Multiplex fluorescent quantitative PCR (Polymerase Chain Reaction) kit and application thereof

Abstract

The invention discloses a multiplex fluorescent quantitative PCR (Polymerase Chain Reaction) kit and application thereof. According to the invention, a multiplex fluorescent quantitative PCR (Polymerase Chain Reaction) detection method for detecting serotype 4h listeria monocytogenes, other listeria monocytogenes and listeria ivanovii is established through the design of primers of specific plcB and i-inlE and a double-labeled probe. According to the multiplex fluorescent quantitative PCR detection method, 4h L of listeria monocytogenes, other listeria monocytogenes and listeria ivanovii infection of serum can be distinguished, and the pathogenic bacteria in food can be quantitatively detected. According to the method, the constructed specific recombinant plasmid is used as a positive quantitative standard substance, absolute quantification of target nucleic acid is achieved through a standard curve, and the method has the advantages of being convenient to operate, high in specificity, high in sensitivity, good in repeatability and the like; the method is suitable for rapid qualitative and quantitative detection of listeria monocytogenes and listeria ivanovii in clinical, food and environmental samples.

Description

Technical Field

[0001] This invention relates to a multiplex quantitative PCR kit and its applications. Background Technology

[0002] Listeria monocytogenes and Listeria erythrozoonii are the main pathogenic species of the Listeria genus. The virulence islands and numerous virulence factors carried by these two species play a crucial role in their pathogenicity. Listeria monocytogenes carries virulence island 1 (LIPI-1), and some strains also carry virulence islands 3 or 4 (LIPI-3 and LIPI-4), which play a key role in crossing the intestinal and blood-brain barriers. Listeria erythrozoonii carries both Listeria virulence island 1 and virulence island 2 (LIPI-1 and LIPI-2). The 4-hour super-virulent serotype of Listeria monocytogenes, in addition to carrying virulence island 1 (LIPI-1), also possesses a truncated virulence island 2 (LIPI-2) through horizontal movement elements, distributed in… i-inlE , i-inlF and smcL The aforementioned pathogens enter the host's digestive tract through contaminated food and feed, further invading the intestinal epithelium and proliferating in macrophages and various cell types, thereby leading to systemic infection.

[0003] Listeria monocytogenes ( Listeria monocytogenes Listeria monocytogenes (Lm) is a Gram-positive facultative intracellular parasite and an important zoonotic pathogen causing listeriosis. Sheep and cattle, among other ruminants, are susceptible hosts for Listeria monocytogenes, but Lm can also infect humans. Lm can cross the human intestinal barrier, blood-placental barrier, and blood-brain barrier, causing meningitis, gastroenteritis, sepsis, and abortion, seriously threatening public health. Listeria monocytogenes is the leading cause of hospitalization among known foodborne pathogens associated with sporadic outbreaks and large-scale outbreaks of human disease worldwide, and is one of the most important causes of death related to foodborne infections. Furthermore, outbreaks or sporadic cases of Listeria monocytogenes in livestock, poultry, and wild animals are frequently reported, causing significant economic losses. Compared to Listeria monocytogenes, Listeria escherichiae shows stronger susceptibility to small ruminants and rodents, causing gastroenteritis, sepsis, and abortion symptoms, but not meningitis or encephalitis. Severe infections caused by Listeria are occasionally seen in immunocompromised individuals and pregnant women, leading to bacteremia, miscarriage, and stillbirth. In immunocompetent hosts, Listeria can cause gastroenteritis, but human infection is relatively rare.

[0004] Molecular biological diagnostic techniques are widely used in the qualitative and quantitative detection of pathogens due to their high specificity and sensitivity. Quantitative real-time PCR (qPCR), developed from PCR qualitative techniques, is a widely applied molecular biological method for the qualitative and quantitative detection of nucleic acids. In particular, probe-based qPCR, based on the use of specific primers and probes, exhibits higher specificity and has the potential to be developed for high-throughput, multiplex gene detection. Currently, several qPCR methods exist for detecting Listeria monocytogenes, such as a rapid detection kit and method for Listeria monocytogenes developed by Zhang Hui et al.; a multiplex qPCR method for detecting and identifying three foodborne pathogens developed by Li Jiefeng et al.; and a detection kit and method for foodborne pathogens developed by Zhang Juan et al. While these studies include qPCR methods for detecting Listeria monocytogenes, a comprehensive qPCR method for detecting pathogenic Listeria infection and differentiating between different genera and serotypes of Listeria monocytogenes is lacking. Summary of the Invention

[0005] Purpose of the invention: The purpose of this invention is to provide a multiplex quantitative PCR kit that is convenient and quick to operate, highly sensitive and specific, and its applications.

[0006] Technical solution: The present invention provides a multiplex real-time PCR kit, comprising two primer pairs and two probes; the nucleotide sequences of the primer pairs are shown in SEQ ID NO.1~2 and SEQ ID NO.4~5; the nucleotide sequences of the probes are shown in SEQ ID NO.3 and SEQ ID NO.6.

[0007] The multiplex real-time PCR kit also includes a positive quantitative template.

[0008] The positive quantitative template is a recombinant plasmid containing a nucleotide sequence as shown in SEQ ID NO. 7~8.

[0009] The method for constructing the recombinant plasmid includes the following steps: pMD-19T-actA plasmid is digested with BamHI and HandIII, and the target gene fragments plcB and i-inlE are amplified by PCR, followed by gel extraction to obtain the target gene fragments; the nucleotide sequence of the plcB target gene fragment is shown in SEQ ID No. 7, and the nucleotide sequence of the i-inlE target gene fragment is shown in SEQ ID No. 8; the linearized vector pMD-19T is ligated to the target gene fragment; the ligated recombinant plasmid is heat-transferred to DH5α competent cells and cultured on resistant plates; single colonies are picked, cultured overnight in liquid, and the recombinant plasmid is extracted using a rapid plasmid miniprep kit.

[0010] The multiplex quantitative PCR kit also contains quantitative real-time polymerase, reference dye, and enzyme-free water, such as Takara's Premix Ex Taq™ polymerase and ROX Reference Dye II dye.

[0011] The present invention also provides the application of the aforementioned multiplex quantitative PCR kit in detecting pathogenic Listeria in samples for non-diagnostic purposes.

[0012] The present invention also provides the application of the aforementioned multiplex quantitative PCR kit in the quantitative detection of Listeria monocytogenes and / or Listeria eeris in samples for non-diagnostic purposes.

[0013] Specifically, the presence of plcB fluorescence signal indicates Listeria monocytogenes infection in the sample; the presence of i-inlE fluorescence signal indicates Listeria estradiol infection in the sample.

[0014] The Listeria monocytogenes mentioned includes serotype 4h Listeria monocytogenes.

[0015] The present invention also provides the application of the aforementioned multiplex quantitative PCR kit in distinguishing different genera of Listeria monocytogenes in samples for non-diagnostic purposes.

[0016] The present invention also provides the application of the aforementioned multiplex quantitative PCR kit in distinguishing different serotypes of Listeria in samples for non-diagnostic purposes.

[0017] When both plcB and i-inlE fluorescence signals were detected simultaneously, the sample was found to contain 4h serum-type Listeria monocytogenes infection.

[0018] Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: This invention establishes a multiplex quantitative PCR detection method for serotype 4h Lm, other Lm, and Liv by designing specific plcB and i-inlE primers and dual-labeled probes. This multiplex quantitative PCR detection method can distinguish between serotype 4h Lm, other Lm, and Liv infections, and can also quantitatively detect the aforementioned pathogens in food. This method uses the constructed specific recombinant plasmid as a positive quantitative standard, and achieves absolute quantification of the target nucleic acid through a standard curve. It has advantages such as convenient operation, high specificity, high sensitivity, and good repeatability, and is suitable for rapid qualitative and quantitative detection of Listeria monocytogenes and Listeria escherichiae in clinical, food, and environmental samples. Attached Figure Description

[0019] Figure 1 The result of plcB primer optimization; Figure 2 The results of i-inlE primer optimization; Figure 3 Results of optimization for the plcB probe; Figure 4 Results of optimization for the i-inlE probe; Figure 5 The amplification curves of pMD-19T-plcB plasmid at different dilutions were obtained when plotting a standard curve using a standard plasmid. Figure 6 The quantitative PCR amplification curves of pMD-19T-i-inlE plasmid at different dilutions are shown when using standard plasmids to draw standard curves. Figure 7 The results of the standard curve for quantitative real-time PCR of pMD-19T-plcB plasmid; Figure 8 The results of the standard curve for quantitative real-time PCR of pMD-19T-i-inlE plasmid; Figures 9-10 For specific detection results, amplification curves were generated for 4-hour serotypes of Listeria monocytogenes, serotypes 1 / 2a, 1 / 2b, and 1 / 2c, as well as Listeria oryzae, harmless Listeria, Escherichia coli, Staphylococcus aureus, Vibrio parahaemolyticus, Salmonella enteritidis, Klebsiella pneumoniae, Enterobacter cloacae, and negative detections. Figure 9 pMD-19T-plcB plasmid; Figure 10 pMD-19T-i-inlE plasmid; Figure 11 The results of sensitivity testing for pMD-19T-plcB plasmid; Figure 12 The results of sensitivity testing for pMD-19T-i-inlE plasmid; Figures 13-14 Results of detecting Listeria monocytogenes at different bacterial dilutions at 4-hour serum level: Figure 13 pMD-19T-plcB; Figure 14 pMD-19T-i-inlE plasmid; Figure 15 The results of Listeria monocytogenes detection at different bacterial dilutions are shown. Detailed Implementation

[0020] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0021] Example 1: Preparation of reagents for detection method The reagents for the real-time quantitative PCR method for detecting Listeria monocytogenes include: Upstream primer plcB-F: 5'-GCGGATCATAAAAATCCATAT-3' (SEQ ID No. 1), Downstream primer plcB-R: 5'-TGCATAGGTTGACTAATATCC-3' (SEQ ID No. 2) Fluorescent probe plcB-P: 5'-FAM-CTAATGCGAAAATAACAGGAGC-BHQ1-3' (SEQ ID No. 3), Upstream primer i-inlE-F: 5'-GGTTTTTGTATTAATATTGGTTCTG-3' (SEQ ID No. 4), Downstream primer i-inlE-R: 5'-TGCTTTCATTACCATTTAATCC-3' (SEQ ID No. 5) Fluorescent probe i-inlE-P: 5'-VIC-TCCTGATCTAGCGAAAGTAGTA-MGB-NFQ-3' (SEQ ID No. 6); FAM and VIC are 5' fluorescent groups, while BHQ1 and MGB-NFQ are 3' fluorescent quenching groups.

[0022] The positive quantitative template contains the sequence GCGGATCATAAAAATCCATATTATGATACTAGTACGTTTTTATCTCATTTTTATAATCCTGATAAAGATAATACTTATTTGCCAGGTTTTGCTAATGCGAAAATAACAGGAGCCAAGTATTTTAATCAATCGGTGGCTGATTACCGAGAAGGGAAATTTGACACAGCATTTTATAAATTGGGCCTAGCAATCCATTATTATACGGATATTAGTCAACCTATGCA (SEQ ID No. 7) plcBThe DNA fragment and contains the sequence GGTTTTTGTATTAATATTGGTTCTGGAGCAAAGGTACATGCAGCAAGTATTTCACATCCGATGCCTATTAATCAAATTTTTCCAGATCCTGATCTAGCGAAAGTAGTAAAACGAACTTTAGGAAAACAAAGTGTTACAGATGTTGTTTCTCAAAAGGAACTAGATAGTGTGCAAGGATTAAATGGTAATGAAAGCA (SEQ ID No. 8) i-inlE The pMD19-T recombinant plasmid contains a DNA fragment. It may further include a quantitative real-time polymerase and a reference dye.

[0023] The primers and probes were used to search for various Listeria monocytogenes strains in GenBank. plcB Genes shared by various Listeria species and 4h serotype Listeria monocytogenes i-inlE Based on the analysis of the genes and their conserved regions, the genes were designed and synthesized according to conventional methods in the field.

[0024] Positive quantitative templates were prepared using conventional methods in the art: Listeria monocytogenes (EGD-e) DNA and 4h serotype Listeria monocytogenes (XYSN) DNA were extracted; fragments of SEQ ID No. 7 and SEQ ID No. 8 were amplified, and the fragments were inserted into the pMD19-T vector between the two restriction sites of BamHⅠ and HandⅢ through ligation and transformation to obtain recombinant plasmids pMD-19T-plcB and pMD-19T-i-inlE, respectively.

[0025] The fluorescence quantitative polymerase Premix Ex Taq actually used in the embodiments of this invention TM Both the reference dye ROX Reference Dye II and the reference dye were purchased from Takara.

[0026] Example 2 Primer Concentration Optimization Using the primers and probes designed in this experiment, and with plasmid standards pMD-19T-plcB and pMD-19T-i-inlE as templates, the primer concentrations for TaqMan real-time PCR were optimized. The system contained 10.0 μL of Premix Ex Taq™ (2×) real-time polymerase; 0.8 μL of 10 μM probe plcB-P; 0.8 μL of 10 μM probe i-inlE-P; 0.4 μL of ROX Reference Dye II (50×) dye; and 2.0 μL of template. The upstream and downstream primers for plcB and i-inlE were both added at a concentration of 10 μM, ensuring final concentrations of 0.1 μM, 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, and 0.6 μM, respectively, and were optimized accordingly. Sterile water was added to a final volume of 20 μL.

[0027] Reaction program: 95°C for 30 s, 95°C for 5 s, 60°C for 30 s, 40 cycles. Results are shown below. Figure 1 and Figure 2 Considering both lower Ct values ​​and higher fluorescence signal intensity, the optimal final primer concentrations were selected: PLCB-F / R at 0.3 μM and i-inlE-F / R at 0.4 μM. Figure 1 and Figure 2 The AH section refers to the eight channels in the machine from top to bottom. Figure 1 and Figure 2 It only involves the six colors of AF, and does not involve GH.

[0028] Example 3 Probe Concentration Optimization The probe concentrations in the TaqMan singlet real-time PCR system were optimized according to the previously optimized plcB and i-inlE primer concentrations (PLCB-F / R final concentration: 0.3 μM, i-inlE-F / R final concentration: 0.4 μM). The system contained 10.0 μL of Premix Ex Taq™ (2×) real-time polymerase; 0.4 μL of ROX Reference Dye II (50×) dye; and 2.0 μL of template. The initial concentrations of both probes plcB-P and i-inlE-P were set at 10 μM, and the final concentrations were optimized to 0.1 μM, 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, and 0.6 μM, respectively. Sterile water was then added to a final volume of 20 μL.

[0029] Reaction program: 95°C for 30 s, 95°C for 5 s, 60°C for 30 s, 40 cycles. Results are shown below. Figure 3 and Figure 4Considering both lower Ct values ​​and higher fluorescence signal intensity, the optimal probe concentrations were selected: 0.3 μM for plcB-P and 0.4 μM for i-inlE-P.

[0030] The final confirmed multiplex quantitative PCR detection system and procedure are as follows: The reaction system (20.0 μL) consisted of: 10.0 μL of Premix Ex Taq™ (2×) real-time quantitative polymerase; and a final concentration of 0.3 μM. plcB Primers for the target gene fragment; probe plcB-P with a final concentration of 0.3 μM; and [other primers] with a final concentration of 0.4 μM. i-inlE Primers for the target gene fragment; probe i-inlE-P with a final concentration of 0.4 μM; 0.4 μL of ROX Reference Dye II (50×) dye; 2.0 μL of template; 3.4 μL of sterile water.

[0031] The reaction program was as follows: pre-denaturation at 95°C for 30 seconds, followed by 40 cycles, each cycle consisting of denaturation at 95°C for 5 seconds and annealing extension at 56°C for 30 seconds.

[0032] In this embodiment of the invention, the results were actually recorded using an Applied Biosystems™ 7500 real-time PCR instrument.

[0033] Example 4: Preparation of Standard Curve The multiplex quantitative PCR detection method for Listeria monocytogenes and Listeria elodeon includes the following steps: (1) Bacterial treatment: Take the BHI solution of 4-hour overnight cultured serotype Listeria monocytogenes and Listeria erythrozoonii, centrifuge at 10,000 rpm for 5 min, collect the bacterial pellet, wash the bacteria twice with 600 μL PBS, and adjust the bacterial concentration to 1×10⁻⁶ with PBS. 9 CFU / mL, then sequentially diluted the bacterial concentration, taking 1×10⁻⁶ CFU / mL. 6 CFU / mL - 1×10 1 1 mL of CFU / mL bacterial culture was used to extract the bacterial genome as a template for multiplex quantitative PCR detection.

[0034] (2) The reaction system (20.0 μL) consisted of: 10.0 μL of Premix Ex Taq™ (2×) real-time polymerase; and a final concentration of 0.3 μM. plcB Primers for the target gene fragment; probe plcB-P with a final concentration of 0.3 μM; and [other primers] with a final concentration of 0.4 μM. i-inlEPrimers for the target gene fragment; probe i-inlE-P with a final concentration of 0.4 μM; 0.4 μL of ROX Reference Dye II (50×) dye; 2.0 μL of template; 3.4 μL of sterile water.

[0035] The reaction program was as follows: pre-denaturation at 95°C for 30 seconds, followed by 40 cycles, each cycle consisting of denaturation at 95°C for 5 seconds and annealing extension at 56°C for 30 seconds.

[0036] (3) Preparation of quantitative standard curve: pMD-19T-plcB and pMD-19T-i-inlE positive plasmids were serially diluted 10-fold to 10-fold. 8 ~10 4 Five concentration gradients of copies / mL were used for quantitative real-time PCR according to the reaction system and procedure in step (2) above. After the reaction, the instrument automatically plotted the standard curve Y=aX+b, R. 2 Eff, where X represents the logarithm of the initial template copy number and Y represents the value of C(t).

[0037] (4) Bacterial detection: Prepare the template according to step (1) above, prepare the reaction solution and set the reaction program according to step (2) above, and run the amplification reaction in the fluorescence quantitative PCR instrument and perform fluorescence detection.

[0038] (5) Result judgment: Set up negative control and blank control. The C(t) value of the test sample is less than or equal to 30 and is negative.

[0039] The results of multiplex quantitative PCR using pMD-19T-plcB and pMD-19T-i-inlE positive plasmids are shown in the figure. Figure 5 and Figure 6 .in, Figure 5 and Figure 6 Of the eight colors A and H, this experiment only used the first five channels, and only AE (representing 10 respectively) were used. 8 10 7 10 6 10 5 10 4 The copy number plasmid amplification curve is shown in the figure. The curve colors in the figure correspond to the five colors AE, but not FH. The results of the real-time PCR standard curve are shown below. Figure 7 and Figure 8 As shown. Figure 7 and Figure 8 middle plcB The standard curve regression equation is Y = -2.902X + 35.976, and the correlation coefficient is R. 2 =998, amplification efficiency Eff=121.101%; i-inlEThe standard curve regression equation is Y = -2.66X + 32.87, and the correlation coefficient is R. 2 =994, amplification efficiency Eff=137.628%.

[0040] Example 5 Specificity Detection Genomes of *Listeria monocytogenes* serotypes SAMN02730097 (4 h), SAMN49751615 (1 / 2a), SAMN51798083 (1 / 2b), SAMN47419611 (1 / 2c), SAMN48875514, harmless SAMN52959394, *Staphylococcus aureus*, *Klebsiella pneumoniae*, *Salmonella enteritidis*, *Escherichia coli*, *Vibrio parahaemolyticus*, and *Enterobacter cloacae* were extracted and preserved using a genome extraction kit and stored for later use. Strains without provided strain numbers were standard strains. The species and serotype of several *Listeria* strains were confirmed using existing conventional PCR methods. The genomes of the above bacteria were detected using a newly established multiplex quantitative PCR method. Results were shown in [data missing]. Figure 9 and Figure 10 In the AD sequence, different serotypes of Listeria monocytogenes showed fluorescent signals from the plcB-P probe within the specified number of cycles, indicating a positive result. In the A and E sequences, 4-hour serotypes of Listeria monocytogenes and Listeria eeris showed fluorescent signals from the i-inlE-P probe within the specified number of cycles, indicating a positive result. Fluorescence signals for other non-Listeria species were later in the sequence. Most CT values ​​appeared after 30 cycles, indicating that the established quantitative PCR detection method has good specificity.

[0041] Example 6 Sensitivity Detection The pMD-19T-plcB and pMD-19T-i-inlE plasmids were serially diluted 10-fold to 10-fold. 6 Seven concentration gradients of ~1 copy / mL were used for detection by real-time PCR. Results were shown in... Figure 11 and Figure 12 This indicates that the detection method provided by the present invention has a sensitivity of up to 10. 2 Copy / mL. Where AH represents 10. 6 10 5 10 4 10 3 10 2 10 1 Amplification curves of 1 copy / mL standard plasmid and negative control group. Listeria monocytogenes and Listeria erythrozoonii serotypes (4h) were analyzed at 1×10⁻⁶. 6CFU / sample was serially diluted 10-fold, and then the genome was extracted for quantitative real-time PCR detection. Results were shown in... Figures 13-15 Where A and H represent 10 6 10 5 10 4 10 3 10 2 10 1 Amplification curves for CFU / sample and negative group. Figures 13-15 This indicates that the method provided by the present invention has high sensitivity and can detect as low as 10. 3 CFU contamination with pathogenic Listeria.

Claims

1. A multiplex real-time PCR kit, characterized in that, It includes two primer pairs and two probes; the nucleotide sequences of the primer pairs are shown in SEQ ID NO.1~2 and SEQ ID NO.4~5; the nucleotide sequences of the probes are shown in SEQ ID NO.3 and SEQ ID NO.

6.

2. The multiplex real-time PCR kit according to claim 1, characterized in that, It also contains a positive quantitative template.

3. The multiplex real-time PCR kit according to claim 2, characterized in that, The positive quantitative template is a recombinant plasmid containing a nucleotide sequence as shown in SEQ ID NO. 7~8.

4. The multiplex real-time PCR kit according to claim 3, characterized in that, The method for constructing the recombinant plasmid includes the following steps: digesting the pMD-19T-actA plasmid with BamHI and Hand III enzymes, amplifying the plcB and i-inlE target gene fragments by PCR, ligating the linearized vector pMD-19T to the target gene fragments, and heat-transferring the ligated recombinant plasmid to DH5α competent cells to obtain the recombinant plasmid; the nucleotide sequence of the plcB target gene fragment is shown in SEQ ID No. 7, and the nucleotide sequence of the i-inlE target gene fragment is shown in SEQ ID No.

8.

5. The multiplex real-time PCR kit according to claim 1, characterized in that, It also contains quantitative real-time polymerase, reference dye, and enzyme-free water.

6. The use of the multiplex real-time PCR kit according to any one of claims 1 to 5 in detecting pathogenic Listeria in samples for non-diagnostic purposes.

7. The use of the multiplex real-time PCR kit according to any one of claims 1 to 5 in the quantitative detection of Listeria monocytogenes and / or Listeria estradiol in samples for non-diagnostic purposes.

8. The application according to claim 7, characterized in that, The Listeria monocytogenes mentioned includes serotype 4h Listeria monocytogenes.

9. The use of the multiplex real-time PCR kit according to any one of claims 1 to 5 in distinguishing different genera of Listeria monocytogenes in samples for non-diagnostic purposes.

10. The use of the multiplex real-time PCR kit according to any one of claims 1 to 5 in distinguishing different serotypes of Listeria in samples for non-diagnostic purposes.

Images