Application of Chinese rose miRNA in gray mold resistance

Abstract

The invention relates to the technical field of breeding of disease-resistant varieties of plants, in particular to application of miRNA (micro Ribonucleic Acid) of Chinese roses in gray mold resistance, the miRNA is novel-miR103, a mature sequence of the miRNA is shown as SEQ ID NO.1, and a precursor sequence of the miRNA is shown as SEQ ID NO.2; an interference vector containing SEQ ID NO.3 is constructed through a short tandem target simulation method and transferred into Chinese roses, the gray mold resistance of the Chinese roses can be remarkably improved by down-regulating the expression of the miRNA, the resistance can be reduced by up-regulating the expression of the overexpression vector constructed through an artificial microRNA method and transferred into the Chinese roses, and the invention further discloses application of the miRNA interference preparation and application of the miRNA interference preparation in gray mold resistance breeding of the Chinese roses. According to the application of the Chinese rose miRNA in gray mold resistance, the problems of cost, pollution and pathogenic bacterium drug resistance of chemical prevention and treatment can be solved, a clear molecular target and a technical path are provided, an important foundation is laid for improvement of Chinese rose disease resistance breeding, and the application prospect in the aspect of Chinese rose gray mold prevention and treatment is good.

Description

Technical Field

[0001] This invention relates to the field of plant disease-resistant variety breeding technology, specifically the application of rose miRNA in resistance to gray mold. Background Technology

[0002] Gray mold is a common plant disease caused by *Botrytis*, which can occur on various plants such as roses, tomatoes, and grapes. *Botrytis* infects the host in the form of mycelium, conidia, and sclerotia. The infection process and mechanism are very complex, with multiple infection modes. When infecting roses, *Botrytis* primarily infects the flower parts, causing petals to turn brown, rot, and wilt, eventually leading to the entire flower turning brown and withering, thus reducing its ornamental value. In recent years, with the increasing economic value of roses, florists have adopted continuous cropping methods for cut roses. While this has led to higher profits, it has also resulted in a severe outbreak of gray mold. Gray mold is extremely damaging to roses; even roses with mild symptoms are unsellable due to petal damage, significantly reducing their economic value. Currently, the control methods for gray mold in roses are limited, mainly relying on chemical control, such as the use of carbendazim and iprodione.

[0003] Long-term use of large amounts of chemical agents not only increases costs but also pollutes the environment with residual agents. Furthermore, the use of chemical agents can lead to drug resistance in pathogens through targeted selection. Therefore, identifying and utilizing resistance-related genes for disease-resistant breeding has become an effective and economical strategy for controlling rose diseases. MicroRNAs (miRNAs) are a class of non-coding RNAs with a length of 20-24 nt. Plant miRNAs mainly regulate the expression of target genes through splicing and translational inhibition, playing an important role in various physiological and biochemical processes such as plant growth and development, metabolism, material transport, stress response, and pathogen defense. Currently, a large number of miRNAs have been identified from various plants, but research on miRNAs related to plant disease resistance regulation is relatively limited. To date, no disease resistance-related miRNAs have been reported in roses, resulting in a lack of miRNA resources that can be used for regulating rose gray mold resistance and for disease-resistant breeding. This makes it difficult to meet the actual needs of breeding disease-resistant rose varieties. Therefore, in light of the above situation, there is an urgent need to develop an application of rose miRNA in gray mold resistance to overcome the current shortcomings in practical applications. Summary of the Invention

[0004] The purpose of this invention is to provide an application of rose miRNA in the fight against gray mold, so as to solve the problems mentioned in the background art.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] The application of a rose miRNA in resistance to gray mold, wherein the miRNA is novel-miR103, and the mature sequence of novel-miR103 is shown in SEQ ID NO.1.

[0007] As a further aspect of the present invention: the precursor sequence of novel-miR103 is shown in SEQ ID NO.2.

[0008] As a further aspect of the present invention, the resistance of roses to gray mold is improved by downregulating the expression level of novel-miR103 in roses.

[0009] As a further aspect of the present invention: the expression level of novel-miR103 is downregulated by using a short tandem target simulation method. Specifically, an interference vector containing a short tandem target simulation sequence is constructed and transferred into rose. The short tandem target simulation sequence is shown in SEQ ID NO.3.

[0010] As a further aspect of the present invention: the interference vector is a recombinant vector obtained by connecting the short tandem target simulation sequence to the pTRV2 vector.

[0011] The application of a rose miRNA interference agent containing the interference vector of claim 4 in improving rose resistance to gray mold.

[0012] As a further aspect of the present invention, the resistance of roses to gray mold is reduced by upregulating the expression level of novel-miR103 in roses.

[0013] As a further aspect of the present invention: the expression level of novel-miR103 is upregulated by artificial microRNA method, specifically by cloning the precursor sequence of novel-miR103 and constructing an overexpression vector, and then transferring the overexpression vector into rose.

[0014] As a further aspect of the present invention, the application is the use of novel-miR103 in the breeding of roses for resistance to gray mold.

[0015] As a further aspect of the present invention: the breeding involves downregulating the expression of novel-miR103 in roses through genetic engineering to cultivate rose varieties resistant to gray mold.

[0016] Compared with the prior art, the beneficial effects of the present invention are:

[0017] This invention, through small RNA sequencing, first discovered rose novel-miR103 (its mature sequence has the sequence shown in SEQ ID NO.1, and its precursor sequence has the sequence shown in SEQ ID NO.2), and clarified the regulatory role of this miRNA in rose resistance to gray mold. Experimental results confirmed that reducing the expression level of rose novel-miR103 in roses can significantly improve the resistance of roses to gray mold, while overexpression of rose novel-miR103 significantly reduces the resistance of roses to gray mold, providing a clear and effective molecular target for the targeted regulation of rose resistance to gray mold.

[0018] This invention also provides specific application schemes based on this miRNA, including obtaining an interference vector of novel-miR103 (containing the STTM sequence shown in SEQ ID NO.3) using a short tandem target simulation method, transferring the interference vector into rose recipient material to improve rose gray mold resistance, and using a novel-miR103 interference preparation containing the interference vector to improve rose gray mold resistance. At the same time, novel-miR103 can be applied to rose gray mold resistance breeding, providing a new technical path for rose disease resistance genetic engineering breeding.

[0019] This invention does not rely on chemical agents, effectively avoiding the increased costs, environmental pollution, and pathogen resistance problems caused by long-term use of chemical agents. It conforms to an effective and economical strategy for controlling rose diseases and has good application prospects in controlling rose gray mold, laying an important foundation for rose disease-resistant breeding and improvement. Attached Figure Description

[0020] Figure 1 This is a secondary structure diagram of the novel-miR103 precursor sequence in an embodiment of the present invention;

[0021] The green portion represents the mature miRNA sequence.

[0022] Figure 2 This is a graph showing the results of fluorescence quantitative PCR detection of novel-miR103 expression in 'Yueyuefen' after infection with Botrytis cinerea in this embodiment of the invention;

[0023] H2O treatment was used as a control; * indicates a significant difference compared to the control (*: 0.01 < P ≤ 0.05; **: 0.001 < P ≤ 0.01; ***: 0.0001 < P ≤ 0.001; ****: 0.00001 < P ≤ 0.0001).

[0024] Figure 3 This is a schematic diagram of the simulated target gene sequence of the novel-miR103 short fragment in an embodiment of the present invention.

[0025] Figure 4 This is the result graph of the identification of the disease resistance of 'Yueyue Pink' with transient silencing of novel - miR103 in the embodiments of the present invention;

[0026] Among them, A is the disease symptom; B is the lesion area; C is the relative expression level of novel - miR103; * represents a significant difference compared with the control (**: 0.001 < P ≤ 0.01; ****: 0.00001 < P ≤ 0.0001).

[0027] Figure 5 This is the result graph of the identification of the disease resistance of 'Yueyue Pink' with transient over - expression of novel - miR103 in the embodiments of the present invention;

[0028] Among them, A is the disease symptom; B is the lesion area; C is the relative expression level of novel - miR103; * represents a significant difference compared with the control (**: 0.001 < P ≤ 0.01; ***: 0.0001 < P ≤ 0.001). Detailed implementation manners

[0029] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts belong to the scope of protection of the present invention.

[0030] The following describes the specific implementation of the present invention in detail with specific embodiments.

[0031] Please refer to Figures 1-5 , an application of a rose miRNA in resisting Botrytis cinerea provided by the embodiments of the present invention. Unless otherwise specified, the technical means used are all conventional technical means of those skilled in the art; the reagents, materials, etc. used can be obtained through commercial channels, and the key gene sequences involved are respectively:

[0032] The mature sequence of novel - miR103: as shown in SEQ ID NO.1, the specific sequence is:

[0033] TCGAAGTCGGTATTGTAGATT;

[0034] The precursor sequence of novel - miR103: as shown in SEQ ID NO.2, the specific sequence is:

[0035] TCACCCTTGAGATTGAATTGTTAAGCTCGAAGTCGGTATTGTAGATT GTTCTCTCGAGGAGAATCTACAATACCGACTTGAACCTTAGGAATTCCAT AATCTACGGCGAGA;

[0036] The novel-miR103 short tandem target simulation sequence (STTM103) is shown in SEQ ID NO.3. The specific sequence is as follows:

[0037] aatctacaatactaccgacttcgaGTTGTTGTTGTTATGGTCTAATTTAAATATGGT CTAAAGAAGAAGAATaatctacaatactaccgacttcga.

[0038] This invention relates to the application of rose miRNAs in resistance to gray mold, focusing on the regulatory role of rose novel-miR103 in gray mold resistance, specifically including the following:

[0039] Application of novel-miR103 in regulating resistance to gray mold in roses: The mature sequence of novel-miR103 is shown in SEQ ID NO.1, and its precursor sequence is shown in SEQ ID NO.2; the expression level of this miRNA can be regulated to achieve targeted regulation of resistance to gray mold in roses, wherein:

[0040] Downregulating the expression level of novel-miR103 can significantly improve the resistance of roses to gray mold. Specifically, the short tandem target mimicry (STTM) method can be used to construct an interference vector containing the STTM sequence shown in SEQ ID NO.3 (such as linking the STTM103 sequence to the pTRV2 vector), and then the interference vector can be transferred into rose receptor material (such as rose 'Monthly Powder') to improve the gray mold resistance of roses.

[0041] Upregulating the expression level of novel-miR103 can significantly reduce the resistance of roses to gray mold. Specifically, the artificial microRNA method can be used to clone the precursor sequence of novel-miR103 (SEQ ID NO.2), construct an overexpression vector (such as ligating the precursor sequence into the pBI121-EGFP vector), and then transfer the overexpression vector into rose recipient material, thereby reducing the resistance of roses to gray mold.

[0042] Application of novel-miR103 interference agent: The interference agent contains the interference vector of novel-miR103 (containing the STTM sequence shown in SEQ ID NO.3), and can be used to improve the resistance of roses to gray mold. The application methods include, but are not limited to, applying the interference agent to rose petals or leaves and other tissues through Agrobacterium-mediated transient transformation.

[0043] Application of novel-miR103 in Botrytis cinerea Resistance Breeding in Roses: Based on the negative regulatory effect of novel-miR103 on Botrytis cinerea resistance, this miRNA can be used as a molecular target for rose disease resistance breeding. Its expression in roses can be downregulated through genetic engineering to cultivate new rose varieties resistant to Botrytis cinerea. The mature sequence of novel-miR103 must meet the sequence characteristics shown in SEQ ID NO.1.

[0044] The biological materials involved in this invention include, but are not limited to, expression cassettes, transposons, vectors (such as pTRV2-STTM103 interference vector, pBI121-pre-miR103 overexpression vector) containing novel-miR103 or its precursor sequence, host cells (such as Agrobacterium GV3101), and transgenic cell lines, wherein the host plant is limited to rose (such as the 'Yueyuefen' variety).

[0045] The feasibility and effectiveness of the above technical solution are verified through specific embodiments, clarifying the association between novel-miR103 and rose gray mold resistance, and the effect of regulating the expression of this miRNA on rose resistance.

[0046] Example 1: Real-time quantitative PCR detection of the response of rose novel-miR103 to gray mold.

[0047] This embodiment uses real-time quantitative PCR (qRT-PCR) technology to detect the expression changes of novel-miR103 in the rose 'Yueyuefen' after infection with Botrytis cinerea, clarifying the association between this miRNA and Botrytis cinerea infection, and laying the foundation for subsequent research on its function in regulating Botrytis cinerea resistance in roses.

[0048] 1.1 Materials and Reagents

[0049] Test strain: Botrytis, the causal agent of gray mold in roses, was isolated from rose plants infected with gray mold.

[0050] The test plant material was the rose variety 'Yueyuefen', with healthy, disease-free petals selected during its full bloom period.

[0051] Culture media and reagents:

[0052] PDA medium: 200g potato, 20g sucrose, 20g agar, 1000mL distilled water, autoclaved at 121℃ for 20min.

[0053] High-throughput tissue homogenizer (Jingxin, model JXFSTPRP-CLN-64); miRcute polysaccharide and polyphenol plant miRNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd.); miRNA cDNA first-strand synthesis kit (Hunan Aikerui Biotechnology Co., Ltd.); SYBR Green Pro Taq HS premixed qPCR kit (Hunan Aikerui Biotechnology Co., Ltd.); CFX Connect TM Real-time fluorescence quantitative detection system (Bio-Rad, CA, USA); sterile water, 75% alcohol, and 0.4% water agar medium.

[0054] Primer design: Based on the mature sequence of novel-miR103 (SEQ ID NO.1), a specific primer novel-miR103-F: 5'-TGAAGTGTTTGGGGGAACTC-3' (as shown in SEQ ID NO.4) was designed, and paired with the universal primer miRNA qPCR 3'primer from the miRNA cDNA first strand synthesis kit; using U6 as an internal reference gene, primers U6-F: 5'-CATCCGATAAAATTGGAACGA-3' (as shown in SEQ ID NO.5) and U6-R: 5'-TTTGTGCGTGTCATCCTTGCG-3' (as shown in SEQ ID NO.6) were designed.

[0055] 1.2 Test Methods

[0056] 1.2.1 Culture and spore suspension preparation of gray mold:

[0057] The isolated *Gyromyces rubrum* fungus was inoculated onto PDA plates and incubated at 22°C for 7 days. The plates were rinsed with sterile water, and fungal conidia were collected. Mycelial residue was removed by filtration through sterile gauze, and the spore suspension was diluted with sterile water to adjust the spore concentration to 1×10⁻⁶. 5 Spores / mL, for later use.

[0058] 1.2.2 Rose petal treatment and inoculation with gray mold:

[0059] Select healthy petals from the 'Monthly Pink' rose variety, disinfect with 75% alcohol for 30 seconds, rinse three times with sterile water, dry the surface water in a laminar flow hood, and then place them on 0.4% water agar medium (keeping the petals moist); inoculate each petal with 1×10 5Two μL of a spore suspension of *Botrytis cinerea* (spores / mL) was dried and cultured at 22°C under 12h light / 12h dark conditions. Five replicates / treatments were set up, with petals inoculated with sterile water serving as a control. After 3 days of culture, disease development was photographed, and all petals from both treatments and controls were immediately flash-frozen in liquid nitrogen and stored at -80°C for subsequent RNA extraction.

[0060] 1.2.3 miRNA extraction:

[0061] Take 100mg of the preserved petal sample, place it in a dedicated grinding tube, add two 2mm sterile steel balls, and grind the sample into powder using a high-throughput tissue homogenizer according to the program of "vibration frequency 50Hz / s, grinding time 30s, 1 cycle, and operating temperature 4℃". Extract miRNA from the sample according to the instructions of the miRcute polysaccharide polyphenol plant miRNA extraction kit, and determine the RNA purity and concentration to ensure that the RNA quality meets the requirements of subsequent experiments.

[0062] 1.2.4 miRNA reverse transcription:

[0063] The reverse transcription reaction was performed according to the instructions of the miRNA cDNA first-strand synthesis kit. The reaction system is shown in Table 1. The reaction conditions were: incubation at 37℃ for 60 min (to complete cDNA synthesis) and heating at 85℃ for 5 min (to inactivate reverse transcriptase) to obtain miRNA cDNA for later use.

[0064] Table 1 miRNA-cDNA first-strand synthesis reaction system

[0065]

[0066]

[0067] 1.2.5 Real-time quantitative PCR detection:

[0068] Using the SYBR Green Pro Taq HS premixed qPCR kit, in CFX Connect TM qRT-PCR was performed using a real-time quantitative PCR system to detect the expression level of novel-miR103. The reaction system is shown in Table 2, and the reaction procedure is shown in Table 3. Three biological replicates were set up, with the U6 gene as an internal control, and a 2... -ΔΔCTThe relative expression level of novel-miR103 was calculated using the method, and the expression level was visualized using GraphPad Prism 9.4.1 software. Significant difference analysis was performed (* indicates 0.01 < P ≤ 0.05, ** indicates 0.001 < P ≤ 0.01, *** indicates 0.0001 < P ≤ 0.001, **** indicates 0.00001 < P ≤ 0.0001).

[0069] Table 2 qRT-PCR reaction system

[0070] reagents Volume (μL) 2X SYBR Green Pro Taq HS Premix 10 cDNA 2 Primer F (10μM) 0.8 Primer R (10μM) 0.8 RNase-free water 6.4

[0071] Table 3 qRT-PCR reaction procedure

[0072]

[0073]

[0074] 1.3 Results and Analysis

[0075] In the early stages of this invention, small RNA sequencing was performed on leaves of the rose 'Yueyuefen' cultivar inoculated with gray mold, identifying a novel miRNA named novel-miR103. The secondary structure of its precursor sequence (SEQ ID NO.2) is as follows: Figure 1 As shown in the figure (the green part is the mature sequence of novel-miR103, i.e. SEQ ID NO.1).

[0076] Sixty hours after inoculation with *Botrytis cinerea*, the petals of 'Yuyuefen' variegated 'Monthly Pink' showed obvious brown rot lesions, while the control petals inoculated with sterile water showed no symptoms. qRT-PCR results showed that the relative expression level of novel-miR103 in the diseased petals was significantly higher than that in the control petals (e.g., ...). Figure 3 As shown in the figure, the expression of novel-miR103 is upregulated by infection with gray mold, suggesting that this miRNA is involved in the response of roses to gray mold.

[0077] Example 2: Effect of novel-miR103 expression inhibition on rose resistance to gray mold

[0078] In this embodiment, a short tandem target simulation (STTM) technique was used to construct an interference vector for novel-miR103. The expression of novel-miR103 in the rose 'Yueyuefen' was inhibited by Agrobacterium-mediated transient transformation. The changes in the resistance of the rose to gray mold after the inhibition of expression were detected, clarifying the effect of downregulating novel-miR103 expression on the resistance of the rose to gray mold.

[0079] 2.1 Materials and Reagents

[0080] Test materials: Rose variety 'Yueyuefen' (petals during full bloom); Agrobacterium strain GV3101; vectors pTRV1 and pTRV2.

[0081] Reagents: Artificially synthesized STTM sequences (STTM103-1 to STTM103-4), T4 DNA ligase, EcoRI and XhoI restriction endonucleases, LB liquid medium (containing 50 mg / L kanamycin (Kan) and 50 mg / L rifampin (Rif)), infection solution (10 mmol / L LMES, 10 mmol / L LMgCl2, 150 μmol / L acetylsyringone (AS)), miRcute polysaccharide-polyphenol plant miRNA extraction kit (Tiangen), qRT-PCR related reagents (same as in Example 1), ImageJ image analysis software.

[0082] 2.2 Test Methods

[0083] 2.2.1 STTM Sequence Design and Synthesis:

[0084] Complementary short tandem target mimic sequences (STTMs) were designed based on the mature sequence (SEQ ID NO.1) of novel-miR103, and four single-stranded sequences were synthesized:

[0085] STTM103-1:

[0086] 5'-ATTCAATCTACAATACTACCGACTTCGAGTTGTTGTTGTTATGGTCTAA TTTAAAT-3' (as shown in SEQ ID NO. 7);

[0087] STTM103-2:

[0088] 5'-CCATATTTAAATTAGACCATAACAACAACAACTCGAAGTCGGTAGTAT TGTAGATTG-3' (as shown in SEQ ID NO.8);

[0089] STTM103-3:

[0090] 5'-ATGGTCTAAAGAAGAAGAATAATCTACAATACTACCGACTTCGAC-3' (as shown in SEQ ID NO. 9);

[0091] STTM103-4:

[0092] 5'-TCGAGTCGAAGTCGGTAGTATTGTAGATTATTCTTCTTCTTTAGA-3' (as shown in SEQ ID NO.10);

[0093] The four single-stranded sequences were annealed to form a double-stranded STTM103 sequence (SEQ ID NO.3) with EcoRI and XhoI restriction sites at both ends, as shown in the schematic diagram below. Figure 2 As shown.

[0094] 2.2.2 Construction of the novel-miR103 interference vector:

[0095] The pTRV2 vector was double-digested with EcoRI and XhoI restriction endonucleases, and the digested vector backbone was recovered. The double-stranded STTM103 sequence (SEQ ID NO.3) was ligated between the EcoRI and XhoI restriction sites of the pTRV2 vector using T4 DNA ligase to construct the recombinant interference vector pTRV2-STTM103. The recombinant vector was transformed into Agrobacterium GV3101 competent cells, and positive clones were screened using LB plates (containing 50 mg / L Kan and 50 mg / L Rif) to verify their correctness before use.

[0096] 2.2.3 Agrobacterium culture and infection solution preparation:

[0097] Agrobacterium GV3101 carrying the pTRV2-STTM103 recombinant vector and Agrobacterium GV3101 carrying the empty vector pTRV2 were inoculated into 5 mL of LB liquid medium (containing 50 mg / L Kan and 50 mg / L Rif) and cultured at 28 °C with shaking at 200 rpm for 16 h; 2 mL of the culture was then transferred to 100 mL of LB liquid medium (containing 50 mg / L Kan and 50 mg / L Rif). In Rif), continue incubation at 28℃ and 200rpm with shaking until the OD600 value of the bacterial solution reaches 1.0; centrifuge the bacterial solution at 5000rpm for 10min, collect the bacterial cells, resuspend the bacterial cells with infection solution (10mmol / L MES, 10mmol / L MgCl2, 150μmol / LAS), and adjust the OD600 value to 1.0; mix equal volumes of Agrobacterium-containing solutions carrying pTRV2-STTM103 and Agrobacterium-containing solutions carrying pTRV1 (experimental group), and mix equal volumes of Agrobacterium-containing solutions carrying pTRV2 and Agrobacterium-containing solutions carrying pTRV1 (control group). Both mixed bacterial solutions are incubated in the dark for 3h for later use.

[0098] 2.2.4 Instantaneous transformation of rose petals and inoculation with gray mold:

[0099] Using a punch, the petals of the 'Monthly Pink' rose variety during its full bloom were punched into 1cm diameter discs. These discs were then immersed in the infection solution used in the experimental and control groups, respectively, and treated under a vacuum of 0.07MPa for 10 minutes. Three replicates were performed, with 5 petals treated in each replicate. The transformed petals were placed on 0.4% water agar medium and cultured at 22°C for 12 hours under light / 12 hours in darkness for 1 day. Then, they were inoculated with 1×10⁻⁶ petals according to the method described in Example 1. 5 A spore suspension of *Botrytis cinerea* at spore density of 2 μL per petal was inoculated and cultured for 3 days.

[0100] 2.2.5 Disease resistance identification and gene expression detection:

[0101] After 3 days of cultivation, the symptoms of petal lesions were recorded by taking photos, and the lesion area (disease resistance index) was calculated using ImageJ software. At the same time, miRNA was extracted from the petals according to the method in Example 1 and qRT-PCR was performed to analyze the difference in the relative expression level of novel-miR103 between the experimental group and the control group. The significance analysis criteria were the same as in Example 1.

[0102] 2.3 Results and Analysis

[0103] Three days after inoculation with gray mold, the control group showed large areas of brown rot lesions on the petals, while the experimental group (treated with pTRV2-STTM103) showed a significant reduction in lesion area, less than one-quarter of the lesion area in the control group (e.g., ...). Figure 4 (As shown in A and B); qRT-PCR results showed that the relative expression level of novel-miR103 in the petals of the experimental group was significantly lower than that in the control group (as shown in A and B). Figure 4 (As shown in C). The above results indicate that inhibiting the expression of novel-miR103 using STTM technology significantly improved the resistance of the rose 'Yueyuefen' to gray mold, demonstrating that downregulating the expression of novel-miR103 can effectively improve the resistance of roses to gray mold.

[0104] Example 3: Effect of transient overexpression of novel-miR103 on resistance to gray mold in roses

[0105] In this embodiment, the precursor sequence of novel-miR103 (SEQ ID NO.2) was cloned, an overexpression vector was constructed, and overexpression of novel-miR103 in the rose 'Yueyuefen' was achieved using Agrobacterium-mediated transient transformation. The changes in the resistance of the rose to gray mold after overexpression were detected, further verifying the regulatory role of novel-miR103 in the resistance of rose to gray mold.

[0106] 3.1 Materials and Reagents

[0107] Test materials: Rose variety 'Yueyuefen' (genomic DNA extracted from petals); Agrobacterium strain GV3101; vector pBI121-EGFP.

[0108] Reagents: Novel plant genomic DNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd.); 2×Phanta Flash MasterMix high-fidelity enzyme (Nanjing Novizan Biotechnology Co., Ltd.); Cloning Vector (Beijing TransGen Biotech Co., Ltd.); Trans1-T1 cloning competent cells (Beijing TransGen Biotech Co., Ltd.); Plasmid miniprep kit (Tiangen Biotech (Beijing) Co., Ltd.); BamHI and Xba I restriction endonucleases; LB liquid medium (containing 50 mg / L Kan and 50 mg / L Rif); Infection solution (same as in Example 2); qRT-PCR related reagents (same as in Example 1); ImageJ image analysis software; universal primers M13 Forward Primer and M13 Reverse Primer.

[0109] 3.2 Test methods;

[0110] 3.2.1 Cloning of the novel-miR103 precursor sequence:

[0111] Genomic DNA was extracted from the petals of the rose 'Yueyuefen' according to the instructions of the novel plant genomic DNA extraction kit; specific primers were designed based on the precursor sequence of novel-miR103 (SEQ ID NO.2).

[0112] pre-miR103F: 5'-TCACCCTTGAGATTGAATTGTTAAG-3' (as shown in SEQ ID NO.11);

[0113] pre-miR103R: 5'-TCTCGCCGTAGATTATGGAATTC-3' (as shown in SEQ ID NO.12);

[0114] PCR amplification was performed using 2×Phanta Flash MasterMix high-fidelity enzyme. The reaction system is shown in Table 4, and the reaction procedure is shown in Table 5. The PCR products were separated by 1% agarose gel electrophoresis (containing GoldView dye). After observing a single bright band under the gel imaging system, the target fragment (i.e., the novel-miR103 precursor sequence) was recovered by gel excision using an agarose gel DNA recovery kit (Tiangen).

[0115] Table 4 PCR reaction system

[0116] reagents Volume (μL) 2×Phanta Flash Master Mix 25 Genomic DNA 1 Primer F (10μM) 2 Primer R (10μM) 2 RNase-free water 20

[0117] Table 5 PCR reaction procedure

[0118]

[0119] Connect the recovered precursor sequence fragments to Trans1-T1 competent cells were transformed onto Cloning Vectors and plated on LB plates (containing 50 mg / L Kan) for overnight incubation. Single colonies were picked and identified by colony PCR using M13 Forward Primer (5'-GTAAAACGACGGCCAGT-3') (as shown in SEQ ID NO.15) and M13 Reverse Primer (5'-CAGGAAACAGCTATGAC-3') (as shown in SEQ ID NO.16). The positive clones were sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing to verify the sequence correctness (ensuring that it is the sequence shown in SEQ ID NO.2).

[0120] 3.2.2 Construction of the novel-miR103 overexpression vector:

[0121] Recombinant plasmids were extracted from correctly sequenced positive clones using a plasmid miniprep kit; seamless cloning primers with homologous arms were designed based on the multiple cloning site of the pBI121-EGFP vector.

[0122] pBI121-103F:

[0123] 5'-AGAACACGGGGGACTCTAGACACCCTTGAGATTGAATTGTTAAGC-3' (as shown in SEQ ID NO.13);

[0124] pBI121-103R:

[0125] 5'-GACTGACCACCCGGGGATCCCTCGCCGTAGATTATGGAATTC-3' (as shown in SEQ ID NO. 14);

[0126] Using the extracted recombinant plasmid as a template, the novel-miR103 precursor sequence was amplified using the aforementioned seamless cloning primers. The pBI121-EGFP vector was double-digested with BamHI and XbaI restriction endonucleases, and the vector backbone was recovered. The novel-miR103 precursor sequence was ligated between the BamHI and XbaI restriction sites of the pBI121-EGFP vector using seamless cloning technology to construct the recombinant overexpression vector pBI121-pre-miR103. The recombinant vector was transformed into Trans1-T1 competent cells, and positive clones were identified by colony PCR (primers pre-miR103F and pre-miR103R). After sequencing verification, the recombinant plasmid was extracted and transformed into Agrobacterium GV3101 competent cells for later use.

[0127] 3.2.3 Agrobacterium culture and transient transformation of rose petals:

[0128] Agrobacterium GV3101 carrying the pBI121-pre-miR103 recombinant vector (experimental group) and Agrobacterium GV3101 carrying the empty vector pBI121-EGFP (control group) were inoculated into 5 mL of LB liquid medium (containing 50 mg / L Kan and 50 mg / L Rif) and cultured at 28 °C with shaking at 200 rpm for 16 h. 2 mL of the bacterial culture was transferred to 100 mL of LB liquid medium (containing 50 mg / L Kan and 50 mg / L Rif) and cultured until OD600 = 1.0. The bacterial cells were collected by centrifugation at 5000 rpm for 10 min, resuspended in infection solution (same as in Example 2) until OD600 = 1.0, and incubated in the dark for 3 h.

[0129] Following the method in Example 2, the petals of the rose 'Yueyuefen' were cut into 1 cm diameter discs and immersed in the infection solutions of the experimental and control groups, respectively, and vacuum-treated at 0.07 MPa for 10 min; the treatment was repeated 3 times, with 5 petals per replicate; after transformation, the petals were placed in 0.4% water agar medium and cultured at 22°C for 12 h light / 12 h dark for 1 day.

[0130] 3.2.4 Inoculation and resistance testing with Botrytis cinerea:

[0131] Following the method in Example 1, the transformed petals were inoculated with 1×10 5 Botrytis cinerea spore suspension at spores / mL was cultured for 2 days, and the lesion area was calculated using ImageJ software. At the same time, the relative expression level of novel-miR103 was detected by qRT-PCR. The significance analysis criteria were the same as in Example 1.

[0132] 3.3 Results and Analysis

[0133] Two days after inoculation with gray mold, the lesion area on the petals of the experimental group (pBI121-pre-miR103 treatment) was significantly larger than that of the control group (empty vector treatment), approximately five times larger (e.g., ...). Figure 5 (As shown in A and B); qRT-PCR results showed that the relative expression level of novel-miR103 in the petals of the experimental group was significantly higher than that in the control group (as shown in A and B). Figure 5 (As shown in C). The above results indicate that overexpression of novel-miR103 in roses significantly reduces the resistance of roses to gray mold, further demonstrating that novel-miR103 has a negative regulatory effect on the resistance of roses to gray mold, and downregulating its expression can effectively improve the resistance of roses to gray mold.

[0134] Through the experimental verification of the above embodiments 1-3, the present invention clarifies that:

[0135] The mature sequence of Rosenovel-miR103 is shown in SEQ ID NO.1, and the precursor sequence is shown in SEQ ID NO.2. The expression of this miRNA is upregulated by infection with Botrytis cinerea.

[0136] Downregulating the expression of novel-miR103 using STTM technology (constructing an interference vector using the STTM sequence shown in SEQ ID NO.3) can significantly improve the resistance of roses to gray mold.

[0137] Constructing an overexpression vector by cloning the precursor sequence and upregulating the expression of novel-miR103 significantly reduces the resistance of roses to gray mold.

[0138] Therefore, rose novel-miR103 can be applied to the regulation of rose resistance to gray mold and disease-resistant breeding. By downregulating its expression (such as by using an interference vector or interference agent containing SEQ ID NO.3), rose varieties resistant to gray mold can be bred, providing an effective technical means for the green control of rose gray mold and the improvement of disease-resistant varieties.

[0139] It should be noted that, in this invention, although the specification describes the embodiments, not every embodiment contains only one independent technical solution. This way of describing the specification is only for clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. The application of a rose miRNA in resistance to gray mold, characterized in that, The miRNA is novel-miR103, and the mature sequence of novel-miR103 is shown in SEQ ID NO.

1.

2. The application of rose miRNA in resistance to gray mold according to claim 1, characterized in that, The precursor sequence of novel-miR103 is shown in SEQ ID NO.

2.

3. The application of rose miRNA in resistance to gray mold according to claim 1, characterized in that, By downregulating the expression level of the novel-miR103 in roses, the resistance of roses to gray mold was improved.

4. The application of rose miRNA in resistance to gray mold according to claim 3, characterized in that, The expression level of novel-miR103 was downregulated using a short tandem target simulation method. Specifically, an interference vector containing a short tandem target simulation sequence was constructed and transferred into rose. The short tandem target simulation sequence is shown in SEQ ID NO.

3.

5. The application of rose miRNA according to claim 4 in resistance to gray mold, characterized in that, The interference vector is a recombinant vector obtained by linking the short tandem target simulation sequence to the pTRV2 vector.

6. The application of a rose miRNA interference agent containing the interference vector of claim 4 in improving the resistance of rose to gray mold.

7. The application of rose miRNA in resistance to gray mold according to claim 1, characterized in that, By upregulating the expression level of novel-miR103 in roses, the resistance of roses to gray mold was reduced.

8. The application of rose miRNA according to claim 7 in resistance to gray mold, characterized in that, The expression level of novel-miR103 was upregulated using the artificial microRNA method. Specifically, the precursor sequence of novel-miR103 was cloned and an overexpression vector was constructed, which was then transformed into rose.

9. The application of rose miRNA according to claim 1 in resistance to gray mold, characterized in that, The application is the use of novel-miR103 in the breeding of roses for resistance to gray mold.

10. The application of rose miRNA according to claim 9 in resistance to gray mold, characterized in that, The breeding involves using genetic engineering to downregulate the expression of novel-miR103 in roses to cultivate rose varieties resistant to gray mold.

Images