by using a water culture device; After the transgenic hairy roots or positive roots grow out of the cuttings, the cuttings are transplanted into large containers for further culture; After the positive roots are lignified, the positive root system is removed for root cutting, so that the whole transgenic poplar plant is obtained.

[0006] As a genetic transformation tool, Agrobacterium rhizogenes has been widely used in the genetic transformation of various plants. In recent years, it has also been successfully applied to various woody plants such as apple and eucalyptus. However, in poplar, although a genetic transformation method based on a sterile environment has been reported, the existing technology mainly relies on a sterile environment and a tissue culture system, which is complex to operate and difficult to scale up. Therefore, the present application provides a broad-spectrum high-throughput open poplar genetic transformation method suitable for outdoor environments. Without a complex sterile operating environment, genetic transformation can be achieved through cutting or water culture in an outdoor environment. This method uses the betalain synthesis gene RUBY, which presents a bright red phenotype, as an identification marker, improving the convenience and efficiency of positive identification. Therefore, this method has the advantages of simple operation, strong openness, high efficiency, short cycle and low cost, and can stably obtain transgenic plants in black poplar, green poplar, white poplar and their hybrid varieties, providing a new technical system for molecular research and genetic improvement of poplar.

[0007] Preferably, the activated Agrobacterium rhizogenes bacterial solution is added with acetyl cinnamone at a final concentration of 200 μmol / L. This concentration is conducive to improving the infection effect of Agrobacterium rhizogenes and increasing the positive rate of genetic transformation. At the same time, this technical parameter is universal for different genotypes of poplar and can be used for genetic transformation of various poplar genotypes.

[0008] Preferably, the concentration of the activated Agrobacterium rhizogenes bacterial solution is OD 600 of 1.0. This concentration helps to improve the infection rate of Agrobacterium rhizogenes on poplar cuttings and increase the positive rate of genetic transformation. At the same time, it is universal for different genotypes of poplar and can be used for genetic transformation of various poplar genotypes.

[0009] Preferably, the introduction of the target gene into Agrobacterium rhizogenes is achieved by introducing an expression vector containing the target gene into Agrobacterium rhizogenes.

[0010] The expression vector containing the target gene comprises a visual carrier RUBY.

[0011] Preferably, the Agrobacterium rhizogenes comprises Agrobacterium rhizogenes K599.

[0012] Preferably, the cutting refers to cutting the strong, pest-free and highly lignified shoot of different clones of poplar into a stem section of about 18 cm, retaining 2-3 full buds on each stem section, and the top bud is about 1 cm away from the upper cut, and the upper cut of the cutting is flat, and the lower cut is horseshoe-shaped, facilitating the formation of callus.

[0013] Preferably, the substrate is sourced from Guangzhou Shengsheng Agricultural Co., Ltd. (item number 10047), and the main raw materials include imported peat, coconut coir, carbonized rice husk and perlite.

[0014] Preferably, the water culture device generally comprises a culture container, a cutting fixing support material and an oxygen supply device, and can be matched with an environmental control module to realize large-scale high-throughput culture.

[0015] The culture container comprises a plastic tank, a glass tank or other corrosion-resistant containers, and the size and shape can be designed according to the needs of large-scale culture. The cutting fixing support is used to fix the position of the cutting, and comprises a perforated plate, a sponge block or a grid device, so that the lower end of the cutting is immersed in the nutrient solution and the upper end is kept in the air. The feeding device comprises an air pump and an aerated stone, which is used to continuously supply oxygen to the nutrient solution to ensure the normal growth of the root system.

[0016] Compared with the prior art, the present application has the following beneficial effects: 1. The present application provides a broad-spectrum high-throughput open poplar genetic transformation method suitable for outdoor environment. First, the target gene is transferred into Agrobacterium rhizogenes and activated to obtain activated Agrobacterium rhizogenes liquid, which provides a carrier for subsequent infection. Then, poplar cuttings of different clones are selected and soaked in the activated bacteria liquid for 30 min, so that the Agrobacterium rhizogenes can effectively invade the cutting incision, and the infected cutting is obtained. Then, the infected cutting is cultured, which can be directly inserted into the soil culture medium or placed in the water culture device to ensure that the cutting is induced to form adventitious roots in a suitable environment. Compared with the control plants, the root system parameters of the transgenic plants are significantly increased, and the root system resistance is significantly improved. The present application uses the betalain synthesis gene RUBY which presents bright red as a positive identification marker, and the transgenic roots present bright red due to the presence of betalain, which improves the convenience and efficiency of positive identification. Finally, after the positive roots are lignified, they are taken off and cut into sections, which can be quickly multiplied to obtain the whole transgenic poplar plant.

[0017] The poplar genetic transformation method provided by the application does not need difficult and complicated technical steps such as embryo callus induction under sterile conditions, callus regeneration of plants, and can realize genetic transformation and obtain a large number of transgenic positive roots containing betanin and showing fresh red color by cutting and water culture in an outdoor environment, realize high-throughput and large-scale genetic transformation, and improve the positive rate of genetic transformation to 16.7% to 40%. The method has high infection efficiency and stability in black poplar, green poplar, white poplar and their hybrid varieties, has wide genotype universality, and truly realizes the technical breakthrough of different genotypes “broad-spectrum”.

[0018] 2, the application further verifies that Agrobacterium rhizogenes infection can significantly promote the occurrence and development of adventitious roots of poplar cuttings, and improve the stress resistance of plants. The root number, root surface area, root projection area and root volume of the positive plants are obviously higher than those of the control, and the highest can reach 180% of the control. Combined with the modular design of the water culture device, the method can realize large-scale operation and has the advantage of “high-throughput”, which provides strong technical support for the molecular genetic improvement of poplar. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 is the map of the visual carrier RUBY carrier in the embodiment of the application; Figure 2 is the hairy root and transgenic positive root system of different genotypes of poplar obtained by cutting for 40 days in the embodiment of the application; wherein, Figure 2 A of the figure is Populus tomentosa with cut leaves; B is Northwest Poplar No. 3; Figure 3 is the hairy root and transgenic positive root system of different genotypes of poplar obtained by water culture in the embodiment of the application; wherein, Figure 3 A of the figure from left to right is the red positive root starting of Populus alba after water culture for 7 days and the root system after water culture for 60 days after the root of tissue culture seedling of Populus alba is removed; Figure 3 B of the figure is Northwest Poplar No. 3 tissue culture seedling after water culture for 60 days after the root is removed; Figure 3 C of the figure is green poplar branch water culture for 60 days; Figure 4 is the root system of the seedling containing positive root (red RUBY) and the bud after root cutting for 15 days in the embodiment of the application; wherein Figure 4 A of the figure is Populus tomentosa with cut leaves; B is Northwest Poplar No. 3. DETAILED DESCRIPTION

[0020] The application will be described in detail below in conjunction with the accompanying drawings and specific embodiments, but should not be understood as limiting the application. If not specifically stated, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, if not specifically stated, can be obtained from commercial channels. Examples

[0021] A method for genetic transformation of poplar by Agrobacterium rhizogenes, comprising the following steps: 1) Establishment of a poplar genetic transformation system suitable for outdoor environment (1) The visual vector 35S::RUB Y is introduced into Agrobacterium rhizogenes and activated to obtain activated Agrobacterium rhizogenes bacterial solution. The specific method is as follows: Take the Agrobacterium rhizogenes K599 strain (competent) stored at -80 ℃ and insert it into ice when it is melted into an ice-water mixed state at room temperature. Add 1 μL 35S::RUB Y plasmid to every 100 μL competent cell, mix well by rapidly and vigorously dialing the bottom of the tube, and then perform the following steps in sequence: stand for 5 min in ice, freeze for 5 min in liquid nitrogen, 37℃ water bath for 5 min, ice bath for 5 min, take out and place at room temperature, add 200 μL of antibiotic-free TY liquid medium, and shake culture at 28℃ for 2 h. Spread the bacterial solution on a TY medium plate containing the corresponding antibiotic, and invert culture in a 28℃ incubator for 2 d. Pick single colonies and shake culture in a TY liquid medium containing 50 mg / L streptomycin and 50 mg / L kanamycin. After completion of the culture, perform PCR identification. Use primer design software Primer Premier 5.0 to design primers, named RUBY-PCR01, which is synthesized by Beijing Aokedaisheng Biological Technology Co., Ltd. The nucleotide sequences of the upstream primer and the downstream primer are shown in SEQ ID NO: 1 and SEQ ID NO: 2, specifically the upstream primer: TGTCACTTTATTGTGAAGAT, and the downstream primer: CTGTGGGGAGAGCAGATGC. The reaction system is 20 ul, and the reaction program is 95℃ pre-denaturation for 3 min; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 30 s, 30 cycles; 72℃ extension for 5 min. The PCR reaction result is detected on an ultraviolet gel imaging instrument after agarose gel electrophoresis.

[0022] After PCR identification, the bacterial solution with positive identification result is added with glycerol and stored in a -80℃ refrigerator.

[0023] Three days before the experiment, the stored bacteria liquid was taken out from the -80℃ refrigerator, streaked on the plate containing the TY medium with the corresponding antibiotic, and cultured in the 28℃ incubator for 48 h. A single colony was picked up in 3 mL TY liquid medium containing 50 mg / L streptomycin and 50 mg / L kanamycin, and cultured at 28℃, 220 r / min for 14 h. Then 200 μL was taken into 100 mL TY liquid medium containing 50 mg / L streptomycin and 50 mg / L kanamycin, and cultured at 28℃, 200 r / min to obtain the activated Agrobacterium rhizogenes liquid.

[0024] RUBY plasmid, i.e. visual carrier 35S::RUB Y, which is purchased from Wuhan Moliang Biological Technology Co., Ltd., the map of the visual carrier RUBY carrier is referred to Figure 1 .

[0025] The Agrobacterium rhizogenes K599 strain is purchased from Shanghai Weidi Biological Technology Co., Ltd.

[0026] The source / formulation of the TY liquid medium without antibiotic is Tryptone 5 g / L, Yeast extract 3 g / L, 121℃, 20 min high temperature sterilization, then add 10 ml / L sterile 1M calcium chloride aqueous solution. If TY solid medium is prepared, 15 g agar powder is added.

[0027] The source / formulation of the TY medium containing the corresponding antibiotic is Tryptone 5 g / L, Yeast extract 3 g / L, 121℃, 20 min high temperature sterilization, then add 10 ml / L sterile 1M calcium chloride aqueous solution and 50 mg / L streptomycin and 50 mg / L kanamycin. If TY solid medium is prepared, 15 g agar powder is added.

[0028] The activated Agrobacterium rhizogenes liquid containing the carrier is the activated Agrobacterium rhizogenes liquid.

[0029] (2) The stem segments used for cutting are one-year-old hard branches of poplar, and the genotypes are Populus tomentosa and Northwest Poplar No. 3. The stem segments used for water culture have two types of sources. The first source is one-year-old hard branches of poplar, and the genotype is Qingyang. The second source is the stem of a tissue culture seedling without roots, and the genotype is Silver Poplar and Northwest Poplar No. 3. The method for collecting one-year-old hard branches is as follows: select one-year-old branches that are healthy, free of pests and diseases, and have high lignification on 2-8-year-old poplar trees, trim them into 15-20 cm long cuttings, and use 100 cuttings for each poplar variety. Each cutting retains 2-3 full buds, the upper cut is a flat cut, and the lower cut is a horseshoe-shaped cut. The cuttings are completely immersed in clean water for 2 days, and then used for cutting or water culture. According to the biological characteristics of different poplars, Populus tomentosa is selected for cutting, Silver Poplar and Qingyang are selected for water culture, and Northwest Poplar No. 3 is selected for both cutting and water culture. When using the stem of a tissue culture seedling without roots for water culture, select healthy tissue culture seedlings with a height of 8-10 cm, cut off the roots and leaves, and retain the stem and apical bud for inoculation and water culture.

[0030] (3) The base of the one-year-old hard branch or the stem of the tissue culture seedling without roots is scratched with a scalpel, and the scratched hard branch or stem is immersed in the activated Agrobacterium rhizogenes bacterial solution of step (1) for 30 min to obtain the infected poplar cutting.

[0031] The activated Agrobacterium rhizogenes bacterial solution in step (3) is the bacterial solution obtained by adding acetyl cinnamaldehyde to the activated Agrobacterium rhizogenes bacterial solution containing the carrier to a final concentration of 200 μmol / L. The concentration of the activated Agrobacterium rhizogenes bacterial solution is OD 600 (B) is 1.0.

[0032] (4) Cutting: the infected cutting is inserted into the substrate using the direct insertion method. The source is Guangzhou Shengsheng Agricultural Co., Ltd. (item number 10047), and the main raw materials include imported peat, coconut husk, carbonized rice husk, and perlite. The cutting depth is 1 / 2 of the length of the cutting, and water is sprayed and lightly pressed after insertion. The cuttings of Populus tomentosa and Northwest Poplar No. 3 are used for cutting. Refer to Figure 2 , the root system of Populus tomentosa and Northwest Poplar No. 3 after cutting is in good condition, and both Populus tomentosa and Northwest Poplar No. 3 contain positive roots and hairy roots, and the positive roots are roots containing fresh red betanin.

[0033] Water culture: the inoculated cutting is placed in 1 / 5 MS aqueous solution with a pH of about 5.8 and an oxygen pump. After transgenic hairy roots or positive roots grow, they are transplanted into soil for further culture. Refer to Figure 3 , the root system of Northwest Poplar No. 3, Silver Poplar, and Qingyang after 60 days of water culture is in good condition.

[0034] During different cultivation methods, the seedlings can be transplanted into large non-woven bags as needed according to the size of the seedlings and the development of the root system.

[0035] (5) After the positive roots are lignified, the positive root system is removed for root section cutting to obtain the whole transgenic poplar plant.

[0036] 2) Positive plant regeneration based on root section cutting: (1) The poplar plant with hairy roots or positive roots after the above experimental steps is continuously cultured. The culture method of the cut poplar material remains unchanged, and the water-cultured poplar material is transplanted into a container containing a solid substrate for continuous culture. The types of substrate and container used are the same as those used for cutting culture. Transplanting is performed in January, and after 5-9 months after transplanting, the root system is peeled off from the substrate, and the transgenic positive root system (red root system) with a diameter of about 0.5 cm or more is removed and cut into 7 cm long root sections. The root sections are buried in the substrate, and the types of substrate and container used are the same as those used for cutting culture. The upper layer is lightly covered to obtain the whole transgenic poplar plant. Moisture needs to be paid attention to during transplanting and root induction of buds, and the soil weight moisture content is maintained at 15%-20%, and the air humidity is maintained at more than 80%. See Figure 4 , Populus tomentosa and Populus xizangensis No. 3 both sprouted after 15 days of root cutting, and the root system was developed after 9 months of planting.

[0037] The transgenic root system for root section cutting requires a high degree of lignification to improve the survival rate of cutting and the positive bud occurrence rate. The survival rate of cutting and the positive bud occurrence rate of Populus tomentosa, Populus xizangensis No. 3, Populus alba x Populus tremula and Populus cathayana can reach more than 50%, 55%, 58% and 63%, respectively.

[0038] It should be noted that when numerical ranges are involved in the present application, both endpoints and any number between the endpoints are intended to be included. In order to avoid redundancy, the present application describes preferred embodiments.

[0039] Although preferred embodiments of the present application have been described, those skilled in the art, once they know the basic inventive concept, can make additional changes and modifications to these embodiments, and these changes and modifications all fall within the scope of all changes and modifications of the present application.

Claims

1. A method for genetic transformation of poplar suitable for outdoor environments, characterized in that, The method comprises the following steps: (1) introducing a target gene into Agrobacterium rhizogenes and activating to obtain activated Agrobacterium rhizogenes liquid; (2) selecting cuttings of different genotypes of poplar and immersing them in the activated Agrobacterium rhizogenes liquid of step (1) for 30 min to obtain infected poplar cuttings; (3) inserting the infected cuttings of step (2) into the substrate by direct insertion method or culturing by using a water culture device; (4) after the cuttings of step (3) grow red transgenic positive roots, transplanting them into large containers for further culture; (5) after the positive roots are lignified, removing the positive root system for root cutting to obtain a whole transgenic poplar plant.

2. The method of genetic transformation of Populus suitable for outdoor environment according to claim 1, characterized by, The activated Agrobacterium rhizogenes liquid is added with acetylchalcone with a final concentration of 200 μmol / L.

3. The method of claim 1, wherein the genetic transformation of poplar adapted to an outdoor environment is characterized by, The concentration OD 600 of the activated Agrobacterium rhizogenes liquid is 1.

0.

4. The method of claim 1, wherein the genetic transformation of poplar adapted to an outdoor environment is characterized by, In step (1), the target gene is introduced into Agrobacterium rhizogenes by introducing an expression vector containing the target gene into Agrobacterium rhizogenes; the expression vector containing the target gene comprises a visual carrier RUBY.

5. The method of claim 4, wherein the genetic transformation of poplar adapted to an outdoor environment is characterized by, The Agrobacterium rhizogenes is Agrobacterium rhizogenes K599.

6. The poplar genetic transformation method suitable for an outdoor environment according to claim 1, wherein, In step (2), the cuttings are cuttings of different clones of poplar, which are healthy, free of pests and diseases, and have a high degree of lignification, and each stem section is 18 cm long, retains 2-3 full buds, the top bud is about 1 cm away from the upper cut, the upper cut of the cutting is flat, and the lower cut is horseshoe-shaped.

7. The poplar genetic transformation method suitable for an outdoor environment according to claim 1, wherein, In step (3), the substrate comprises peat, coconut husk, carbonized rice husk and perlite.

8. The poplar genetic transformation method suitable for an outdoor environment according to claim 1, wherein, The water culture device used in step (3) comprises a culture container, a cutting fixing support and an oxygen supply device; The culture container comprises a plastic tank, a glass tank or other corrosion-resistant containers, the cutting fixing support is used for fixing the cuttings and comprises a perforated plate, a sponge block or a grid device; and the feeding device comprises an air pump and an aeration stone for continuously supplying oxygen to the nutrient solution.

Images