DNA tetrahedral probe for living oocyte mitochondrial ATP imaging and application of DNA tetrahedral probe

Abstract

The invention belongs to the technical field of biology, and discloses a DNA tetrahedral probe for live oocyte mitochondrial ATP imaging and application of the DNA tetrahedral probe. The invention provides a DNA tetrahedron delivery-based nucleic acid probe for fixed-point trigger cascade nucleic acid reaction, which can realize high-sensitivity and rapid detection of mitochondrial ATP of living oocytes. The nucleic acid probe is stable in structure and high in specificity, can accurately distinguish similar 12s rRNA and ATP analogues (such as CTP, GTP and UTP), remarkably reduces false positive signals, and ensures the reliability of detection results. The nucleic acid probe realizes ATP in-situ imaging at a mitochondrial level, is helpful for deep evaluation of an oocyte energy state, provides key indexes for quality reduction of oocytes of elderly women and evaluation of embryonic development potential, and has positive significance in improvement of assisted reproductive outcome.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a DNA tetrahedral probe for imaging mitochondrial ATP in live oocytes and its applications. Background Technology

[0002] With adjustments to fertility policies, the demand for assisted reproductive technologies among older couples is increasing. However, reproductive aging and functional decline have become significant factors affecting women's health and fertility success. Among these, ovarian aging and its associated mitochondrial dysfunction are key factors influencing oocyte quality and embryonic development. Improving mitochondrial function has become an important means to increase the success rate of assisted reproduction in older women. Given the significant heterogeneity among individual oocytes, there is an urgent need to establish effective assessment methods to achieve precise intervention.

[0003] Current oocyte assessment techniques, such as morphological observation, mitochondrial function testing, and molecular genetic screening, still have limitations, including high subjectivity, reliance on expensive and sophisticated instruments, complex procedures, and high invasiveness. Invasive procedures not only render the assessed oocytes unusable but also carry a high risk of misjudgment and significant economic burden. Live-cell imaging, as a non-invasive assessment method, has therefore attracted considerable attention. However, traditional imaging methods are largely limited to morphological observation and struggle to accurately reflect key organelle-level indicators such as mitochondrial activity and functional status. Existing commercially available dyes (such as JC-1 for assessing mitochondrial membrane potential and MitoSOX for assessing reactive oxygen species) also have significant drawbacks in practical applications, such as long retention times, susceptibility to photobleaching, and high false-positive signals. Therefore, developing objective, economical, non-invasive methods that accurately assess mitochondrial function is crucial for improving the rate of high-quality embryo formation in older women.

[0004] Adenosine triphosphate (ATP) is the core carrier of energy metabolism in oocyte mitochondria. Clinical studies have confirmed that a 30%–50% decrease in ATP levels in oocytes of older women can lead to a 2.3-fold increase in the rate of embryonic developmental arrest, highlighting its crucial role in female fertility. Mitochondria synthesize ATP through oxidative phosphorylation, directly driving key events such as meiotic spindle assembly, precise chromosome segregation, and early embryonic cleavage. Therefore, accurate detection of ATP levels in oocyte mitochondria is a core indicator for assessing oocyte quality. Existing detection methods, such as chemiluminescence, nanoflow cytometry, and fluorescence detection, each have significant limitations: chemiluminescence requires cell lysis to extract mitochondria, disrupting cell integrity, and lacks sufficient sensitivity, making single-cell analysis difficult; nanoflow cytometry equipment is expensive, limiting its application; fluorescence detection probes often have cytotoxicity or lack mitochondrial targeting specificity, affecting the accuracy of results and cell viability. Although various nucleic acid detection methods have been used for intracellular ATP analysis, nucleic acid probes rely on carrier delivery. Commonly used nanocarriers (such as liposomes, upconversion materials, and DNA nanostructures) generally suffer from poor biocompatibility and slow metabolism. Effective delivery vectors need to be able to penetrate the zona pellucida and plasma membrane of oocytes, and their size, lipophilicity, and surface charge need to be optimized to achieve mitochondrial targeting. To date, no studies have been reported on the use of targeted nanocarriers to deliver nucleic acid probes to oocyte mitochondria for in situ ATP detection.

[0005] DNA tetrahedral (TDN) structures are stable and easy to synthesize, possessing the ability to efficiently deliver and assemble multiple probes, and have been successfully used for highly sensitive analysis of intracellular ATP. Mitochondrial targeting can be achieved by modifying its ends with triphenylphosphine (TPP). Given the widespread presence of ATP in the cytoplasm, to avoid non-specific signals during delivery, a mitochondrial-localized activation "molecular switch" needs to be designed to spatiotemporally control the ATP recognition probe. Therefore, developing a highly sensitive and specific method for detecting endogenous ATP in situ and at a specific site in the mitochondria of live oocytes, achieving highly sensitive and specific analysis of endogenous ATP, not only has significant scientific research value but also has urgent practical significance for improving the success rate of assisted reproductive technology in older women. Summary of the Invention

[0006] To address the limitations of current conventional imaging methods for assessing oocyte mitochondrial function, such as reliance on subjective interpretation, high false-positive rates of commercially available fluorescent dyes, and low targeted delivery efficiency and poor biocompatibility of commonly used nanocarriers, this invention proposes a novel oocyte mitochondrial imaging strategy. This strategy utilizes triphenylphosphine (TPP)-modified DNA tetrahedral structures, which can specifically target mitochondria and efficiently deliver multinucleic acid probes, to construct a highly sensitive ATP analysis method, enabling in-situ, accurate detection of ATP within the mitochondria of live oocytes.

[0007] The first aspect of the present invention is to provide a nucleic acid probe.

[0008] The second objective of this invention is to provide a method for preparing the nucleic acid probe of the first aspect of this invention.

[0009] The third aspect of this invention aims to provide the application of the nucleic acid probe of the first aspect of this invention.

[0010] A fourth aspect of the present invention is to provide a reagent, reagent kit, or analytical apparatus.

[0011] The fifth aspect of this invention is to provide a method for detecting ATP.

[0012] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a nucleic acid probe comprising a DNA tetrahedron and three double-stranded LMTs, wherein the double-stranded LMTs are modified on any three strands of the DNA tetrahedron; The DNA tetrahedron is composed of 4 DNA single strands. The ends of the DNA single strands are free sequences, which are located at the four vertices of the DNA tetrahedron. One end of the free sequence is fixed to a vertex of the DNA tetrahedron, and the outer end extends beyond the vertex of the DNA tetrahedron. The dual-chain LMT consists of a TR single chain, a connecting chain, and a Reporter chain; The 3' end of the TR single chain is complementary to the 3' end portion of the connecting chain sequence; The 5' end of the TR single chain is complementary to the 3' end of the Reporter chain. The partial sequence of the connecting chain is complementary to a partial sequence of the Reporter chain; The 5' end of the connecting strand binds complementary to the free sequences of any three DNA single strands of the DNA tetrahedron; The linker chain contains an ATP aptamer sequence.

[0013] In some embodiments of the present invention, the two ends of the Reporter chain contain a segment of RNA, which is rRNA or miRNA that exists only in the mitochondria of cells.

[0014] In some embodiments of the present invention, the RNA comprises 12S rRNA.

[0015] In some embodiments of the present invention, the Reporter chain may form a hairpin structure.

[0016] In some embodiments of the present invention, the loop portion of the hairpin structure is complementary to a portion of the sequence of the connecting chain.

[0017] In some embodiments of the present invention, the ring portion of the hairpin structure is marked with a fluorescent group.

[0018] In some embodiments of the present invention, the fluorescent group is selected from FAM, Cy series (such as CY3, CY5, Cy3B, Cy5.5, Cy7, etc.), TAMRA, TET, ROX, Texas Red, Alexa Fluor series (such as Alexa Fluor 488, 568, 594, 647), ATTO series (such as ATTO 425, ATTO 550, ATTO 647N), and fluorescent proteins (such as CFP, YFP, mCherry, tdTomato, etc.).

[0019] In some embodiments of the present invention, the 5' end of the TR single strand includes a toehold region for recognizing the RNA.

[0020] In some embodiments of the present invention, the portion of the connecting chain that is complementary to the Reporter chain is labeled with a fluorescence quenching group.

[0021] In some embodiments of the present invention, the fluorescence quenching group is selected from BHQ (such as BHQ0, BHQ1, BHQ2, BHQ3, etc.), Dabcyl, QSY series (such as QSY-7, QSY-21, QSY-35, etc.), TAMRA, CY5, Iowa Black FQ.

[0022] In some embodiments of the present invention, the nucleotides of the ATP aptamer sequence are as shown in SEQ ID NO:13 (ACCTGGGGGAGTATTGCGGAGG).

[0023] In some embodiments of the present invention, the nucleotide sequences of the four DNA single strands of the DNA tetrahedron are shown in SEQ ID NO:1 to 4.

[0024] In some embodiments of the present invention, the nucleotide sequence of the TR single strand is shown in SEQ ID NO:6.

[0025] In some embodiments of the present invention, the nucleotide sequence of the linker strand is as shown in SEQ ID NO:5; and / or, the nucleotide sequence of the reporter strand is as shown in SEQ ID NO:7.

[0026] In some embodiments of the present invention, the nucleic acid probe is further modified with a substance that targets mitochondria.

[0027] In some embodiments of the present invention, the mitochondrial-targeting substance includes triphenylphosphine.

[0028] In some embodiments of the present invention, the mitochondrial-targeting substance modifies the free sequence of the DNA tetrahedron; the mitochondrial-targeting substance and the double-stranded LMT are modified on different free sequences.

[0029] In some embodiments of the present invention, the free sequence of the DNA tetrahedron modified with the mitochondrial-targeting material is modified with DBCO.

[0030] In some embodiments of the present invention, the DNA tetrahedron is prepared by a method comprising: mixing four single strands of DNA at equal concentrations to a mixture containing Mg 2+ The reaction is carried out in a buffer solution to obtain DNA tetrahedra.

[0031] In some preferred embodiments of the present invention, the final concentration of the four DNA single strands in the reaction system is 0.1–1 μM; further, 0.4–0.6 μM; and even further, 0.5 μM.

[0032] In some preferred embodiments of the present invention, in the reaction system, the Mg 2+ The final concentration is 8–12 mM; further, 9–11 mM; and even further, 10 mM.

[0033] In some embodiments of the present invention, the buffer solution is Tris-HCl with a concentration of 0.1–1 M.

[0034] In some preferred embodiments of the present invention, the reaction conditions are as follows: reacting at 90–98°C for 4–8 min, then rapidly cooling to 15–20°C for 20–40 min; further, reacting at 94–96°C for 4–6 min, then rapidly cooling to 16–18°C for 30–40 min; even further, reacting at 95–96°C for 5–6 min, then rapidly cooling to 17–18°C for 30–35 min.

[0035] In some embodiments of the present invention, the double-chain LMT is prepared by the following method: the linker chain and the reporter chain are mixed to contain Mg. 2+ The reaction was carried out in a buffer solution, TR single-chain was added, and the reaction was repeated to obtain double-chain LMT.

[0036] In some preferred embodiments of the present invention, the final concentrations of the linker chain and the reporter chain in the reaction system are both 0.1–1 μM; further, 0.4–0.6 μM; and even further, 0.5–0.6 μM.

[0037] In some preferred embodiments of the present invention, in the reaction system, the Mg 2+ The final concentration is 8–12 mM; further, 9–11 mM; and even further, 10 mM.

[0038] In some preferred embodiments of the present invention, the reaction conditions are as follows: reacting at 90–98°C for 4–8 min, then rapidly cooling to 15–20°C for 20–40 min; further, reacting at 94–96°C for 4–6 min, then rapidly cooling to 16–18°C for 30–40 min; even further, reacting at 95–96°C for 5–6 min, then rapidly cooling to 17–18°C for 30–35 min.

[0039] In some preferred embodiments of the present invention, the conditions for the second reaction are: 20-30°C for 0.5-2 hours; further, 20-26°C for 0.5-1.5 hours; and even further, 24-26°C for 1-1.5 hours.

[0040] In some preferred embodiments of the present invention, the final concentration of the TR single chain in the reaction system is 0.1–1 μM; further, 0.4–0.6 μM; and even further, 0.5 μM.

[0041] The mitochondrial site-triggered nucleic acid probe based on DNA tetrahedral delivery provided by this invention is composed of three double-stranded LMTs and a DNA tetrahedral TDN. The double-stranded LMT is formed by hybridization of a linker, a single-stranded TR, and a hairpin reporter containing an rRNA analog (such as 12S rRNA). The loop portion of the hairpin reporter is complementary to a portion of the linker sequence, and the 3' end portion of the TR is complementary to the linker, leaving a toehold for rRNA-specific recognition. The middle portion of the linker strand blocks the aptamer sequence recognized by ATP. The bases of the reporter loop are labeled with fluorescent groups, and the linker is labeled with quenching groups. After the linker and reporter hybridize to form a double strand, the fluorescence is quenched. The DNA tetrahedral TDN is formed by hybridization of four single-stranded probes T1, T2, T3, and T4. The double-stranded LMT is assembled at the 3' end of the three tetrahedral strands via the 5' end of the linker strand, and the remaining tetrahedral strand is modified with TPP. DNA tetrahedrons not only serve to transfect nucleic acids into mitochondria but also fix the distance and position between the three double-stranded LMTs, increasing the local concentration of reactants. In the absence of rRNA and ATP, the LMTs on the DNA tetrahedrons are stable and do not react with each other. In the presence of rRNA, rRNA hybridizes with the TRs on the LMTs via toehold substitution to form a more stable double strand, displacing the 3' end of the linker. Then, when ATP is absent, no further reaction occurs. When ATP is present, ATP binds to the aptamer on the linker to form a hairpin structure, simultaneously displacing the reporter strand to form an rRNA mimic. This leads to fluorescence recovery on the reporter. The single-stranded rRNA mimic can then hybridize with the TRs of neighboring LMTs via toehold substitution to form a stable double strand and displacing the 3' end of the linker. It further reacts with ATP to release a fluorescent signal. This process repeats continuously, resulting in the recovery of fluorescence on numerous reporter strands, enabling ATP detection. Because the reactant LMTs are fixed on the DNA tetrahedrons, the displaced single-stranded rRNA mimic can rapidly react with neighboring LMTs, resulting in a fast response and high sensitivity.

[0042] The nucleic acid probes provided by this invention have high accuracy and good repeatability, and have the potential to be developed into standardized testing kits, which are easy to promote and apply. They provide a new tool for clinical oocyte quality assessment and selection, and have important application value in improving oocyte quality assessment, especially in the reproductive health of older women.

[0043] A second aspect of the present invention provides a method for preparing a nucleic acid probe according to the first aspect of the present invention, comprising the following steps: mixing DNA tetrahedra and double-stranded LMT, and then... 2+The reaction is carried out in a buffer solution to obtain a nucleic acid probe.

[0044] In some embodiments of the present invention, when the nucleic acid probe is modified with a substance targeting mitochondria, the substance targeting mitochondria is first mixed with one single strand of DNA tetrahedron, and the reaction is carried out to modify the DNA single strand with the substance targeting mitochondria, thereby forming a DNA tetrahedron, which is then mixed with LMT in a solution containing Mg. 2+ The reaction is carried out in a buffer solution to obtain a nucleic acid probe.

[0045] In some embodiments of the present invention, the concentration ratio of the DNA tetrahedron to the double-stranded LMT is 1:(3-5); more specifically, it is 1:(3-4).

[0046] In some embodiments of the present invention, in the reaction system, the Mg 2+ The final concentration is 8–12 mM; further, 9–11 mM; and even further, 10 mM.

[0047] In some embodiments of the present invention, the reaction conditions are 23–28°C for 0.5–2 h; further, 23–26°C for 0.5–1.5 h; and even further, 24–26°C for 1–1.5 h.

[0048] In some embodiments of the present invention, the buffer solution is Tris-HCl with a concentration of 0.1–1 M.

[0049] In some embodiments of the present invention, a single-stranded DNA modified with DBCO is mixed with a substance targeting mitochondria at a concentration ratio of (8-12):1 and reacted at room temperature for 20-40 min to obtain a single-stranded DNA modified with the substance targeting mitochondria.

[0050] The third aspect of the present invention provides the application of the nucleic acid probe of the first aspect of the present invention in any one of (1) to (6): (1) qualitative or quantitative detection of ATP; (2) preparation of a product for qualitative or quantitative detection of ATP; (3) real-time monitoring of dynamic changes of ATP in living cells; (4) preparation of a product for real-time monitoring of dynamic changes of ATP in living cells; (5) in situ imaging of ATP in living cells; (6) preparation of a product for in situ imaging of ATP in living cells.

[0051] In some embodiments of the present invention, the detection of ATP includes the detection of extracellular ATP or intracellular (including mitochondrial) ATP.

[0052] In some embodiments of the present invention, the product includes, but is not limited to, reagents, kits, or analytical devices.

[0053] In some embodiments of the present invention, the cells include oocytes, cancer cells (such as MCF-7, HeLa), MCF-10A cells, etc.

[0054] The nucleic acid probe provided by this invention can monitor the dynamic changes of mitochondrial ATP in real time in a non-invasive manner, which can provide a basis for personalized reproductive intervention strategies. After evaluation, oocytes can be directly used for transplantation or culture, which is especially suitable for maintaining and improving fertility in people with poor oocyte quality, such as older women.

[0055] A fourth aspect of the present invention provides a reagent, kit, or analytical apparatus comprising the nucleic acid probe described in the first aspect of the present invention.

[0056] In some embodiments of the present invention, the reagent, kit, or analytical device has any of the following functions: qualitative or quantitative detection of ATP; real-time monitoring of dynamic changes in ATP within living cells; and in situ imaging of ATP within living cells.

[0057] A fifth aspect of the present invention is a method for detecting ATP, comprising the step of processing a sample to be tested using a nucleic acid probe of the first aspect of the present invention or a reagent, kit, or analytical device of the fourth aspect of the present invention.

[0058] In some embodiments of the present invention, the method specifically includes the following steps: mixing the nucleic acid probe with the sample to be tested, incubating, and observing the electrophoretic properties of the reaction product using polypropylene gel electrophoresis or measuring the fluorescence intensity using a fluorescence spectrophotometer.

[0059] In some embodiments of the present invention, the incubation conditions are: incubation at 35-40°C for 1-4 hours; further, incubation at 35-38°C for 2-3 hours; and even further, incubation at 36-38°C for 2-3 hours.

[0060] In some embodiments of the present invention, the sample to be tested also contains an RNA sequence, which may be identical to the RNA in the Reporter chain in the first aspect of the present invention.

[0061] In some embodiments of the present invention, when it is necessary to quantify ATP, a standard curve is constructed using ATP of known concentration, and the ATP content in the sample to be tested is calculated using the standard curve.

[0062] In some embodiments of the present invention, it is necessary to detect ATP in the mitochondria of living cells. In this case, the nucleic acid probe of the first aspect of the present invention is mixed with living cells, incubated, mitochondrial colocalization dye is added, and incubated again. The fluorescence intensity in the cells is then observed under an inverted confocal laser microscope.

[0063] In some embodiments of the present invention, the incubation conditions are: incubation at 35-40°C for 2-5 hours; further, incubation at 35-38°C for 2-3 hours; and even further, incubation at 36-38°C for 2-3 hours.

[0064] In some embodiments of the present invention, the final concentration of the mitochondrial colocalization dye in the reaction system is 80–120 nM; further, 90–110 nM; and even further, 100–110 nM.

[0065] In some embodiments of the present invention, the conditions for the second incubation are: incubation at 35-40°C for 10-30 min; further, incubation at 35-38°C for 10-20 min; and even further, incubation at 36-38°C for 10-15 min.

[0066] The beneficial effects of this invention are: This invention provides a nucleic acid probe based on a site-triggered cascade nucleic acid reaction using DNA tetrahedral delivery, enabling highly sensitive and rapid detection of mitochondrial ATP in live oocytes. This nucleic acid probe exhibits structural stability and high specificity, accurately distinguishing between similar 12S rRNA and ATP analogs (such as CTP, GTP, and UTP), significantly reducing false-positive signals and ensuring reliable detection results. This nucleic acid probe achieves in situ ATP imaging at the mitochondrial level, facilitating in-depth assessment of oocyte energy status and providing key indicators for evaluating declining oocyte quality and embryonic developmental potential in older women, thus having a positive impact on improving assisted reproductive outcomes.

[0067] The method provided by this invention is non-destructive to living cells, simple to operate, has good biocompatibility, low toxicity, and the reaction time can be shortened to 1.5 hours. The imaged oocytes retain normal activity and function and can be directly used in subsequent assisted reproductive procedures such as in vitro fertilization (IVF), demonstrating good clinical applicability. It has a wide detection linear range and a detection limit as low as 9 μM, suitable for the quantitative analysis of trace amounts of ATP. The entire detection process does not require cell lysis or fixation, maintaining the integrity of the oocytes to the greatest extent and not affecting their subsequent reproductive applications. Attached Figure Description

[0068] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 This is a schematic diagram of the nucleic acid probe and its detection based on the site-triggered cascade nucleic acid reaction of the present invention, which is delivered by DNA tetrahedron.

[0069] Figure 2The polypropylene gel electrophoresis results for DNA tetrahedral (TDN) synthesis are shown in the figure. From left to right, lane 1: Marker; lane 2: T1; lane 3: T2; lane 4: T3; lane 5: T4; lane 6: T1+T2; lane 7: T1+T2+T3; lane 8: T1+T2+T3+T4.

[0070] Figure 3 This is a comparison chart of particle sizes for TDN and TDN-LMT.

[0071] Figure 4 Comparison of atomic force microscopy images of TDN (A) and TDN-LMT (B).

[0072] Figure 5 The electrophoretic verification results for the feasibility of the nucleic acid probe of this invention in detecting ATP are shown in the figure. From left to right, lane 1: Marker; lane 2: linker; lane 3: reporter; lane 4: TR; lane 5: 12S rRNA; lane 6: linker + reporter; lane 7: LMT nanosystem; lane 8: LMT + 12S rRNA; lane 9: LMT + 12S rRNA + ATP; lane 10: Linker + ATP; lane 11: 12S rRNA + TR; lane 12: 12S rRNA + rRNA mimic.

[0073] Figure 6 The results show the fluorescence verification of the feasibility of the nucleic acid probe of this invention in detecting ATP; where A is the fluorescence intensity and B is a comparison of fluorescence bar graphs.

[0074] Figure 7 The fluorescence intensity changes and standard curves for different ATP concentrations in the LMT (A) and TDN-LMT (B) reaction systems are shown in Figure (C).

[0075] Figure 8 The graph shows the specificity verification results of the nucleic acid probe TDN-LMT; where A is a comparison of 12S rRNA mismatch fluorescence bar graphs; and B is a comparison of ATP mismatch fluorescence bar graphs.

[0076] Figure 9 The results are from the cytotoxicity assay of the nucleic acid probe TDN-LMT.

[0077] Figure 10 CLSM images of HeLa cells treated under different conditions, from top to bottom: nucleic acid probe LMT, nucleic acid probe TDN-LMT, and nucleic acid probe TPP-TDN-LMT. The scale bar in the image is 20 μm.

[0078] Figure 11The images show CLSM images of MCF-10A cells, MCF-7 cells, and HeLa cells after co-incubation with the nucleic acid probe TPP-TDN-LMT for 3 h. The scale bar in the images is 20 μm.

[0079] Figure 12 CLSM images of young and old oocytes (OLD) after co-incubation with TPP-TDN-LMT for 3 h. The scale bar in the image is 50 μm.

[0080] Figure 13 To quantify ATP expression in young and old oocytes using fluorescence methods. Detailed Implementation

[0081] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0082] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0083] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0084] Example 1: Synthesis and Validation of DNA Tetrahedron (TDN), LMT, TDN-LMT, and TPP-TDN-LMT (1) Synthesis of TDN, LMT, TDN-LMT and TPP-TDN-LMT The single-chain T1, T2, T3, T4, linker, TR and Reporter were prepared to a final concentration of 10 μM.

[0085] Preparation of DNA tetrahedrons (TDN): Single-stranded T1, T2, T3, T4, linker, TR, and reporter strands were prepared to a final concentration of 10 μM. 1 μL of each of T1, T2, T3, and T4 was mixed, and Mg was added. 2+ TDN was prepared by adjusting the volume to 20 μL with 10 mM Tris-HCl (0.1 M) and rapidly cooling to 18 °C for 30 min after incubation at 95 °C for 5 min.

[0086] Preparation of LMT (Locked Mediating Toehold): Take 1 μL each of the linker and reporter chains and add Mg 2+ The volume was adjusted to 19 μL with 10 mM Tris-HCl (0.1 M), the temperature was rapidly reduced from 95 °C for 5 min to 18 °C for 30 min, and then 1 μL TR was added. The reaction was carried out at 25 °C for 1 h to obtain LMT.

[0087] Preparation of TDN-LMT: The prepared TDN and LMT were mixed at a concentration ratio of 1:3, and Mg was added. 2+ TDN-LMT was prepared by incubating TDN-LMT with Tris-HCl (10 mM) and Tris-HCl (0.1 M) at 25 °C for 1 h.

[0088] Preparation of TPP-TDN: A (3-azidopropyl)triphenylphosphine solution prepared with pure water was added to a DBCO-modified T3 chain at a concentration ratio of 10:1 and mixed at room temperature for 30 min to obtain TPP-T3. Then, equal concentrations of T1, T2, TPP-T3, and T4 (all 340 nM) were added to Mg... 2+ TPP-TDN was prepared by adjusting the volume to 20 μL with 10 mM Tris-HCl (0.1 M).

[0089] Preparation of mitochondrial site-triggered nucleic acid probe based on DNA tetrahedral delivery (TPP-TDN-LMT): TPP-TDN and LMT were mixed at a concentration ratio of 1:3 and incubated at 25°C for 1 h to obtain TPP-TDN-LMT.

[0090] The nucleotide sequences of the single-stranded T1, T2, T3, T4, linker, TR, and Reporter strands are as follows: T1: 5'-CCCAGGTTCTCTTTTTTTTTAAT ACATTCCTAAGTCTGAA AC ATTACAGCTTGCTACAC GA GAAG AGCCGCCATAGTA -3' (SEQ ID NO:1).

[0091] T2: 5'-CCCAGGTTCTCTTTTTTTTTAATT ATCACCAGGCAGTTGA CA GTGTAGCAAGC TGTAAT AG ATGCGAGGGTCCAATAC -5' (SEQ ID NO:2).

[0092] T3: 5'-TTA TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATC TACTATGGCGGCTCTTC -3' (SEQ ID NO:3), the 5' end is modified with DBCO (dibenzocyclooctylene).

[0093] T4: 5'-CCCAGGTTCTCTTTTTTTTTTTA TTCAGACTTAGGAATGT GCTTCCCACGTAGTGTCGT TTGTAT TGGACCCTCGCAT -3' (SEQ ID NO:4).

[0094] In the four sequences T1 to T4 mentioned above, the single-underlined portion in T1 and the single-underlined portion in T4 are opposite complementary sequences; the double-underlined portion in T1 and the double-underlined portion in T2 are opposite complementary sequences; the italicized portion in T1 and the italicized portion in T3 are opposite complementary sequences; the italicized portion containing an underline in T2 and the italicized portion containing an underline in T3 are opposite complementary sequences; the wavy underlined portion in T2 and the wavy underlined portion in T4 are opposite complementary sequences; and the bolded portion in T3 and the bolded portion in T4 are opposite complementary sequences.

[0095] Linker (used to identify ATP): 5'-AAAAAAAGAGAACCTGG GGGC / iBHQ2dT / ACGA ACCTGGGGGAG TATTGCGGAGGAAGGT AAGCATCCCCG-3' (SEQ ID NO:5). The underlined portion is the Reporter complementary region, and the italicized portion is the ATP aptamer sequence.

[0096] TR (used to recognize 12S rRNA): 5'- CTCACTGGAA CGGGGATGCTTACCTTC-3' (SEQ ID NO:6). The double-underlined part is the 12S rRNA recognition toehold region, and the bolded part is inversely complementary to the bolded part in the linker.

[0097] Reporter (12s rRNA mimic): 5'-AAGCATCCCCG CAGCG CCAGGTTCG / iCy3dT / AGCC CGCTG TTCCAGTGAG-3'SEQ ID NO:7). The bolded portion consists of two 12S rRNA mimic segments (combining to form a 12S rRNA), with their 3' ends being inversely complementary to the double-underlined portion of the TR sequence. The single-underlined portion is inversely complementary to the single-underlined portion of the linker. The italicized portions are complementary, forming a hairpin structure.

[0098] The above design principle of mitochondrial site-triggered nucleic acid probes based on DNA tetrahedral transport ( Figure 1 The TPP-TDN-LMT is composed of three combined double-stranded LMTs and a DNA tetrahedral TDN. The combined double-stranded LMT is formed by hybridization of a linker strand, a single-stranded TR, and a hairpin reporter containing a 12S rRNA mimic. The loop portion of the hairpin reporter is complementary to a portion of the linker sequence, and the 3' end portion of the TR is complementary to the linker sequence, leaving a toehold for 12S rRNA-specific recognition. The middle portion of the linker strand blocks the aptamer sequence recognized by ATP. The loop portion of the reporter is labeled with the fluorescent group cy3, and the linker is labeled with BHQ2. After the linker and reporter hybridize to form a double strand, the cy3 fluorescence is quenched. The DNA tetrahedral TDN is formed by hybridization of four single-stranded probes T1, T2, T3, and T4. The combined double-stranded LMT is assembled at the 3' end of the three tetrahedral strands through the 5' end of the linker strand. The remaining tetrahedral strand is modified with TPP. DNA tetrahedrons not only serve to transfect nucleic acids into mitochondria but also fix the distances and positions between the three combined strands of the LMT, increasing the local concentration of reactants. In the absence of 12S rRNA and ATP, the LMTs on the DNA tetrahedron are stable and do not react with each other. In the presence of 12S rRNA, it hybridizes with the TR on the LMT through toehold substitution to form a more stable double strand, displacing the 3' end of the linker. Then, in the absence of ATP, no further reaction occurs; in the presence of ATP, ATP binds to the aptamer on the linker to form a hairpin structure, simultaneously displacing the reporter strand to form a 12S rRNA mimic, leading to the recovery of cy3 fluorescence on the reporter. The single strand of the 12S rRNA mimic can further hybridize with the TR of the adjacent LMT through toehold substitution to form a stable double strand and displacing the 3' end of the linker. It then further reacts with ATP to release a fluorescent signal. This process repeats continuously, resulting in the recovery of cy3 fluorescence on a large number of reporters, enabling the detection of ATP. Since the reactant LMT is fixed on the DNA tetrahedron, the displaced 12S rRNA mimic single strand can react rapidly with the neighboring LMT, resulting in a fast response and high sensitivity.

[0099] (2) Polypropylene gel electrophoresis to verify the synthesis of TDN and LMT The synthesized probes TDN and the cascaded toehold chain substitution amplification system LMT without TDN, along with their single strands, were prepared under the same conditions. The amplification was performed using a 12% polypropylene gel at 220V for 0.5 h. The synthesis of TDN and LMT was then assessed by comparing the brightness and dispersion of single strands and composite chains (e.g., T1+T2, T1+T2+T3). LMT and TDN-LMT were characterized by particle size distribution and atomic force microscopy, respectively.

[0100] Single chains of T1, T2, T3, and T4 were prepared to a final concentration of 500 nM. Then, T1+T2, T1+T2+T3, and TDN were prepared and added to Mg. 2+ The volume was adjusted to 100 μL with 30 mM Tris-HCl (0.1 M) and rapidly cooled to 4 °C after 5 min at 95 °C. The synthesis of tetrahedra was determined by comparing the brightness and dispersion of single and complex chains using 12% polypropylene gel electrophoresis. Figure 2 As shown: the single chains are relatively clear, while the synthesized double chains are significantly thicker and brighter. Tetrahedral TDN shows obvious diffuse bright bands, which are relatively bright aggregates due to their heavy molecular weight.

[0101] LMT and TDN-LMT were characterized by particle size and atomic force microscopy, respectively. Figure 3 and Figure 4 As shown.

[0102] Example 2 A method for ATP detection based on TDN-LMT includes the following steps: TDN-LMT (the final concentration of TDN-LMT is 500 nM if polyacrylamide gel electrophoresis is used as the detection method, and 100 nM if a fluorescence spectrophotometer is used as the detection method) was mixed with the test sample (containing 12S rRNA with a final concentration of 50 nM and different concentrations of ATP) and incubated at 37°C for 2 h. The electrophoresis of the reaction products was observed by 12% polyacrylamide gel electrophoresis (non-denaturing PAGE electrophoresis at 220 V); or the fluorescence intensity was measured by a fluorescence spectrophotometer (fluorescence measurement was set at 540 nm excitation, and the obtained spectrum was recorded between 555 nm and 650 nm, with an excitation / emission slit width of 5 nm).

[0103] Example 3: In vitro experiments of cascaded proximity amplification reaction based on DNA tetrahedral transport This embodiment examines the feasibility, sensitivity, and specificity of cascaded proximity amplification reaction based on DNA tetrahedral transport (i.e., the method of Example 2) in detecting ATP.

[0104] (1) Feasibility of the polypropylene gel electrophoresis method Based on the designed detection principle, 500 nM single-stranded linker, 12S rRNA (5'-AAGCATCCCCGTTCCAGTGAG-3' (SEQ ID NO:8)), TR, and LMT (prepared in Example 1) were prepared respectively. LMT (final concentration 100 nM) was mixed with and without 12S rRNA (final concentration 50 nM) and ATP (final concentration 5 mM), and incubated at 37°C for 2 h. The electrophoretic behavior of the reaction products was observed by 12% polypropylene gel electrophoresis (non-denaturing PAGE electrophoresis at 220V) to verify whether the chain reaction and amplification were feasible.

[0105] The results are as follows Figure 5 As shown, lanes 2, 3, 4, and 5 all show relatively bright single bands, indicating that the single strands are pure and free of impurities. Lane 6 shows that the band shifts upward after the linker + reporter (i.e., the linker and reporter are mixed, reacted at 95℃ for 5 minutes, and then rapidly cooled to 4℃) binds. Lane 7 shows that LMT was successfully synthesized without any extra impurities, and that LMT does not change in the absence of 12S rRNA and ATP. Lane 8 produced a new band, thus proving that a strand displacement reaction occurred in the presence of 12S rRNA, but due to the absence of ATP, there was no product of ATP and aptamer. Lane 9 shows that in the presence of 12S rRNA and ATP, 12S rRNA initiates a strand displacement reaction, followed by ATP binding to the aptamer sequence to generate the product, thus proving that cascade exponential amplification can occur and the reaction is relatively complete.

[0106] (2) Feasibility of the fluorescence verification method LMT (100 nM) and TDN-LMT (100 nM) labeled with the fluorescent group cy3 and the quencher group BHQ2, respectively, were incubated at 37 °C for 2 h with or without 12S rRNA (50 nM) or ATP (5 mM). The fluorescence of the reaction solution was then measured by excitation at 540 nm, and the resulting spectra were recorded between 555 and 650 nm. The excitation / emission slit width was 5 nm, and the fluorescence intensity was detected to verify the occurrence of strand displacement and amplification reactions.

[0107] The results are as follows Figure 6As shown, both LMT and TDN-LMT exhibited relatively weak fluorescence in the absence of both 12S rRNA and ATP. When LMT reacted with 12S rRNA, fluorescence showed almost no increase, indicating that the signal strand was not displaced in the absence of ATP. In the presence of only ATP, LMT fluorescence showed only a slight increase, indicating that the strand displacement reaction hardly occurred in the absence of 12S rRNA. When both 12S rRNA and ATP were present in LMT, the fluorescence intensity increased, indicating that 12S rRNA triggered strand displacement and, in the presence of ATP, achieved cascade signal amplification, resulting in simple linear amplification. In contrast, TDN-LMT showed the highest fluorescence in the presence of both 12S rRNA and ATP, indicating a faster reaction and more pronounced signal amplification. These data demonstrate that the cascade proximity amplification reaction of DNA tetrahedral transport is feasible and has a faster and more efficient amplification rate than the ordinary Toehold strand displacement LMT reaction.

[0108] (3) Sensitivity assessment of the method LMT and TDN-LMT, labeled with the fluorescent group Cy3 and the quencher group BHQ2 respectively, were prepared. A series of test solutions with different ATP concentrations (0–10 mM, containing 50 nM of 12S rRNA) were prepared for each solution. Then, the reaction solution was prepared: LMT or TDN-LMT (final concentration 100 nM), Mg... 2+ The final concentration of 10 mM ATP solution was adjusted to 100 μL with Tris-HCl buffer (final concentration 0.1 M). The mixture was incubated at 37 °C for 2 h. Fluorescence measurements of the reaction solution were performed with excitation at 540 nm, and the resulting spectra were recorded between 555 nm and 650 nm. The excitation / emission slit width was 5 nm. The fluorescence intensity of Cy3 was measured using a fluorescence spectrophotometer. Standard curves were plotted using different ATP concentrations and their corresponding Cy3 fluorescence intensities.

[0109] Standard curves were plotted using different ATP concentrations and corresponding cy3 fluorescence intensities. Figure 7 In both systems, the fluorescence intensity increased with increasing ATP concentration. ATP in the LMT reaction system ( Figure 7 The fitting equation for (A, C) is: Y = 127.16 + 37.46 (R² + π²) / 2.5. 2 =0.993), the detection limit is 90 μM, and the fitting equation for the TDN-LMT reaction system is: Y = 88.40X + 33.12 (R² = 0.993). 2 =0.997), and the detection limit is 9 μM ( Figure 7 (For B and C), the detection limit is reduced by 10 times compared to LMT, demonstrating good detection sensitivity.

[0110] (4) Specificity assessment of the method TDN-LMT labeled with the fluorescent group cy3 and the quencher group BHQ2 was incubated at 37°C for 2 h under conditions with and without 12S rRNA, with and without mismatched or irrelevant 12S rRNA, and with and without ATP and its analogues CTP, GTP, and UTP. The fluorescence of the reaction solution was measured with excitation at 540 nm, and the resulting spectra were recorded between 555 nm and 650 nm. The excitation / emission slit width was 5 nm, and the fluorescence intensity changes were observed using a fluorescence spectrophotometer to assess the specificity of the reaction.

[0111] The nucleotide sequences of the above-mentioned 12S rRNA containing mismatched bases or irrelevant bases (the bolded parts in the sequence represent mismatched bases) are as follows: Mis1-12s rRNA: 5'-AAGCATCCCCGTTCCACTGAG -3' (SEQ ID NO:9); Mis2-12srRNA: 5'-AAGCAACCCCGTTCCAGTGAG -3' (SEQ ID NO:10); Mis3-12s rRNA: 5'-AAGCATCCGCGTTCCAGTGAG -3' (SEQ ID NO:11); 18s rRNA: 5'-GTCGTAGTTCCGACCATAAAC-3' (SEQ ID NO: 12).

[0112] The results are as follows Figure 8 As shown, strong fluorescence can only be generated when both 12S rRNA and ATP are present. Fluorescence generated by blank, mismatched strand, irrelevant strand and analogue is very weak, indicating that the TDN-LMT-based method has high specificity.

[0113] Example 4 Cytotoxicity of TPP-TDN-LMT MCF-7 (human breast cancer cells), MCF-10A (human breast epithelial cells), and HeLa (cervical cancer cells) cells were seeded in 96-well plates, approximately 6000 cells per well. After overnight incubation, different concentrations (0, 25, 50, 100, 150, 200 nM) of TPP-TDN-LMT were added, and the cells were incubated at 37°C for 24 h. The culture medium was then discarded, and 100 μL of 10% MTT solution was added. After incubation at 37°C for 24 h, the MTT solution was discarded, and 100 μL of DMSO was added. The cells were shaken for 10 min, and the absorbance at 490 nm was measured. Cell viability was calculated using the following formula: Cell viability = (A... 实验组 / A 空白组的平均值（空白） ) × 100%.

[0114] The results are as follows Figure 9As shown, the activity of normal breast epithelial cells MCF-10A, breast cancer cells MCF-7, and cervical cancer cells HeLa treated with TDN-LMT was all above 90%, which proves that TDN-LMT has good biocompatibility.

[0115] Example 5: Verification of site-specific triggering of ATP imaging reaction by tetrahedral transport of DNA in living cells. Given the excellent transport properties of tetrahedral DNA (TDN), this embodiment evaluates the transport efficiency of the self-assembled tetrahedral DNA reaction system in living cells and the feasibility of the amplification reaction. Three identical HeLa cells were used: the first group was treated with LMT, the second with TDN-LMT, and the third with TPP-TDN-LMT. The cells were then incubated at 37°C for 3 h. 100 nM of the mitochondrial colocalization dye Mito tracker (MitoTrackerrm Deep Red FM, Thermo Fisher Scientific, USA, M22426) was added, and the cells were incubated at 37°C for 15 min. The intracellular cy3 fluorescence intensity was observed using an inverted confocal laser microscope, and the intracellular location of cy3 fluorescence was determined to verify whether the reaction system was transferred into the mitochondria and to enable ATP detection.

[0116] The results are as follows Figure 10 As shown, fluorescence was only observed in the TDN-LMT and TPP-TDN-LMT reaction systems when DNA tetrahedron (TDN) was present. The TDN-LMT system, lacking mitochondrial targeting, exhibited weak mitochondrial localization, resulting in weaker fluorescence. Specifically, the TPP-TDN-LMT reaction system, with TPP attached, showed a strong fluorescence signal localized within the mitochondria; the LMT reaction system showed almost no fluorescence, indicating that TDN has the function of transporting nucleic acid chains and can only achieve detection within the mitochondria.

[0117] Example 6 A method for live-cell mitochondrial ATP imaging (site-triggered ATP imaging of live-cell DNA tetrahedral transport) includes the following steps: Cells (such as cancer cells MCF-7, HeLa, normal cells MCF-10A, oocytes, etc.) were mixed at a density of 10 × 10⁶ cells. 4 cells / cm 2 Seeds were placed in 20 mm confocal dishes, mixed with TPP-TDN-LMT or TDN-LMT (final concentration 100 nM), and incubated at 37 °C for 3 h; 100 nM mitochondrial colocalization dye Mito tracker was added, and the mixture was incubated at 37 °C for 15 min; the intracellular cy3 fluorescence intensity was observed using an inverted confocal laser microscope.

[0118] Example 7: In situ imaging of ATP in mitochondria of live cells This implementation is used to verify the feasibility of the method of Example 6 for in situ imaging of ATP in mitochondria in different types of cells.

[0119] After verifying the feasibility of the method in Example 6 for detecting ATP in mitochondria (Example 5), the method was further used to detect the difference in ATP content between relevant cancer cells and normal cells, as follows: Cancer cells MCF-7 and HeLa, and normal cells MCF-10A were selected respectively. The cultured cancer cells and normal cells were plated (cell mixing density was 10 × 10⁻⁶). 4 cells / cm 2 The cells were seeded in 20 mm confocal dishes. TPP-TDN-LMT (final concentration of 100 nM) was mixed with the cells and incubated at 37 °C for 3 h. Then, 100 nM of mitochondrial colocalization dye Mito tracker was added to each group of cells and incubated at 37 °C for 15 min. The fluorescence intensity of cy3 in the three groups of cells was observed by inverted confocal microscope to verify that it can distinguish different types of cells.

[0120] The results are as follows Figure 11 As shown, the fluorescence emitted by normal human breast cells MCF-10A under the action of TPP-TDN-LMT is very weak, while cancer cells HeLa and MCF-7 have stronger fluorescence after treatment with the TPP-TDN-LMT system. These data prove that the expression of ATP in the mitochondria of various cells is different, and that the expression is lower in normal cells and higher in cancer cells.

[0121] Example 8: In situ imaging of ATP in oocyte mitochondria Three young female Kunming mice (8 weeks old) and three old female Kunming mice (9 months old) were injected intraperitoneally with 10 IU of pregnant mare serum gonadotropin (PMSG), followed by 10 IU of human chorionic gonadotropin (HCG) 48 h later. Sixteen h after HCG injection, the cumulated oocyte complex was flushed out of the oviduct ampulla. The oocytes of both types were transferred to M2 medium containing 0.1% hyaluronidase. The oocytes were washed with an oocyte retrieval needle to remove granulosa cells from the cell surface, and then transferred to M16 medium containing TPP-TDN-LMT (100 nM) (approximately 20 oocytes per group). The cells were incubated at 37°C for 3 h. 100 nM of mitochondrial colocalization dye Mito tracker was added to each group of cells, and the cells were incubated at 37°C for 15 min. The fluorescence intensity of cy3 in the three groups of cells was observed by inverted confocal microscopy to verify the accuracy of ATP detection in mitochondria and determine its content in mitochondria. The results are as follows Figure 12 As shown, young oocytes emitted significant fluorescence after treatment with TPP-TDN-LMT, while older oocytes showed weaker fluorescence. These data demonstrate that ATP expression differs in the mitochondria of oocytes at different ages, with lower expression in older oocytes and higher expression in younger oocytes. These results are consistent with the trend results of the ATP fluorescence quantitative kit (enhanced ATP detection kit, Beyotime Biotechnology Co., Ltd., China, S0027). Figure 13 This indicates that the present invention, using TPP-TDN-LMT, can accurately detect ATP in cellular mitochondria, and the method is simpler (it does not require cell lysis like quantitative kits).

[0122] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. A nucleic acid probe comprising a DNA tetrahedron and three double-stranded LMTs, wherein the double-stranded LMTs are modified on any three strands of the DNA tetrahedron; The DNA tetrahedron is composed of 4 DNA single strands. The ends of the DNA single strands are free sequences, which are located at the four vertices of the DNA tetrahedron. One end of the free sequence is fixed to a vertex of the DNA tetrahedron, and the outer end extends beyond the vertex of the DNA tetrahedron. The dual-chain LMT consists of a TR single chain, a connecting chain, and a Reporter chain; The 3' end of the TR single chain is complementary to the 3' end portion of the connecting chain sequence; The 5' end of the TR single chain is complementary to the 3' end of the Reporter chain. The partial sequence of the connecting chain is complementary to a partial sequence of the Reporter chain; The 5' end of the connecting strand binds complementary to the free sequences of any three DNA single strands of the DNA tetrahedron; The linker chain contains an ATP aptamer sequence.

2. The nucleic acid probe according to claim 1, characterized in that, The Reporter strand contains an RNA segment at both ends, which is either rRNA or miRNA that exists only in the mitochondria of the cell; Preferably, the Reporter chain can form a hairpin structure; Preferably, the loop portion of the hairpin structure is complementary to a portion of the connecting chain sequence; Preferably, the ring portion of the hairpin structure is marked with a fluorescent group.

3. The nucleic acid probe according to claim 2, characterized in that, The 5' end of the TR single strand includes a toehold region for recognizing the RNA; and / or, the portion of the linker strand that binds complementary to the Reporter strand is labeled with a fluorescence quenching group.

4. The nucleic acid probe according to any one of claims 1 to 3, characterized in that, The nucleotide sequences of the four single strands of DNA in the DNA tetrahedron are shown in SEQ ID NO:1-4; and / or, the nucleotide sequences of the ATP aptamer are shown in SEQ ID NO:

13.

5. The nucleic acid probe according to any one of claims 1 to 3, characterized in that, The nucleotide sequence of the TR single strand is shown in SEQ ID NO:6; and / or, the nucleotide sequence of the linker strand is shown in SEQ ID NO:5; and / or, the nucleotide sequence of the Reporter strand is shown in SEQ ID NO:

7.

6. The nucleic acid probe according to any one of claims 1 to 3, characterized in that, The nucleic acid probe is also modified with substances that target mitochondria; Preferably, the substance targeting mitochondria includes triphenylphosphine; Preferably, the mitochondrial-targeting substance modifies the free sequence of the DNA tetrahedron; the mitochondrial-targeting substance and the double-stranded LMT are modified on different free sequences; Preferably, the free sequence of the DNA tetrahedron modified with the mitochondrial-targeting substance is modified with DBCO.

7. A method for preparing a nucleic acid probe according to any one of claims 1 to 6, comprising the following steps: Mix DNA tetrahedrons and double-stranded LMT in a solution containing Mg 2+ The reaction is carried out in a buffer solution to obtain a nucleic acid probe. Preferably, when the nucleic acid probe is modified with a mitochondrial-targeting substance, the mitochondrial-targeting substance is first mixed with one single strand of DNA tetrahedron, and the reaction is carried out to modify the DNA single strand with the mitochondrial-targeting substance, thereby forming a DNA tetrahedron. Then, it is mixed with LMT in a solution containing Mg. 2+ The reaction is carried out in a buffer solution to obtain a nucleic acid probe.

8. The use of the nucleic acid probe according to any one of claims 1 to 6 in any one of (1) to (6): (1) Qualitative or quantitative detection of ATP; (2) Prepare products for qualitative or quantitative detection of ATP; (3) Real-time monitoring of dynamic changes in ATP within living cells; (4) Prepare products for real-time monitoring of dynamic changes in ATP in living cells; (5) In situ imaging of ATP in living cells; (6) Prepare products for in situ imaging of ATP in living cells.

9. A reagent, kit, or analytical apparatus comprising the nucleic acid probe according to any one of claims 1 to 6; Preferably, the reagent, kit, or analytical device has any of the following functions: qualitative or quantitative detection of ATP; real-time monitoring of dynamic changes in ATP within living cells; and in-situ imaging of ATP within living cells.

10. A method for detecting ATP, comprising the step of processing a sample to be tested using a nucleic acid probe according to any one of claims 1 to 6 or a reagent, kit, or analytical device according to claim 9; Preferably, the method specifically includes the following steps: Mix the nucleic acid probe with the sample to be tested, incubate, and observe the electrophoresis of the reaction product using polypropylene gel electrophoresis or measure the fluorescence intensity using a fluorescence spectrophotometer. Preferably, if it is necessary to detect ATP in the mitochondria of living cells, the nucleic acid probe described in claim 6 is mixed with living cells, incubated, mitochondrial colocalization dye is added, incubated again, and the fluorescence intensity in the cells is observed under an inverted confocal laser microscope.

Images