Molecular marker closely linked with eggplant peel stripe, KASP primer and application of molecular marker

Abstract

The invention discloses a molecular marker closely linked with eggplant peel stripes, a KASP primer and application of the molecular marker and the KASP primer. According to the method, WT and BW2-2 are taken as parents, an F2 hybrid population is constructed, a genetic linkage map is constructed through statistical analysis of population pericarp stripe traits and combination of InDel sites obtained through genome re-sequencing, and QTL positioning analysis of eggplant pericarp stripes is carried out. And finally, an InDel molecular marker significantly related to the eggplant peel stripes is screened, and the marker is located at the 4043249 bp site of the chromosome 4. Three KASP primers designed based on the site can be directly used for early identification and screening of corresponding genotypes of eggplant peel stripes, and rapid and accurate identification of target phenotypes is realized. The marker provides reliable technical support for molecular-assisted selection of eggplant peel stripe traits, the backcross offspring breeding time can be remarkably shortened, the breeding workload is reduced, and the breeding efficiency is improved.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of eggplant germplasm identification and breeding, and particularly relates to a molecular marker closely linked to eggplant pericarp strip, a KASP primer and application thereof. BACKGROUND

[0002] Eggplant (Solanum melongena L.) is an important vegetable crop of the Solanaceae family and the Solanum L. genus. Eggplant pericarp strip shows rich genetic diversity, and its color, width, density and distribution pattern differ significantly between and within varieties, which is an important external quality trait and a main basis for classification of varieties. Eggplant planting and consumption in China have strong regional characteristics, and consumers have different requirements for fruit appearance quality in different regions, so breeding commercial fruit shapes that meet regional market preferences has become an important goal of eggplant breeding.

[0003] However, current research on eggplant pericarp strip is still mainly focused on germplasm resource evaluation and genetic rule analysis. Previous studies have shown that this trait is quantitative inheritance, but related QTL mapping research has been relatively lagging behind. Traditional backcross breeding is an effective means to improve pericarp strip, but it usually requires selection based on pericarp phenotype in the backcross progeny, which has the problems of long breeding cycle and heavy workload, resulting in low breeding efficiency. In addition, eggplant pericarp strip is a dominant trait. Furthermore, phenotypic selection is easily affected by environmental conditions and cultivation measures, and has poor stability. In contrast, molecular marker-assisted selection can achieve high-throughput screening at the seedling stage and is not affected by environmental factors, which can significantly improve breeding efficiency. However, due to the lack of molecular markers closely linked to eggplant pericarp strip, this technology has not been widely used in the genetic improvement of this trait. SUMMARY

[0004] To solve the above problems, the application constructs an eggplant pericarp strip trait segregating population, screens candidate variation sites based on resequencing data, conducts association analysis combined with the phenotype segregating population, develops an InDel marker closely linked to the target trait, and designs a corresponding KASP primer pair for efficient genotyping, thereby providing an effective tool for molecular marker-assisted selection breeding.

[0005] In a first aspect, the application provides an InDel molecular marker closely linked to a QTL locus of fruit skin streak of eggplant, which is located at a site of 4043249 bp on chromosome 4 of the eggplant genome, and which has a single-base T insertion / deletion variation. The nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, and comprises nucleotide sequences within a range of 101 bp upstream and 100 bp downstream of the InDel site, wherein the 102nd base is a variation site. When the site has a base T, the eggplant fruit skin appears to have streaks; and when the site lacks the base T, the eggplant fruit skin appears to have no streaks.

[0006] SEQ ID NO. 1

[0007] TGAAGCGGCTAGTTGGAGCCAAAGGAAGCAAATGTACGCCACAATCCGCGACGCAGGAGGAAAGAGAATTATGATGAACCCCTGGACTGCACCACCAACCA[T / -]GGGTTTTCCGCCCACGGCTCATCATATTAGACCCTTACATGTTTGGGGGCATCCACATGTAAATAATTGTTTTTGGCATCCACATTATCAAGGGGTGAGT; wherein the genotype phenotype of the InDel at the 102nd base marked with [] from the 5' end of the sequence is "T" -> "-"; i.e., the variation of "presence of base T" -> "absence of base T".

[0008] In a second aspect, the application provides a KASP primer set for detecting the above-mentioned molecular marker, which comprises:

[0009] Forward primer Fp1: 5'-GACTGCACCACCAACCAG-3';

[0010] Forward primer Fp2: 5'-GACTGCACCACCAACCAT-3';

[0011] Reverse primer R: 5'-GGTCTAATATGATGAGCCGTGG-3';

[0012] The 5' end of the forward primers Fp1 and Fp2 is connected with different fluorescent group tag sequences.

[0013] Preferably, the 5' end of the forward primer Fp1 is connected with a fluorescent group FAM tag sequence GAAGGTGACCAAGTTCATGCT; and the 5' end of the forward primer Fp2 is connected with a fluorescent group HEX tag sequence GAAGGTCGGAGTCAACGGATT.

[0014] In a third aspect, the present application provides a product comprising the primer set described above, preferably, the product is a reagent or a kit for detection.

[0015] In a fourth aspect, the present application provides the use of the molecular marker, the primer set or the product described above in any one or more of the following aspects:

[0016] (1) for identification or genotyping of the fruit skin streak trait of eggplant;

[0017] (2) for early prediction and screening of the fruit skin streak trait of eggplant seedlings;

[0018] (3) for molecular breeding and germplasm improvement of eggplant.

[0019] In a fifth aspect, the present application provides a method for identifying the genotyping of the fruit skin streak trait of eggplant, using the primer set described above to perform PCR amplification on the template of eggplant DNA, and performing genotyping according to the fluorescence signal results of the amplification product.

[0020] Preferably, the genotyping according to the fluorescence signal results of the amplification product is specifically: if only FAM fluorescence signal is detected, the genotype is G / G, corresponding to no fruit skin streak of eggplant; if only HEX fluorescence signal is detected, the genotype is T / T, corresponding to fruit skin streak of eggplant; if FAM and HEX fluorescence signals are detected simultaneously, the genotype is T / G, corresponding to no fruit skin streak of eggplant.

[0021] Preferably, the reaction system of the PCR amplification is: KASP Master mix 2.5 μL, 10 μM forward primer Fp1 0.075 μL, 10 μM forward primer Fp2 0.075 μL, 10 μM reverse primer R 0.2 μL, template DNA 1.0 μL, and ddH2O to make up to a total volume of 5 μL.

[0022] Preferably, the program of the PCR amplification is: 94℃ pre-denaturation for 15 min; followed by 10 cycles of amplification, each cycle including 94℃ denaturation for 20 s, 65℃ annealing for 1 min, decreasing by 0.7℃ for each cycle; 94℃, 20 s; 57℃, 1 min, 30 cycles: 30℃ reading fluorescence value.

[0023] The present application has the following beneficial effects:

[0024] On the basis of QTL positioning of eggplant fruit skin striping, an Indel variation site closely linked thereto is identified, and a co-dominant KASP molecular marker is developed accordingly. The marker can quickly and accurately distinguish homozygous striping, homozygous non-stripping and heterozygous genotypes at the seedling stage, realize early molecular assisted selection, significantly reduce the workload and environmental influence of field phenotype identification, and improve the breeding efficiency and accuracy of eggplant varieties with striping. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 Statistical distribution of fruit skin striping traits of single plants in the F2 population in Example 1 of the present application.

[0026] Figure 2 Positioning map of InDel related to fruit skin striping in Example 1 of the present application.

[0027] Figure 3 F2 population in Example 1 of the present application. 2:3 The 21 recombinant single plant genotypes in the family, wherein the red line interval represents the fine positioning interval of the gene. S represents eggplant with fruit skin striping; P represents eggplant without fruit skin striping.

[0028] Figure 4 The insertion of T base in the eggplant material (BW-2-2) with fruit skin striping at the position of chr04:4043249.

[0029] Figure 5 Genotyping map of 53 F2 population single plants detected by marker Fs04_4043249 in Example 1 of the present application. DETAILED DESCRIPTION

[0030] The following examples are further illustrations of the present application and are not intended to limit the present application.

[0031] In the following examples, the test methods are conventional test methods unless otherwise specified, and the experimental reagents and consumables described in the following examples are from conventional biochemical reagent companies unless otherwise specified.

[0032] Example 1

[0033] 1. Materials and methods

[0034] 1.1 Experimental materials

[0035] The eggplant materials used in this experiment were: the non-striped eggplant "WT" as the female parent and the striped eggplant "BW2-2" as the male parent, and the F1 heterozygous striped eggplant offspring population was obtained through hybridization. After self-pollination, the F2 segregating population was obtained. All materials were planted at the research base of the South Subtropical Crops Research Institute of the Chinese Academy of Tropical Agricultural Sciences in Zhanjiang City, Guangdong Province, with a plant spacing of 55 cm × 65 cm, and managed according to conventional field cultivation methods.

[0036] 1.2 Experimental Methods

[0037] 1.2.1 DNA extraction and BSA pooled sequencing

[0038] Genomic DNA was extracted from young leaves using the 2% CTAB method. After statistical analysis of the striped phenotype in the F2 population, 20 plants each of the extreme phenotypes (striped and non-striped) were selected to construct two extreme pools: a non-striped eggplant pool and a striped eggplant pool. The DNA from the selected plants in each pool was mixed in equal amounts to construct the two pools. Berry Genomics performed BSA pool resequencing using the Illumina HiSeq 2000 platform. Simultaneously, whole-genome resequencing was performed on the parental materials: non-striped eggplant “WT” and striped eggplant “BW2-2”. The parental sequencing depth was 20×, and the sequencing depth of the two pools was 30×. Using eggplant HQ-1315 as the reference genome (https: / / solgenomics.net / ), sequence alignment was performed using BWA, and variant detection was conducted using software such as SAMtools to obtain a high-quality set of SNP loci. Using the striped parent BW2-2 as a reference, the SNP-index value of each pool at each SNP locus was calculated. Further, the SNP-index values ​​of the striped pool and the non-striped pool were subtracted to obtain the Δ(SNP-index) for each locus, and a distribution map of SNP-index and Δ(SNP-index) was plotted accordingly. Based on the eggplant reference genome HQ-1315 published in the So1 Genomics Network database, the resequencing data of both parents were compared to screen for polymorphic Indel loci between the parents, which will be used for subsequent molecular marker development.

[0039] 1.2.2 KASP Tag Development

[0040] Based on the VCF and FASTA files obtained from BSA analysis, KASP molecular markers were developed using the screened Indel sites. The specific steps are as follows:

[0041] (1) Locate the variant site in the target interval (Chr04: 4043249 bp) in the vcf file, get its physical location, and extract the gene sequence of 250 bp before and after the variant site in the fasta file.

[0042] (2) Submit the above sequence to the SNP Primer function area of the website http: / / www.snpway.com / to automatically generate the allele-specific upstream forward primer Fp1 FAM and Fp2 HEX located downstream of the Indel, and the reverse primer R (Table 4).

[0043] (3) The primers are synthesized by Shanghai Sangon Biological Engineering Co., Ltd. and purified by PAGE gel. The synthesized primers need to be dissolved with ultrapure water to avoid the use of low-quality water or high-concentration TE buffer to avoid affecting the subsequent genotyping effect.

[0044] 1.2.3 KASP genotyping

[0045] KASP genotyping reaction was performed on a 384-well fluorescent quantitative PCR instrument. Before starting the experiment, the 384-well plate should be reasonably laid out according to the sample number, and two parents, F1 samples and blank controls should be set for each plate.

[0046] Dilute the genomic DNA of the sample to be tested to 20 ng / μL as the PCR template. The KASP reaction system needs to be prepared on ice, and the KASP Master mix reagent must be operated in the dark. After the system is prepared, centrifuge it in a centrifuge at 1200 rpm for 1 min to ensure that the liquid is fully collected at the bottom of the tube. The specific composition of the KASP reaction system is shown in Table 1, and the amplification reaction program settings are shown in Table 2.

[0047] Table 1 PCR reaction system of KASP genotyping

[0048] Table 2 KASP amplification reaction setting program

[0049] The KASP genotyping data analysis was performed using the QuantStudio 6 and 7 Flex Real-Time PCR System Software produced by Applied Biosystems. Based on the difference in excitation and emission wavelengths of FAM and HEX fluorescent dyes, the product genotypes were distinguished: the red dots gathered near the X-axis represented homozygous samples carrying the HEX fluorescent label, corresponding to the genotype T / T; the blue dots gathered near the Y-axis represented homozygous samples carrying the FAM fluorescent label, corresponding to the genotype G / G; the green circles gathered in the XY-axis diagonal area represented heterozygous samples of the two alleles, corresponding to the genotype T / G; the black graph displayed in the lower left corner was the NTC (no template control) group. Figure 5 ).

[0050] 1.2.4 Construction of genetic linkage map and primary gene positioning

[0051] Based on the 95% confidence interval determined by BSA-seq analysis, molecular markers suitable for KASP analysis were designed and screened, and then genotyping was carried out in the F2 population. The genotype assignment rules are as follows: consistent with the parent without stripes "WT" is recorded as "0", consistent with the parent with stripes "BW2-2" is recorded as "2", heterozygous is recorded as "1", and untyped or no signal is recorded as "-1". The genetic distance was calculated using the MAP function of QTL IciMapping 4.2 software to construct a genetic linkage map, in which the genetic map distance was converted into centimorgan (cM) units by Kosambi function. Further QTL analysis of the fruit color trait of eggplant was carried out by the BIP function of the software, with LOD value ≥ 2.5 as the threshold for the existence of QTL, and finally the gene positioning results were determined.

[0052] 2. Results and analysis

[0053] 2.1 Segregation statistics of fruit peel stripe trait in F2 population

[0054] F1 (WT x BW2-2) was obtained by crossing the parent without stripes "WT" with the parent with stripes "BW2-2", and F2 segregation population was constructed by selfing F1. Among the 278 F2 population, there were 193 striped eggplants and 85 non-striped eggplants, and the segregation ratio of non-striped and striped individuals was consistent with the Mendelian single gene inheritance rule of 3:1. Moreover, the trait was controlled by a major gene, and the striped trait was dominant (T / T) over the non-striped trait (G / G). Figure 1 ).

[0055] 2.2 BSA pool sequencing and QTL positioning of eggplant fruit peel stripe gene

[0056] The gene controlling fruit peel stripness of eggplant was located in the interval of 3.89-4.87 Mb (95% confidence level) on Chr04 with a total length of about 0.98 Mb by BSA-seq, as shown in Figure 2 Figure 1. The target interval on chromosome 4 was narrowed down to 0.33 Mb between the molecular markers Fs04_4033683 and Fs04_4357857 by BSA-seq. 2:3 The eggplant plants in the family that were heterozygous in the target interval on chromosome 4 were used as materials, and the population size was expanded to 1488. Between the molecular markers Fs04_3903348 and Fs04_4679316, a total of 21 recombinant single plants were identified. Figure 3 The interval between these recombinant single plants was marker-encrypted, and combined with genotype and phenotype association analysis, the gene controlling the stripness trait was finally located to the molecular markers Fs04_4033683 and Fs04_4357857 on chromosome 4 of eggplant, with a physical distance of about 0.33 Mb.

[0057] 2.3 Detection of associated InDel and development of KASP marker

[0058] Analysis of the genome resequencing data of the parents "WT" and "BW2-2" showed that there was a polymorphism of an InDel site at the 4043249 bp site on chromosome 4, specifically, there was an insertion of one base "T" in "BW2-2" Figure 4 , while the base "T" was deleted in "WT". The InDel was converted into KASP marker Fs04_4043249 (Table 3). Using Fs04_4043249 KASP primer amplification (Table 4), the fluorescence signal detected in the parent "WT" was FAM, and the genotype was G / G, while the fluorescence signal detected in the parent "BW2-2" was HEX, and the genotype was T / T.

[0059] Table 3 Molecular marker information

[0060] Table 4 KASP primer sequence

[0061] Note: Fp1 FAM FAM fluorescence linker is indicated by underlined; Fp2 HEX : HEX fluorescence linker is indicated by underlined

[0062] 2.4 Development and verification of KASP molecular markers closely linked to the stripness trait

[0063] The accuracy of the molecular marker Fs04_4043249 was detected in 53 single plants of the F2 segregation population, and the results Figure 5Table 5 shows that its phenotype was 100% consistent with that of the unstriped eggplant and the striped eggplant in the F2 population.

[0064] Table 5. Correspondence between genotype and phenotype after genotyping of molecular marker Fs04_4043249

[0065] >WT (SEQ ID NO.1)

[0066] TGAAGCGGCTAGTTGGAGCCAAAGGAAGCAAATGTACGCCACAATCCGCGACGCAGGAGGAAAGAGAATTATGATGAACCCCTGGACTGCACCACCAACCA[-]GGGTTTTCCGCCCACGGCTCATCATATTAGACCCTTACATGTTTGGGGGCATCCACATGTAAATAATTGTTTTTGGCATCCACATTATCAAGGGGTGAGT

[0067] >BW2-2 (SEQ ID NO.2)

[0068] TGAAGCGGCTAGTTGGAGCCAAAGGAAGCAAATGTACGCCACAATCCGCGACGCAGGAGGAAAGAGAATTATGATGAACCCCTGGACTGCACCACCAACCA[T]GGGTTTTCCGCCCACGGCTCATCATATTAGACCCTTACATGTTTGGGGGCATCCACATGTAAATAATTGTTTTTGGCATCCACATTATCAAGGGGTGAGT

[0069] The above detailed description is a specific description of the embodiments of the present invention. These embodiments are not intended to limit the patent scope of the present invention. All equivalent implementations or modifications that do not depart from the present invention should be included in the patent scope of this case.

Claims

1. An InDel molecular marker closely linked to Solanum melongena fruit skin streak QTL locus, characterized in that, The molecular marker is located at position 102 of the nucleotide sequence shown in SEQ ID NO. 1, and a single-base T insertion / deletion variation exists at the position; when the base T exists at the position, the eggplant pericarp shows stripes; and when the base T is deleted at the position, the eggplant pericarp shows no stripes.

2. A KASP primer set for detecting the molecular marker of claim 1, characterized in that, Comprise: Forward primer Fp1: 5'-GACTGCACCACCAACCAG-3'; Forward primer Fp2: 5'-GACTGCACCACCAACCAT-3'; Reverse primer R: 5'-GGTCTAATATGATGAGCCGTGG-3'.

3. The primer set of claim 2, wherein, Different fluorescent group tag sequences are connected to the 5' end of the forward primers Fp1 and Fp2.

4. The primer set of claim 3, wherein, The 5' end of the forward primer Fp1 is connected with the fluorescent group FAM tag sequence GAAGGTGACCAAGTTCATGCT; and the 5' end of the forward primer Fp2 is connected with the fluorescent group HEX tag sequence GAAGGTCGGAGTCAACGGATT.

5. A product comprising the primer set according to any one of claims 2 to 4, characterized in that, The product is a reagent or kit for detection.

6. The molecular marker of claim 1, the primer set of claim 2 or the product of claim 5 is applied in any one or more of the following aspects: (1) used for identification or genotyping of the eggplant pericarp strip trait; (2) used for early prediction and screening of the eggplant pericarp strip trait at the seedling stage; (3) used for eggplant molecular breeding and germplasm improvement.

7. A method for identifying the absence or presence of a fruit-streaking gene in eggplant, comprising, The eggplant DNA to be tested is used as a template, and the primer set of any one of claims 2-4 is used for PCR amplification, and genotyping is judged according to the fluorescence signal results of the amplification product.

8. The method of claim 7, wherein, The genotyping according to the fluorescence signal results of the amplification product is specifically: if only FAM fluorescence signal is detected, the genotype is G / G, corresponding to no eggplant pericarp strip; if only HEX fluorescence signal is detected, the genotype is T / T, corresponding to eggplant pericarp with strip; and if FAM and HEX fluorescence signals are detected simultaneously, the genotype is T / G, corresponding to eggplant pericarp without strip.

9. The method of claim 7, wherein, The reaction system of the PCR amplification is: KASP Mastermix 2.5 μL, 10 μM of forward primer Fp1 0.075 μL, 10 μM of forward primer Fp2 0.075 μL, 10 μM of reverse primer R 0.2 μL, template DNA 1.0 μL, and ddH2O is supplemented to a total volume of 5 μL.

10. The method of claim 7, wherein, The program of the PCR amplification is: 94℃ pre-denaturation for 15min; then 10 cycles of amplification, each cycle including 94℃ denaturation for 20s, 65℃ annealing for 1min, decreasing 0.7℃ for each cycle; 94℃, 20s; 57℃, 1min, 30 cycles: 30℃ reading fluorescence value.

Images