Application of galactosidase gene GbGAL1 in improvement of cotton fiber yield traits

Abstract

The invention discloses an application of a galactosidase gene GbGAL1 in improvement of yield traits of cotton fibers. The galactosidase gene GbGAL1 has two haplotypes, the genomic sequence of the haplotype 1 is SEQ ID NO.1, and the CDS sequence of the haplotype 1 is SEQ ID NO.2; the genomic sequence of the haplotype 2 is SEQ ID NO.4, and the CDS sequence of the haplotype 2 is SEQ ID NO.5. SNAP primers for identifying the two haplotypes are further developed, and the sequences of the SNAP primers are respectively SEQ ID NO. 9 and SEQ ID NO. 10. When the haplotype 2 gene sequence or the protein coded by the haplotype 2 gene exists in a cotton plant, the allele or the protein of the allele can promote the cotton boll weight or lint percentage increase, which shows that the haplotype 2 gene has important effect and application prospect in improving the cotton yield character and cultivating a new high-yield cotton variety.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biotechnology application, and relates to application of galactoside enzyme gene GbGAL1 in improving fiber yield traits of cotton. BACKGROUND

[0002] Sea island cotton has many excellent properties, such as disease resistance, stress resistance and high-quality fiber, but its fiber yield is lower than that of upland cotton (Jin et al., 2022; Han et al., 2023; Hu et al., 2019). With the continuous improvement of people's living standards and the rapid development of modern cotton textile technology, the demand for long-staple cotton in the domestic and international markets is also increasing, and the shortage of sea island cotton is becoming a key constraint factor. Improving the yield of sea island cotton and cultivating high-yield sea island cotton varieties will help the rapid development of the long-staple cotton industry. Due to the narrow genetic background, the improvement of yield traits by traditional breeding methods is still relatively lagging behind in sea island cotton breeding (Zhang et al., 2008). Therefore, it is very important to mine QTL / gene related to yield components through molecular breeding means for improving the fiber yield of sea island cotton.

[0003] So far, many QTLs and candidate genes related to the yield of upland cotton have been reported (Song et al., 2019; Sun et al., 2018; Su et al., 2016; Zhang et al., 2017; Ma et al., 2018), and there are few studies on the yield traits of sea island cotton. Yu et al. (2021) reported 823 single nucleotide polymorphisms (SNPs) related to LP using 240 sea island cotton germplasms and identified a candidate gene GB_A07G1034 encoding a receptor protein kinase. Zhao et al. (2022) identified a candidate gene GbLP1 (Gbar_A05G014160) related to LP and further confirmed its function through gene expression and virus-induced gene silencing (VIGS) experiments. Jin et al. (2023) conducted a structural variation (SV)-genome-wide association study (GWAS) analysis on 333 sea island cotton germplasms from POP2 and identified a SV (65 bp deletion) significantly associated with LP on A04 chromosome, located 1617 bp downstream of GH_A04G0270. These research results provide excellent site and gene resources for cotton breeding and greatly accelerate the breeding efficiency.

[0004] Plant β-galactosidase catalyzes the hydrolysis of terminal galactose residues of carbohydrates, glycoproteins and galactolipids, and is involved in plant growth and development, cell wall biogenesis and modification (Smith et al., 2000; Esteban et al., 2005; Buckeridge and Reid, 1994; Chantarangsee et al., 2007; McCartneyy et al., 2003; Martín et al., 2009; Sørensen et al., 2000, Guo et al., 2018; Hou et al., 2021). Previous studies have shown that β-galactosidase can be involved in cell elongation by regulating cell wall changes (Martín et al., 2009; Albornos et al., 2012; Moneo-Sánchez et al., 2019). β-galactosidase is related to the metabolism of cell wall polysaccharides, and a large number of studies have shown that some genes related to sugar metabolism play an important role in the entire development process of cotton fibers (Wu et al., 2005; Lee et al., 2010; Jiang et al., 2012; Sun et al., 2019; Li et al., 2014; Sun et al., 2020; Ahmed et al., 2018; Han et al., 2016; Jiang et al., 2012; Wen et al., 2023). SUMMARY

[0005] The purpose of the present application is to provide the application of galactosidase gene GbGAL1 in improving cotton yield traits. Based on the yield phenotype data and BLUP value of two-year two-point upland cotton natural population, combined with whole genome resequencing information of each material, 3VmrMLM model was used to conduct whole genome association analysis of genotype-phenotype on two yield traits, and QTL affecting yield traits was located. Subsequently, important variations in the coding region of candidate genes located in the QTL were extracted for local association analysis test, and an important InDel site was found in the exon region of ID number GB_A06G0815, which caused changes in amino acid sequences, producing two different haplotypes (haplotype 1 and haplotype 2). GB_A06G0815 gene encodes β-galactosidase, named GbGAL1. Comparative analysis of yield traits between different haplotypes of GbGAL1 showed that haplotype 2 had significant advantages over haplotype 1 in boll weight and lint percentage traits.

[0006] The purpose of the present application can be achieved by the following technical solutions:

[0007] In a first aspect, the present application claims at least one of the following (a1)-(a5) applications of a molecular marker related to cotton fiber yield traits or a substance for detecting the molecular marker:

[0008] (a1) screening or assisting in screening cotton germplasm with excellent fiber yield traits, or preparing a product for screening or assisting in screening cotton germplasm with excellent fiber yield traits;

[0009] (a2) identifying or assisting in identifying cotton fiber yield traits, or preparing a product for identifying or assisting in identifying cotton fiber yield traits;

[0010] (a3) identifying cotton galactosidase gene GbGAL1 haplotype, or preparing a product for identifying galactosidase gene GbGAL1 haplotype;

[0011] (a4) improving cotton fiber yield traits, or preparing a product for improving cotton fiber yield traits;

[0012] (a5) high fiber yield trait cotton breeding, or preparing a product for high fiber yield trait cotton breeding;

[0013] The molecular marker comprises an InDel and a SNAP molecular marker. The molecular marker is used for detecting two haplotypes of cotton galactosidase gene GbGAL1; wherein the genomic sequence of haplotype 1 is shown in SEQ ID NO. 1, and the genomic sequence of haplotype 2 is shown in SEQ ID NO. 4; haplotype 1 has a deletion of a nucleotide C at 2139 bp of the genomic sequence compared with haplotype 2, which causes the premature termination of the amino acid translation encoded by the genomic sequence of haplotype 1; haplotype 1 has an A / G mutation site at 7712 bp of the genomic sequence compared with haplotype 2, and the A / G mutation site is co-segregated with the nucleotide deletion site at 2139 bp; the cotton fiber yield trait of haplotype 2 is better than that of haplotype 1.

[0014] Further, screening cotton germplasm materials carrying galactosidase gene GbGAL1 haplotype 2 for breeding application to improve cotton fiber yield traits, or overexpressing the CDS sequence shown in SEQ ID NO. 5 of galactosidase gene GbGAL1 haplotype 2 in cotton.

[0015] In a second aspect, the present application claims a product containing the above-mentioned substance for detecting the molecular marker, and at least one of the following (b1)-(b5):

[0016] (b1) a product for screening or assisting in screening cotton germplasm with excellent fiber yield traits;

[0017] (b2) a product for identifying or assisting in identifying cotton fiber yield traits;

[0018] (b3) a product for identifying haplotypes of galactosidase gene GbGAL1;

[0019] (b4) a product for improving cotton fiber yield traits;

[0020] (b5) a product for cotton breeding with high fiber yield traits.

[0021] In a third aspect, the present application claims a method, which is at least one of the following (c1)-(c5):

[0022] (c1) a method for screening or assisting in screening cotton germplasm with excellent fiber yield traits;

[0023] (c2) a method for identifying or assisting in identifying cotton fiber yield traits;

[0024] (c3) a method for identifying haplotypes of galactosidase gene GbGAL1;

[0025] (c4) a method for improving cotton fiber yield traits;

[0026] (c5) a method for cotton breeding with high fiber yield traits.

[0027] The method is for identifying haplotypes of galactosidase gene GbGAL1 using a substance for detecting a molecular marker; the cotton galactosidase gene GbGAL1 has two haplotypes, wherein the genomic sequence of haplotype 1 is shown in SEQ ID NO. 1, and the genomic sequence of haplotype 2 is shown in SEQ ID NO. 4; haplotype 1 has a deletion of one nucleotide C at 2139 bp of the genomic sequence compared with haplotype 2, which causes the premature termination of the amino acid translation encoded by the genomic sequence of haplotype 1; haplotype 1 has an A / G mutation site at 7712 bp of the genomic sequence compared with haplotype 2, and the A / G mutation site is co-segregated with the nucleotide deletion site at 2139 bp; the cotton fiber yield traits of haplotype 2 are superior to those of haplotype 1; cotton germplasm materials carrying haplotype 2 of galactosidase gene GbGAL1 are screened for breeding application to improve cotton fiber yield traits, or the CDS sequence of haplotype 2 of galactosidase gene GbGAL1 shown in SEQ ID NO. 5 is overexpressed in cotton.

[0028] The identification of haplotypes of galactosidase gene GbGAL1 using a substance for detecting a molecular marker can be detected at the gene level.

[0029] In the specific embodiments of the present application, the in vitro nucleic acid amplification primers shown as SEQ ID NO. 9 and SEQ ID NO. 10 are used for amplification, and in haplotype 1, an amplification product with a molecular weight of 884 bp can be generated, while in haplotype 2, no amplification product is generated.

[0030] In the technical solution of the present application, the substance for detecting the molecular marker is as follows (d1) or (d2) or (d3) or (d4):

[0031] (d1) contains the in vitro nucleic acid amplification primers shown as SEQ ID NO. 9 and SEQ ID NO. 10 for specifically amplifying the SNAP molecular marker;

[0032] (d2) contains the in vitro nucleic acid amplification reagent of (d1) the in vitro nucleic acid amplification primer;

[0033] (d3) contains the kit of (d1) the in vitro nucleic acid amplification primer or (d2) the in vitro nucleic acid amplification reagent;

[0034] (d4) contains the detection instrument of (d1) the in vitro nucleic acid amplification primer, (d2) the in vitro nucleic acid amplification reagent or (d3) the kit.

[0035] In the technical solution of the present application, the cotton fiber yield trait is at least one of boll weight and lint percentage.

[0036] In a fourth aspect, the present application claims to protect the galactoside enzyme gene GbGAL1 or the biological material related to the galactoside enzyme gene GbGAL1 for use in (e1) or (e2) as follows:

[0037] (e1) improving cotton fiber yield traits or cultivating new cotton germplasm with high yield;

[0038] (e2) promoting plant growth;

[0039] The galactoside enzyme gene GbGAL1 has a genomic sequence as shown in SEQ ID NO. 4 or a CDS sequence as shown in SEQ ID NO. 5.

[0040] Further, the biological material related to the galactoside enzyme gene GbGAL1 is at least one of (f1)-(f11) as follows:

[0041] (f1) a galactoside enzyme protein GbGAL1 with an amino acid sequence as shown in SEQ ID NO. 6;

[0042] (f2) a primer pair for cloning the galactoside enzyme gene GbGAL1 as shown in SEQ ID NO. 7 and SEQ ID NO. 8;

[0043] (f3) an expression cassette containing the galactosidase gene GbGAL1;

[0044] (f4) a recombinant vector containing the galactosidase gene GbGAL1, or a recombinant vector containing the expression cassette of (f3);

[0045] (f5) a recombinant microorganism containing the galactosidase gene GbGAL1, or a recombinant microorganism containing the expression cassette of (f3), or a recombinant microorganism containing the recombinant vector of (f4);

[0046] (f6) a transgenic plant cell line containing the galactosidase gene GbGAL1, or a transgenic plant cell line containing the expression cassette of (f3), or a transgenic plant cell line containing the recombinant vector of (f4);

[0047] (f7) a transgenic plant tissue containing the galactosidase gene GbGAL1, or a transgenic plant tissue containing the expression cassette of (f3), or a transgenic plant tissue containing the recombinant vector of (f4);

[0048] (f8) a transgenic plant organ containing the galactosidase gene GbGAL1, or a transgenic plant organ containing the expression cassette of (f3), or a transgenic plant organ containing the recombinant vector of (f4);

[0049] (f9) a transgenic plant containing the galactosidase gene GbGAL1, or a transgenic plant containing the expression cassette of (f3), or a transgenic plant containing the recombinant vector of (f4);

[0050] (f10) a tissue culture produced from regenerable cells of the transgenic plant of (f9);

[0051] (f11) a protoplast produced from the tissue culture of (f10).

[0052] Further, the above-mentioned application is as follows (g1) or (g2):

[0053] (g1) breeding application of screening cotton germplasm materials carrying haplotype 2 of the galactosidase gene GbGAL1 to improve cotton fiber yield traits, or overexpressing haplotype 2 of the galactosidase gene GbGAL1 in cotton;

[0054] (g2) overexpressing the CDS sequence of haplotype 2 of the galactosidase gene GbGAL1 as shown in SEQ ID NO. 5 in plants to promote plant growth.

[0055] In the specific embodiments of the present application, overexpression of haplotype 2 of the galactoside hydrolase gene GbGAL1 in Arabidopsis thaliana exhibits longer main root length, better plant growth and longer leaf length than wild type.

[0056] In a fifth aspect, the present application claims a method for improving cotton fiber yield traits or promoting the growth of target plants, characterized in that the galactoside hydrolase gene GbGAL1 is used as a target gene, and the galactoside hydrolase gene GbGAL1 with the nucleotide sequence shown as SEQ ID NO. 5 is overexpressed in cotton or target plants by genetic engineering method to improve cotton fiber yield traits or cultivate new cotton germplasm with improved cotton fiber yield traits, or promote the growth of target plants.

[0057] The present application finds a galactoside hydrolase gene GbGAL1, which has two haplotypes, haplotype 1 has the genomic sequence shown as SEQ ID NO. 1 and the CDS sequence shown as SEQ ID NO. 2, and haplotype 2 has the genomic sequence shown as SEQ ID NO. 4 and the CDS sequence shown as SEQ ID NO. 5. The amino acid sequence of the protein encoded by haplotype 1 of the galactoside hydrolase gene GbGAL1 is shown as SEQ ID NO. 3, and the amino acid sequence of the protein encoded by haplotype 2 of the galactoside hydrolase gene GbGAL1 is shown as SEQ ID NO. 6.

[0058] Studies have shown that when haplotype 2 gene sequence or its encoded protein exists in cotton plants, the allele or its protein can promote the increase of boll weight and lint percentage of cotton, indicating that the gene haplotype 2 has important role and application prospect in improving cotton yield traits and cultivating new cotton varieties with high yield.

[0059] The development process of the technical scheme of the present application includes the following steps:

[0060] 1. Selecting a natural population of upland cotton for multi-year and multi-point phenotype data determination and processing. The natural population of upland cotton is planted under multi-year and multi-point conditions, the yield traits (boll weight and lint percentage) are investigated, the outliers are removed, and the BLUP analysis (best linear unbiased prediction) is performed on the multi-year and multi-point phenotype data.

[0061] 2. Performing second-generation resequencing (sequencing depth 10x) on each germplasm in the upland cotton population, detecting variation sites with upland cotton Hai7124 as the reference genome to obtain genotype data. The filtering standard for genotype data is that sites with a deletion rate greater than 0.1 and an alternative allele frequency less than 0.05 are removed.

[0062] 3. The haplotypes 1 and 2 of the galactosidase gene GbGAL1 are provided in the application, wherein the genome sequence of the haplotype 1 is SEQ ID NO. 1, the CDS sequence is SEQ ID NO. 2, and the encoded amino acid sequence is SEQ ID NO. 3; the genome sequence of the haplotype 2 is SEQ ID NO. 4, the CDS sequence is SEQ ID NO. 5, and the encoded amino acid sequence is SEQ ID NO. 6. The haplotype 1 has a deletion of a nucleotide C at 2139 bp of the genome sequence compared with the haplotype 2, which results in the premature termination of the translation of the encoded amino acid. In addition, the haplotype 1 has an A / G SNP site at 7712 bp of the genome sequence compared with the haplotype 2, which is co-segregated with the nucleotide deletion at 2139 bp. The comparative analysis of the yield traits between the different haplotypes of GbGAL1 shows that the haplotype 2 has advantages in boll weight and lint percentage compared with the haplotype 1.

[0063] 4. The application further provides an Arabidopsis thaliana transgenic strain overexpressing the haplotype 2 of GbGAL1. Compared with the wild type (WT), the Arabidopsis thaliana transgenic strain overexpressing the haplotype 2 has a longer main root length, a better plant growth and a longer leaf length, which indicates the important role of the haplotype in the growth and development of plants.

[0064] 5. The application further provides a molecular marker for identifying the two haplotypes of GbGAL1. The amplification product with a molecular weight of 884 bp can be generated in the material of the haplotype 1, while no amplification product can be generated in the material of the haplotype 2. The genotype identification by using the molecular marker can obtain the genotyping data of different haplotypes, and the material of the haplotype 2 is determined as a new germplasm of high-yield cotton.

[0065] The application has the following advantages:

[0066] 1. The application mines a galactosidase gene GbGAL1 significantly associated with the yield traits of cotton by resequencing a natural cotton population and performing whole genome association analysis. The 10-fold deep resequencing of the island cotton population identifies 3780162 SNPs and 449380 InDels. The high-quality genotype data provides a guarantee for the accuracy of the association analysis site.

[0067] 2. The expression level of GbGAL1 in different tissues and organs of cotton is obtained by transcriptome analysis. The gene is dominantly expressed during the fiber development period, which indicates the close relationship between the gene and the yield traits.

[0068] 3. The population can be divided into two types according to different InDel / SNP genotypes of GbGAL1, haplotype 1 has a deletion of one nucleotide at 2139 bp of the genomic sequence compared to haplotype 2, i.e. haplotype 1 (-) and haplotype 2 (C), which causes the encoded amino acid translation to terminate prematurely. In addition, haplotype 1 has an A / G SNP site at 7712 bp of the genomic sequence compared to haplotype 2, which is co-segregated with the nucleotide deletion at 2139 bp. Statistical analysis found that there were significant differences in boll weight and lint percentage between populations corresponding to different haplotypes, and the expression of the two haplotypes was significantly different at different stages of fiber development, further proving the correlation between the gene and cotton yield traits.

[0069] 4. Compared with wild type (WT), transgenic Arabidopsis lines with overexpression of the dominant haplotype of GbGAL1 showed different differences, Arabidopsis transgenic lines with haplotype 2 showed longer main root length, better plant growth and longer leaf length. BRIEF DESCRIPTION OF DRAWINGS

[0070] Figure 1 . Manhattan plot of candidate gene GbGAL1 in boll weight (BW) and lint percentage (LP) traits in multiple environments.

[0071] Figure 2 . Gene structure of cotton GbGAL1 gene.

[0072] The black line represents the position of InDel (- / C) and SNP G / A on the gene. An InDel site was identified in the natural population, which is located in the 10th exon region of GbGAL1 (GB_A06G0815), which encodes β-galactosidase. In addition, there is an A / G SNP site at the 12th exon region, which is co-segregated with the InDel (- / C) nucleotide deletion. According to the variation, haplotype analysis of the natural population found that there are two haplotypes of the gene, haplotype 1 has a deletion of one nucleotide (C) compared to haplotype 2, which causes the encoded amino acid translation to terminate prematurely.

[0073] Figure 3 . Comparative analysis of yield trait differences between different haplotypes of GbGAL1.

[0074] Box plot represents the distribution of yield traits of the natural population of Gossypium barbadense. The horizontal coordinate represents different haplotype materials, and the vertical coordinate is the corresponding yield trait value, which is boll weight and lint percentage in yield traits, respectively. The number of materials containing haplotype 1 (-) and haplotype 2 (C) is 193 and 51, respectively. **** indicates a difference at the 0.0001 level.

[0075] Figure 4 Expression levels of GbGAL1 in different tissues and developmental stages of sea island cotton Hai7124.

[0076] The vertical axis represents gene expression levels (expressed as the average expression level (TPM) of a single gene per million transcripts). The horizontal axis represents different tissues, including roots, stems, leaves, floral organs, ovules, and fibers. Floral organ tissues include bracts, calyxes, receptacles, petals, anthers, and filaments; ovule tissues include -3, -1, 0, 1, 3, 5, 10, 20, and 25 DPA; and fiber tissues include 10, 20, and 25 DPA.

[0077] Figure 5 Differences in GbGAL1 expression during fiber development stages (5 DPA, 10 DPA, 15 DPA, 20 DPA, 25 DPA) in high-chromatic germplasm M (AShi) and low-chromatic germplasm I (XH33).

[0078] Three replicates were used for each period. *, **, and **** represent significant differences at P < 0.05, P < 0.01, and P < 0.0001, respectively. Two-tailed t-tests were used to analyze the significance of the differences.

[0079] Figure 6 Functional analysis of dominant haplotypes of GbGAL1, a gene associated with yield traits.

[0080] The study included: (A) Phenotypic analysis of taproot length in WT and transgenic seedlings after 9 days of long-day growth. Scale bar represents 1 cm. (B) Mean taproot length in WT and transgenic seedlings after 9 days of long-day growth. At least eight biological replicates were used for each assay. (C) Growth of WT and transgenic seedlings after 25 days of short-day growth following transplanting. Scale bar represents 1 cm. (D) Phenotypic analysis of leaf length in WT and transgenic seedlings after 25 days of short-day growth following transplanting. Scale bar represents 1 cm. (E) Leaf length in WT and transgenic seedlings after 25 days of short-day growth following transplanting. At least eight biological replicates were used for each assay. Significant differences between WT and transgenic lines were calculated using a two-tailed t-test. ** represents P < 0.01. Vertical line represents standard deviation (SD). WT, wild type; OE, different GbGAL1 overexpression lines.

[0081] Figure 7 Development of different haplotype molecular markers of GbGAL1 and analysis of different sea island cotton materials

[0082] The vertical electrophoresis gel image represents the distribution of two different haplotypes in 269 Gossypium barbadense populations. Haplotype 1 can amplify a DNA band of 884 bp, while haplotype 2 has no amplification product.

[0083] Figure 8 Based on the vertical electrophoresis gel analysis, the difference of lint percentage between different haplotypes of GbGAL1 was identified and compared

[0084] The box plot represents the distribution of yield traits of 244 Gossypium barbadense materials. The horizontal coordinate represents the number of different haplotype materials, and the vertical coordinate is the lint percentage. The number of materials containing haplotype 1 (A) and haplotype 2 (G) is 189 and 55, respectively. * indicates a difference at the 0.05 level. DETAILED DESCRIPTION

[0085] In order to make the technical problems solved by the present application, technical solutions and beneficial effects more clearly understood, the present application will be further described in detail below in combination with embodiments.

[0086] The experimental methods used in the following examples are conventional methods unless otherwise specified.

[0087] Example 1 Mining of GbGAL1 associated with cotton yield traits

[0088] A total of 269 Gossypium barbadense germplasm from different regions of China and major cotton producing countries in the world were subjected to whole genome resequencing. After standard variation detection and genotype filtering, a total of 3780162 high-quality SNPs and 449380 InDels (≤50 bp) were detected. At the same time, the population materials were planted in two different locations, Korla (Loc1) and Aksu (Loc2), for two consecutive years (2017 and 2018), and the 2 yield traits of each material were investigated in detail. Based on the phenotypic data and BLUP values of two years and two points, GWAS analysis was performed on the two yield traits using 3VmrMLM model, and a InDel located on A06 chromosome was significantly associated with boll weight and lint percentage by local association analysis (P<0.001, Table 1), which is located at the 10th exon of GB_A06G0815, and produces two different types, haplotype 1 (-) and haplotype 2 (C) (Table 1). Figure 1 , Table 1), haplotype 1 has a nucleotide deletion at 2139 bp (A06: 17077600) of the genomic sequence compared with haplotype 2, resulting in premature termination of the encoded amino acid. Figure 2

[0089] Table 1 Mining of GbGAL1 associated with cotton yield traits ​

[0090]

[0091] Example 2 Phenotypic difference analysis of different haplotypes of galactosidase gene GbGAL1

[0092] Using t-test statistical method, we calculated the phenotypic difference of yield traits between the two groups of haplotypes. The boll weight and lint percentage of haplotype 2 (C) were significantly better than those of haplotype 1 (-) of Gossypium barbadense germplasm ( Figure 3 ).

[0093] Example 3 Expression level analysis of GbGAL1 in different tissues and developmental stages of cotton

[0094] The present application collected the transcriptome data of different tissues and different developmental stages of Gossypium barbadense germplasm Hai7124 from NCBI. The sample materials include roots, stems, leaves, floral organs, ovules and fibers, etc. The floral organ tissues include bracts, sepals, receptacles, petals, anthers and filaments; the ovule tissues include -3, -1, 0, 1, 3, 5, 10, 20, 25 DPA; the fiber tissues include 10, 20, 25 DPA. The calculation of gene expression level is to align the reads obtained by sequencing with the Gossypium barbadense genome, and the calculated expression level is expressed as the average expression level of monomer gene per one million transcripts (TPM). The experimental results are shown in Figure 4 , which shows that the gene is dominantly expressed in the fiber development period, indicating the correlation of the gene with the fiber yield trait ( Figure 4 ).

[0095] Example 4 Expression level difference analysis of different haplotype germplasm of GbGAL1 in the fiber development period of cotton

[0096] The application downloads the published genome resequencing data and fiber transcriptome data of two island cotton germplasms with extremely different fiber traits, namely M (A Shi, high fiber content, containing haplotype 2) and I (X H33, low fiber content, containing haplotype 1). Through variation detection on the genome resequencing data of the two island cotton germplasms, the haplotype of the GbGAL1 gene of the two island cotton germplasms is obtained, that is, the genotype of M (A Shi) is haplotype 2 (C), and the genotype of I (X H33) is haplotype 1 (-). The calculation of gene expression level is to align the reads obtained by sequencing with the island cotton genome, and the calculated expression level is expressed as the average expression level of monomer genes in one million transcripts. Using the t-test statistical method, we calculate the difference in gene expression level between the two groups of haplotypes at different fiber development periods. The results show that the gene expression level of the high fiber content germplasm (A Shi) carrying haplotype 2 (C) is significantly higher than that of the low fiber content germplasm (X H33) carrying haplotype 1 (-) at 5 DPA, 10 DPA, 15 DPA, 20 DPA and 25 DPA Figure 5 ), indicating that the gene is related to fiber yield.

[0097] Example 5 Functional analysis of the dominant haplotype of GbGAL1 gene

[0098] To further elucidate the function of GbGAL1, the haplotype 2 cDNA sequence as shown in SEQ ID NO. 5 was amplified from the 10-day post-anthesis fiber of Gossypium barbadense L. cv. Hai7124. The amplification primers were F primer 5'-GGACTCTAGAGGATCCCCGGGATGTGGTGGGACAAAAACATGTT-3' as shown in SEQ ID NO. 7, and R primer 5'-CGATCGGGGAAATTCGAGCTCTCATTTGCATGCAGCTTCAACT-3' as shown in SEQ ID NO. 8. The overexpression transgenic Arabidopsis lines of this gene haplotype 2 were constructed, and the overexpression vector used in the experiment was PBI121, and the double enzyme digestion method was used, and the enzyme digestion sites were Smal and SacI. Finally, four transgenic Arabidopsis lines overexpressing haplotype 2 (OE-3, OE-5, OE-6, and OE-7) were obtained. We selected three transgenic lines from them for phenotype research. The surface-sterilized wild-type and transgenic Arabidopsis seeds were sown in rows on 1 / 2MS medium. One group of experiments was vertically placed in the growth chamber under long-day growth conditions (24 / 22°C, 16 h light / 8 h dark) for 9 days, and then the primary root length of wild-type and transgenic Arabidopsis was measured. Another group of experiments was placed in the growth chamber under long-day conditions for 14 days and then under short-day growth conditions (24 / 22°C, 8 h light / 16 h dark) for 25 days, and then the growth of wild-type and transgenic Arabidopsis was observed, and the leaf length of rosette leaves was measured. Compared with the wild type (WT), the overexpression transgenic lines of haplotype 2 in Arabidopsis showed longer primary root length after vertical culture for 9 days under long-day conditions, better plant growth, and longer leaf length after 25 days of culture under short-day conditions. Figure 6 ).

[0099] Example 6 Development of GbGAL1 Different Haplotype SNAP Marker and Population Identification

[0100] It was found that haplotype 1 has a nucleotide deletion at 2139 bp of the genomic sequence compared with haplotype 2, which causes the premature termination of the encoded amino acid translation. In addition, haplotype 1 has an A / G SNP site at 7712 bp of the genomic sequence compared with haplotype 2, which is co-segregated with the nucleotide deletion at 2139 bp. Based on this SNP site, a SNAP marker was developed to identify haplotype 1 and haplotype 2. Haplotype 1 can amplify a 884 bp DNA band, while haplotype 2 has no amplification product. Figure 7 Using the t-test statistical method, we further analyzed the Gossypium barbadense natural population and verified the phenotypic differences of yield traits between the two haplotypes. The lint percentage of Gossypium barbadense germplasm with haplotype 2 was significantly better than that of haplotype 1Figure 8 ). The SNAP marker primers are shown in SEQ ID NO. 9 and SEQ ID NO. 10.

[0101] In summary, we mined a galactosidase gene GbGAL1 which is significantly associated with boll weight and lint percentage in cotton from natural population resequencing and genome-wide association analysis. GbGAL1 gene is expressed dominantly during fiber development. There are two haplotypes of GbGAL1 gene in natural population, and different haplotypes have different expression levels in fiber tissue at 5 DPA, 10 DPA, 15 DPA, 20 DPA and 20 DPA. According to Arabidopsis thaliana transgenic experiment of GbGAL1 gene, it is found that the dominant haplotype 2 shows longer main root length, better plant growth and longer leaf length than wild type (WT), indicating that it plays an important role in plant growth and development. Further development of SNAP marker for identifying different haplotypes of GbGAL1 serves the rapid selection of cotton germplasm materials with GbGAL1 dominant haplotype 2. In summary, GbGAL1 has important role and application prospect in improving cotton yield traits and cultivating new cotton varieties with high yield.

[0102] SEQUENCE LISTING

[0103] SEQ ID NO. 1 Genomic sequence of GbGAL1 haplotype 1 9392

[0105] DNA

[0106] Gossypium barbadense

[0107] ​

[0108] SEQ ID NO. 2 CDS sequence of GbGAL1 haplotype 1 1014

[0110] DNA

[0111] Gossypium barbadense

[0112]

[0113] SEQ ID NO. 3 Amino acid sequence of GbGAL1 haplotype 1 337

[0115] Amino acid sequence

[0116] MWWDKNMLSKVVNMFMLWLLFSSWVFSLVSATVSYDSKAIIINGRRRILLSGSIHYPRSTPQMWPDLIAKAKEGGLDVIQTYVFWNGHEPSPGNYYFEDRYDLVRFIKLVQQAGLYVHLRIGPYICAEWNFGGFPVWLKYVPGIAFRTDNEPFKAAMQKFTEKIVSMMKAEKLFETQGGPIIMSQIENEFGPVEWEIGDPGKAYTKWAAQMAVGLDTGVPWIMCKQDDAPDPVINTCNGFYCENFTPNAKYKPKMWTENWTGWYTEFGGAVPTRPAEDIAFSVARFIQNGGSFVNYYMYHGGTNFGRTASGLFIATSYDYDAPIDKYGLQGNQNGAI

[0117] SEQ ID NO. 4 Genomic sequence of GbGAL1 haplotype 2 9393

[0119] DNA

[0120] Gossypium barbadense

[0121]

[0122] SEQ ID NO. 5 CDS sequence of GbGAL1 haplotype 2 2529

[0124] DNA

[0125] Gossypium barbadense

[0126]

[0127] SEQ ID NO. 6 Amino acid sequence of GbGAL1 haplotype 2 842

[0129] Amino acid sequence

[0130] MWWDKNMLSKVVNMFMLWLLFSSWVFSLVSATVSYDSKAIIINGRRRILLSGSIHYPRSTPQMWPDLIAKAKEGGLDVIQTYVFWNGHEPSPGNYYFEDRYDLVRFIKLVQQAGLYVHLRIGPYICAEWNFGGFPVWLKYVPGIAFRTDNEPFKAAMQKFTEKIVSMMKAEKLFETQGGPIIMSQIENEFGPVEWEIGDPGKAYTKWAAQMAVGLDTGVPWIMCKQDDAPDPVINTCNGFYCENFTPNAKYKPKMWTENWTGWYTEFGGAVPTRPAEDIAFSVARFIQNGGSFVNYYMYHGGTNFGRTASGLFIATSYDYDAPIDKYGLPREPKWGHLRDLHRAIKLSEPALVSADPTVTSLGSNQEGHVFKSKSGACAAFLANYDTKYSVKVTFGSAHYELPSWSITILPDCKTAVFNTARLGAQSSEKKMVLANTAFSWQSYNEESPSADDQDVTVHDGLWEQIYITRDATDYLCYMTDVQIDPDEGFLRSGQDPLLTIWSAGHALHVFINGQLSGTVYGGLENPKLTFSNNVKLRAGINKVTLLSVAVGLSNVGTHFETWNVGVLGPVTLKGLNEGTRDLSKQKWSYKIGLKGEALKLHTDAGSSSVEWVEGSQLVKKQPMTWYKTTFDAPGGNEPLGLDMSSMGKGQVWINGQSIGRHWPGYIAHGNCDACDYSGTYSDQKCRTNCGQPSQRWYHVPRSWLKPSGNFLVVFEEWGGDPNGIALAKRTTTSVCADIFEGQPTMKKRGMLIAGRISSPKAHLWCPPGQKISKINFASYGMPEGSCGNFREGSCHANKSYDAFQKNCIGKQSCSVTVAPEVFGGDPCPGSRKKVSVEAACK

[0131] SEQ ID NO. 7 Forward primer sequence for cloning GbGAL1 gene 44

[0133] DNA

[0134] Artificial Sequence

[0135] GGACTCTAGAGGATCCCCGGGATGTGGTGGGACAAAAACATGTT

[0136] SEQ ID NO. 8 Reverse primer sequence for cloning GbGAL1 gene 43

[0138] DNA

[0139] Artificial Sequence

[0140] CGATCGGGGAAATTCGAGCTCTCATTTGCATGCAGCTTCAACT

[0141] SEQ ID NO. 9 F primer sequence of SNAP to distinguish different haplotypes of GbGAL1

[0142] AATGAAGAAAGCCCCTCTGCCA

[0143] SEQ ID NO. 10 R primer sequence of SNAP to distinguish different haplotypes of GbGAL1

[0144] TTTAATCCGGTTCTATAGGTTCG.

Claims

1. The use of a molecular marker or substance for detecting a cotton fiber yield trait in at least one of the following (a1)-(a5): (a1) Screening or assisting in the screening of cotton germplasm with excellent fiber yield traits, or preparing products for screening or assisting in the screening of cotton germplasm with excellent fiber yield traits; (a2) To identify or assist in the identification of cotton fiber yield traits, or to prepare products for the identification or assistance in the identification of cotton fiber yield traits; (a3) Identify the GbGAL1 haplotype of the cotton galactosidase gene, or prepare a product for identifying the GbGAL1 haplotype of the galactosidase gene; (a4) Improve cotton fiber yield traits, or prepare products for improving cotton fiber yield traits; (a5) Breeding cotton with high fiber yield traits, or preparing products for breeding cotton with high fiber yield traits; This molecular marker was used to detect two haplotypes of the cotton galactosidase gene GbGAL1; among them, The genome sequence of haplotype 1 is shown in SEQ ID NO.1, and the genome sequence of haplotype 2 is shown in SEQ ID NO.

4. Haplotype 1 has a deletion of nucleotide C at 2139 bp, which causes premature termination of translation of the amino acid encoded by the genome sequence of haplotype 1. Haplotype 1 has an A / G mutation site at 7712 bp, which co-segregates with the nucleotide deletion site at 2139 bp. The cotton fiber yield trait of haplotype 2 is superior to that of haplotype 1.

2. The application according to claim 1, characterized in that, Cotton germplasm materials carrying haplotype 2 of the galactosidase gene GbGAL1 can be screened for breeding applications to improve cotton fiber yield traits, or the CDS sequence of haplotype 2 of the galactosidase gene GbGAL1, as shown in SEQ ID NO.5, can be overexpressed in cotton.

3. A product characterized in that, The product contains the substance for detecting molecular markers as described in claim 1, and is at least one of the following (b1)-(b5): (b1) Screening or assisting in the screening of cotton germplasm with excellent fiber yield traits; (b2) Products used to identify or assist in the identification of cotton fiber yield traits; (b3) Products that identify the GbGAL1 haplotype of the galactosidase gene; (b4) Products that improve the yield properties of cotton fibers; (b5) Products used in cotton breeding for the high fiber yield trait.

4. A method, characterized in that, The method is at least one of the following (c1)-(c5): (c1) Methods for screening or assisting in screening cotton germplasm with excellent fiber yield traits; (c2) Methods for identifying or assisting in the identification of cotton fiber yield traits; (c3) Method for identifying haplotypes of the galactosidase gene GbGAL1; (c4) Methods for improving cotton fiber yield traits; (c5) Methods for breeding cotton with high fiber yield traits; This method involves identifying haplotypes of the galactosidase gene GbGAL1 using a substance that detects molecular markers. The cotton galactosidase gene GbGAL1 exists in two haplotypes: haplotype 1 (genomic sequence shown in SEQ ID NO. 1) and haplotype 2 (genomic sequence shown in SEQ ID NO. 4). Haplotype 1 has a nucleotide C deletion at 2139 bp, causing premature termination of translation of the amino acid encoded by haplotype 1. Haplotype 1 also has an A / G mutation site at 7712 bp, which co-exists with the nucleotide deletion site at 2139 bp. The cotton fiber yield trait of haplotype 2 is superior to that of haplotype 1. Cotton germplasm carrying haplotype 2 of the galactosidase gene GbGAL1 can be screened for breeding applications to improve cotton fiber yield, or haplotype 2 of the galactosidase gene GbGAL1 can be overexpressed in cotton (as shown in SEQ ID NO. 4). The CDS sequence shown in NO.

5.

5. The application according to claim 1 or 2, the product according to claim 3, and the method according to claim 4, characterized in that, The substances used to detect the molecular markers are (d1) or (d2) or (d3) or (d4) as follows: (d1) In vitro nucleic acid amplification primers, such as those shown in SEQ ID NO. 9 and SEQ ID NO. 10, that specifically amplify the molecular markers described above; (d2) In vitro nucleic acid amplification reagent containing the in vitro nucleic acid amplification primers described in (d1); (d3) A kit containing the in vitro nucleic acid amplification primers described in (d1) or the in vitro nucleic acid amplification reagents described in (d2); (d4) A detection instrument containing the in vitro nucleic acid amplification primers described in (d1), the in vitro nucleic acid amplification reagents described in (d2), or the kit described in (d3).

6. The application according to claim 1 or 2, the product according to claim 3, the method according to claim 4, characterized in that, The cotton fiber yield trait is at least one of boll weight and lint percentage.

7. The use of the galactosidase gene GbGAL1 or biological materials related to said galactosidase gene GbGAL1 in the following (e1) or (e2): (e1) Improve cotton fiber yield traits or cultivate new high-yielding cotton germplasm; (e2) Promotes plant growth; The galactosidase gene GbGAL1 has a genomic sequence as shown in SEQ ID NO.4 or a CDS sequence as shown in SEQ ID NO.

5.

8. The application according to claim 7, characterized in that, Biological materials associated with the galactosidase gene GbGAL1 include at least one of the following (f1)-(f11): (f1) The amino acid sequence of the galactosidase protein GbGAL1 is shown in SEQ ID NO.6; (f2) Primer pairs as shown in SEQ ID NO.7 and SEQ ID NO.8 for cloning the galactosidase gene GbGAL1; (f3) An expression cassette containing the galactosidase gene GbGAL1; (f4) A recombinant vector containing the galactosidase gene GbGAL1, or a recombinant vector containing the expression cassette (f3); (f5) A recombinant microorganism containing the galactosidase gene GbGAL1, or a recombinant microorganism containing the expression cassette (f3), or a recombinant microorganism containing the recombinant vector (f4); (f6) A transgenic plant cell line containing the galactosidase gene GbGAL1, or a transgenic plant cell line containing the expression cassette (f3), or a transgenic plant cell line containing the recombinant vector (f4); (f7) Transgenic plant tissue containing the galactosidase gene GbGAL1, or transgenic plant tissue containing the expression cassette (f3), or transgenic plant tissue containing the recombinant vector (f4); (f8) A transgenic plant organ containing the galactosidase gene GbGAL1, or a transgenic plant organ containing the expression cassette (f3), or a transgenic plant organ containing the recombinant vector (f4); (f9) A transgenic plant containing the galactosidase gene GbGAL1, or a transgenic plant containing the expression cassette (f3), or a transgenic plant containing the recombinant vector (f4); (f10) Tissue culture produced from regenerative cells of the transgenic plant described in (f9); (f11) Protoplasts produced from the tissue culture described in (f10).

9. The application according to claim 4, characterized in that, The application is as follows (g1) or (g2): (g1) Screening cotton germplasm materials carrying the galactosidase gene GbGAL1 haplotype 2 for breeding applications to improve cotton fiber yield traits, or overexpressing the galactosidase gene GbGAL1 haplotype 2 in cotton. (g2) Overexpression of haplotype 2 of the galactosidase gene GbGAL1, as shown in SEQ ID NO.5, in plants promotes plant growth.

10. A method for improving cotton fiber yield or promoting the growth of a target plant, characterized in that: Using the galactosidase gene GbGAL1 as the target gene, genetic engineering methods are employed to overexpress the galactosidase gene GbGAL1 with the nucleotide sequence shown in SEQ ID NO.5 in cotton or target plants, thereby improving cotton fiber yield traits, cultivating new cotton germplasm with improved cotton fiber yield traits, or promoting the growth of target plants.

Images