Composite material, preparation method of composite material, thin film and photoelectric device

Abstract

The invention discloses a composite material, a preparation method of the composite material, a thin film and a photoelectric device, the composite material comprises tobacco mosaic virus and metal nanoparticles, and the metal nanoparticles are combined with coat protein of the tobacco mosaic virus. Part of peptide chains in the coat protein of the tobacco mosaic virus and different types of metal nanoparticles have special binding energy, so that the metal nanoparticles can be orderly assembled on the coat protein of the tobacco mosaic virus, the problem that the metal nanoparticles are easy to agglomerate is effectively improved, and the composite material can be applied to photoelectric devices and has good application prospects. The photoelectric performance and the service life of the photoelectric device can be improved.

Description

Technical Field

[0001] This application relates to the field of optoelectronic technology, specifically to a composite material, a method for preparing the composite material, a thin film, and an optoelectronic device. Background Technology

[0002] Metal nanoparticles, with their small size, high specific surface area, high reactivity, and unique photoelectric and thermal properties, have been widely used in optoelectronics, catalysis, medicine, and environmental protection. The morphology and size of metal nanoparticles are important factors influencing their performance and applications.

[0003] Metal nanoparticles are prone to agglomeration, which can lead to uneven film formation in practical applications. Summary of the Invention

[0004] In view of the shortcomings of the prior art, this application provides a composite material, a method for preparing the composite material, a thin film, and an optoelectronic device.

[0005] In a first aspect, this application provides a composite material comprising tobacco mosaic virus and metal nanoparticles, wherein the metal nanoparticles are bound to the outer shell protein of the tobacco mosaic virus.

[0006] Secondly, this application provides a method for preparing a composite material, comprising the steps of: providing tobacco mosaic virus and metal nanoparticles, mixing the tobacco mosaic virus, the metal nanoparticles and a first dispersion medium to obtain the composite material.

[0007] Thirdly, this application provides a thin film, the material of which includes the composite material as described in the first aspect, or the composite material prepared by the method described in the second aspect.

[0008] Fourthly, this application provides an optoelectronic device, comprising:

[0009] The anode and cathode are arranged opposite each other; and

[0010] An electronic functional layer is disposed between the anode and the cathode;

[0011] The material of the electronic functional layer includes the composite material as described in the first aspect, or the composite material prepared by the method described in the second aspect.

[0012] This application provides a composite material, a method for preparing the composite material, a thin film, and an optoelectronic device, which have the following technical advantages:

[0013] The composite material provided in this application utilizes tobacco mosaic virus with a nanorod structure as a self-assembling biological template for metal nanoparticles. Based on the high specific surface area and nanorod structure of tobacco mosaic virus, and the special binding energy between some peptide chains in the outer shell protein of tobacco mosaic virus and different types of metal nanoparticles, the metal nanoparticles can be orderly assembled on the outer shell protein of tobacco mosaic virus, effectively improving the problem of easy aggregation of metal nanoparticles. Attached Figure Description

[0014] The technical solution and other beneficial effects of this application will become apparent from the following detailed description of specific embodiments in conjunction with the accompanying drawings.

[0015] Figure 1 This is a schematic diagram of the structure of an optoelectronic device provided in an embodiment of this application. Detailed Implementation

[0016] The technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of this application, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of this application without creative effort are within the scope of protection of this application.

[0017] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to this invention. The preferred embodiments and materials described herein are for illustrative purposes only and do not limit the scope of this application.

[0018] It should be noted that the order of description of the following embodiments is not intended to limit the preferred order of embodiments. Various embodiments of this application may exist in the form of a range; it should be understood that the description in the form of a range is merely for convenience and brevity and should not be construed as a rigid limitation on the scope of the invention; therefore, it should be considered that the range description has specifically disclosed all possible sub-ranges and single numerical values ​​within that range. For example, it should be considered that the range description from 1 to 6 has specifically disclosed sub-ranges, such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., and single numbers within the range, such as 1, 2, 3, 4, 5, and 6, regardless of the range. Furthermore, whenever a numerical range is indicated herein, it means including any referenced number (fraction or integer) within the indicated range.

[0019] In the description of this application, the term "comprising" means "including but not limited to".

[0020] The term "at least one" refers to one or more items, while "multiple" or "multi-item" refers to two or more items. The terms "at least one," "at least one of the following," or similar expressions refer to any combination of these items, including any combination of single or multiple items. For example, "at least one of a, b, or c" or "at least one of a, b, and c" can be expressed as: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, and c can be single or multiple.

[0021] The term "and / or" encompasses any one of two or more of the listed items, as well as any and all combinations of the listed items. These combinations include any two listed items, any number of listed items, or a combination of all listed items. For example, "A and / or B" includes three parallel solutions: A, B, and A+B. Similarly, the technical solution "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (i.e., all connected by "logical OR"), any and all combinations of A, B, C, and D, including combinations of any two or three of A, B, C, and D, and combinations of all four of A, B, C, and D (i.e., all connected by "logical AND").

[0022] In this application, descriptions such as "layer A is formed on one side of layer B," "layer A is formed on the side of layer B away from layer C," or similar expressions can mean that layer A is directly formed on one side of layer B or on the side of layer B away from layer C, i.e., layer A and layer B are in direct contact; or they can mean that layer A is indirectly formed on one side of layer B or on the side of layer B away from layer C, i.e., other spacer structures can be formed between layer A and layer B. Similarly, "layer A is disposed on one side of layer B" or "layer A is disposed on the side of layer B away from layer C" can mean that layer A and layer B are in direct contact, or that other spacer structures are provided between layer A and layer B; "layer A is disposed between layer B and layer C" can mean that layer A and layer B are in direct contact and layer A and layer C are in direct contact, or layer A and layer B are in direct contact and one or more spacer structures are provided between layer A and layer C, or layer A and layer B are provided and one or more spacer structures are provided between layer A and layer C, or layer A and layer B are provided and layer A and layer C are in direct contact.

[0023] The term "average particle size" refers to the area-average particle size of a particle swarm. Area-average particle size is calculated by dividing the total volume of the particle swarm by its total area, which is the reciprocal of the surface area per unit volume. If an imaginary swarm of particles with uniform size is used to replace the original swarm, and the total volume and area of ​​this imaginary swarm are identical to the original swarm, then the diameter of this imaginary swarm is the area-average particle size of the original swarm. Area-average particle size can be obtained through statistical analysis, using transmission electron microscopy to statistically analyze the particle size of each particle in the swarm.

[0024] The term "tobacco mosaic virus" refers to a single-stranded RNA virus, abbreviated as TMV, which is the pathogen causing tobacco mosaic disease and other similar conditions. It specifically infects plants, especially tobacco and other Solanaceae plants, causing the infected leaves to appear mottled and stained. The virus particles of the tobacco mosaic virus are rod-shaped.

[0025] This application provides a composite material comprising tobacco mosaic virus and metal nanoparticles, wherein the metal nanoparticles are bound to the outer shell protein of the tobacco mosaic virus.

[0026] The composite material provided in this application uses tobacco mosaic virus with a nanorod structure as a self-assembling biological template for metal nanoparticles. Based on the high specific surface area and nanorod structure of tobacco mosaic virus, and the special binding energy between some peptide chains in the outer shell protein of tobacco mosaic virus and different types of metal nanoparticles, the metal nanoparticles can be orderly assembled on the outer shell protein of tobacco mosaic virus, effectively improving the problem of easy aggregation of metal nanoparticles.

[0027] In some embodiments of this application, the composite material is composed of tobacco mosaic virus and metal nanoparticles.

[0028] In some embodiments of this application, the tobacco mosaic virus is selected from TMV-U1.

[0029] In some embodiments of this application, the metal nanoparticles include one or more of gold nanoparticles, silver nanoparticles, and platinum nanoparticles. It should be noted that light of a specific wavelength can excite the localized surface plasmon resonance (LSPR) effect of the metal nanoparticles, generating hot electrons and thereby enhancing the electron injection and / or electron transport properties of the metal nanoparticles. Different types, sizes, and morphologies of metal nanoparticles may correspond to different excitation light. For example, gold nanoparticles can be excited by green light with a wavelength of 501 nm to 600 nm to exhibit the LSPR effect; silver nanoparticles can be excited by red light with a wavelength greater than 600 nm to exhibit the LSPR effect; and platinum nanoparticles can be excited by blue light with a wavelength of 450 nm to 500 nm to exhibit the LSPR effect.

[0030] To further improve the uniformity of self-assembly of metal nanoparticles in tobacco mosaic virus and to ensure that the metal nanoparticles effectively achieve LSPR under excitation of specific wavelength light to improve the conductivity of the composite material, in some embodiments of this application, the average particle size of the metal nanoparticles is 3nm to 50nm, for example, it can be 3nm, 5nm, 10nm, 20nm, 30nm, 40nm, 50nm or any two of the aforementioned values.

[0031] In some embodiments of this application, the composite material comprises 50%–80% metal nanoparticles and 20%–50% tobacco mosaic virus by mass percentage. The mass percentage of metal nanoparticles can be, for example, 50%, 60%, 70%, 80%, or any two of the aforementioned values, and the mass percentage of tobacco mosaic virus can be, for example, 20%, 30%, 40%, 50%, or any two of the aforementioned values. On the one hand, by adjusting the content of metal nanoparticles and tobacco mosaic virus in the composite material, the metal nanoparticles can be fully and orderly bound to the outer coat protein of the tobacco mosaic virus, improving the uniformity of the distribution of metal nanoparticles on the tobacco mosaic virus. On the other hand, controlling the density of metal nanoparticles in the composite material within a suitable range is beneficial for the metal nanoparticles to effectively achieve LSPR under excitation by light of a specific wavelength, further improving the conductivity of the composite material.

[0032] In some embodiments of this application, the genome of tobacco mosaic virus includes one or more of the first nucleotide sequence shown in SEQ.NO.1, the second nucleotide sequence shown in SEQ.NO.2, and the third nucleotide sequence shown in SEQ.NO.3, wherein the peptide chain encoded by the first nucleotide sequence, the peptide chain encoded by the second nucleotide sequence, and the peptide chain encoded by the third nucleotide sequence are respectively bound to metal nanoparticles.

[0033] Specifically, when the metal nanoparticles include gold nanoparticles and the genome of the tobacco mosaic virus includes the first nucleotide sequence shown in SEQ. NO. 1, the peptide chain encoded by the first nucleotide sequence binds to the gold nanoparticles. That is, the composite material containing gold nanoparticles and the tobacco mosaic virus can be excited by green light with a wavelength of 501 nm to 600 nm, exhibiting an LSPR effect. When the metal nanoparticles include silver nanoparticles and the genome of the tobacco mosaic virus includes the second nucleotide sequence shown in SEQ. NO. 2, the peptide chain encoded by the second nucleotide sequence binds to the silver nanoparticles. That is, the composite material containing silver nanoparticles and the tobacco mosaic virus can be excited by red light with a wavelength greater than 600 nm, exhibiting an LSPR effect. When the metal nanoparticles include platinum nanoparticles and the genome of the tobacco mosaic virus includes the third nucleotide sequence shown in SEQ. NO. 3, the peptide chain encoded by the third nucleotide sequence binds to the platinum nanoparticles. That is, the composite material containing platinum nanoparticles and the tobacco mosaic virus can be excited by blue light with a wavelength of 450 nm to 500 nm, exhibiting an LSPR effect.

[0034] The first nucleotide sequence (5' to 3') of SEQ. NO. 1 is: CAATCATCGCATGCATGCACCA, located at positions 2401–2422 of the TMV-U1 genome. The second nucleotide sequence (5' to 3') of SEQ. NO. 2 is: ACGCTGTTGGGGAGGTCACTA, located at positions 4798–4818 of the TMV-U1 genome. The third nucleotide sequence (5' to 3') of SEQ. NO. 3 is: GGCTCGAGATGTCTCTACAC, located at positions 5712–5731 of the TMV-U1 genome.

[0035] It should be noted that tobacco mosaic viruses with specific binding energies to certain metal nanoparticles can be obtained through biological screening methods, including the following steps:

[0036] S1. Provides a tobacco mosaic virus library and target molecules. The tobacco mosaic virus library includes a variety of tobacco mosaic viruses, and the target molecules include a metal nanoparticle.

[0037] S2. Using biopanilution technology, tobacco mosaic viruses that can specifically bind to target molecules are screened from a tobacco mosaic virus library.

[0038] S3. The tobacco mosaic virus obtained in step S2 is amplified to obtain a tobacco mosaic virus with a special binding energy to the metal nanoparticles.

[0039] In step S2, the tobacco mosaic virus library and target molecules are mixed and co-incubated for a period of time. Unbound tobacco mosaic viruses are then washed away, and the tobacco mosaic viruses specifically bound to the target molecules are eluted. These procedures can be performed using conventional biotechnological methods and will not be detailed here.

[0040] This application also provides a method for preparing a composite material, which can be used to prepare any of the composite materials described above. The method for preparing the composite material includes the steps of: providing tobacco mosaic virus and metal nanoparticles, mixing the tobacco mosaic virus, metal nanoparticles and a first dispersion medium to obtain the composite material. The tobacco mosaic virus and metal nanoparticles are described above.

[0041] In some embodiments of this application, the first dispersion medium includes a C1 to C10 fatty alcohol compound, the number of carbon atoms in the fatty alcohol compound may be, for example, 1 to 3, 1 to 5 or 1 to 8, and the first dispersion medium may include, for example, at least one of methanol, ethanol, ethylene glycol, isopropanol and n-butanol.

[0042] In some embodiments of this application, the titer of tobacco mosaic virus in the mixture obtained by mixing tobacco mosaic virus, metal nanoparticles, and a first dispersion medium is less than or equal to 10. 9 PFU / mL, for example, less than or equal to 10 9 PFU / mL and greater than or equal to 10 7 PFU / mL, on the one hand, is beneficial to improve the dispersion performance of tobacco mosaic virus in the first dispersion medium, and on the other hand, it is beneficial to control the density of the composite film to be within a suitable range so as to effectively achieve LSPR under specific light excitation.

[0043] To further improve the uniformity of self-assembly of metal nanoparticles in tobacco mosaic virus and to ensure that the metal nanoparticles effectively achieve LSPR under excitation of specific wavelength light to improve the conductivity of the composite material, in some embodiments of this application, the mass ratio of tobacco mosaic virus to metal nanoparticles in the step of mixing tobacco mosaic virus, metal nanoparticles and the first dispersion medium is 1:(1 to 4), for example, it can be 1:1, 1:2, 1:3, 1:4 or any value between the two aforementioned ratios.

[0044] To further improve the purity of the composite material, in some embodiments of this application, after the step of mixing the tobacco mosaic virus, metal nanoparticles, and the first dispersion medium and before the step of obtaining the composite material, the method for preparing the composite material further includes the step of: performing solid-liquid separation on the mixture obtained by mixing the tobacco mosaic virus, metal nanoparticles, and the first dispersion medium, and collecting the solid, wherein the solid is the composite material. In at least one embodiment of this application, the solid-liquid separation is selected from centrifugation, with a centrifugation speed of 5000 r / min to 8000 r / min and a centrifugation time of 20 min to 50 min.

[0045] This application also provides a thin film, the material of which includes any of the composite materials described above, or a composite material prepared by any of the methods described above.

[0046] The thin film of the present application embodiment has good surface flatness, and the surface roughness of the thin film is, for example, 1.3nm to 1.8nm.

[0047] In some embodiments of this application, the film includes a biological carrier based on tobacco mosaic virus and a metal film layer formed by the self-assembly of metal nanoparticles onto the biological carrier.

[0048] It should be noted that the thin film in this application embodiment can be prepared using a solution method, for example, including the steps of: depositing a dispersion containing the composite material, and drying the deposited dispersion to obtain a thin film. The deposition method of the dispersion includes, but is not limited to, one or more of spin coating deposition, printing deposition, inkjet printing deposition, blade coating deposition, dip-coating deposition, immersion deposition, spraying deposition, roller coating deposition, casting deposition, slot coating deposition, and strip coating deposition. The dispersion can be, for example, a mixture obtained by mixing tobacco mosaic virus, metal nanoparticles, and a first dispersion medium. The drying method of the deposited dispersion includes, but is not limited to, one or more of heat treatment and vacuum drying treatment.

[0049] This application provides an optoelectronic device, which includes, but is not limited to, light-emitting devices, solar cells, or photodetectors. The optoelectronic device can be of an upright or inverted structure, such as... Figure 1 As shown, the optoelectronic device 10 includes an anode 101, a cathode 102, and an electronic functional layer 103. The anode 101 and the cathode 102 are disposed opposite to each other, and the electronic functional layer 103 is disposed between the anode 101 and the cathode 102. The material of the electronic functional layer 103 includes any of the composite materials described above, or a composite material prepared by any of the methods described above, or the electronic functional layer 103 includes any of the thin films described above.

[0050] In the optoelectronic device 10 of this application embodiment, the electronic functional layer 103 includes a composite material based on tobacco mosaic virus and metal nanoparticles. On the one hand, the metal nanoparticles are orderly assembled on the outer shell protein of tobacco mosaic virus, which effectively improves the problem of easy aggregation of metal nanoparticles and improves the film uniformity of electronic functional layer 103. On the other hand, under the excitation of light of a specific wavelength, the metal nanoparticles generate hot electrons based on the LSPR effect, which locally enhances electron injection and promotes the carrier injection balance of optoelectronic device 10, thereby improving the device efficiency and device lifetime of optoelectronic device 10.

[0051] In some embodiments of this application, the materials of the anode 101 and the cathode 102 are independently selected from one or more of metals, carbon materials, and metal oxides. The metals include, but are not limited to, one or more of Al, Ag, Cu, Mo, Au, Ba, Pt, Ca, Ir, Ni, and Mg. The carbon materials include, but are not limited to, one or more of graphite, carbon nanotubes, graphene, and carbon fibers. The metal oxides include, but are not limited to, one or more of indium tin oxide (ITO), fluorine-doped tin oxide (FTO), antimony tin oxide (ATO), aluminum-doped zinc oxide (AZO), gallium-doped zinc oxide (GZO), indium-doped zinc oxide (IZO), magnesium-doped zinc oxide (MZO), TiO2, SnO2, ZnO, and In2O3.

[0052] The anode 101 or cathode 102 can also be a composite electrode. The composite electrode has a sandwich-like structure, where the upper and lower layers are independently selected from metal oxides or metal sulfides, and the middle layer is a metal, such as one or more of AZO / Ag / AZO, AZO / Al / AZO, ITO / Ag / ITO, ITO / Al / ITO, ZnO / Ag / ZnO, ZnO / Al / ZnO, TiO2 / Ag / TiO2, TiO2 / Al / TiO2, ZnS / Ag / ZnS, ZnS / Al / ZnS, TiO2 / Ag / TiO2, and TiO2 / Al / TiO2. The thickness of the middle layer does not exceed 35 nm. The thickness of the anode 101 can be, for example, 20 nm to 300 nm, and the thickness of the cathode 102 can be, for example, 20 nm to 300 nm.

[0053] In the optoelectronic device 10 of this application embodiment, the electronic functional layer 103 can be a single-layer structure or a multi-layer structure, and the thickness of the electronic functional layer 103 is, for example, 10 nm to 100 nm. Further reference will be made to some embodiments of this application. Figure 1The electronic functional layer 103 includes an electron transport layer 1031 and an auxiliary layer 1032 stacked together. The auxiliary layer 1032 is closer to the cathode 102 than the electron transport layer 1031. The material of the auxiliary layer 1032 includes any of the composite materials described above, or a composite material prepared by any of the methods described above, or the electronic functional layer 103 includes any of the thin films described above.

[0054] In some embodiments of this application, the material of the electron transport layer 1031 includes one or more of a first inorganic compound material, a second inorganic compound material, a group IIB-VIA semiconductor material, a group IIIA-VA semiconductor material, and a group IB-IIIA-VIA semiconductor material. The first inorganic compound material includes, but is not limited to, one or more of ZnO, TiO2, SnO2, BaO, Ta2O3, Al2O3, and ZrO2, and / or IIB-VIA group semiconductor materials include, but are not limited to, one or more of ZnS, ZnSe, and CdS, and / or IIIA-VA group semiconductor materials include, but are not limited to, one or more of InP and GaP, and / or IB-IIIA-VIA group semiconductor materials include, but are not limited to, one or more of CuInS and CuGaS; and / or, the second inorganic compound material includes one or more doped first compounds, the doping element of the doped first compound includes, but is not limited to, one or more of Mg, Ca, Zr, W, Ga, Li, Al, Ti, Y, In, and Sn, the host material of the doped first compound is selected, for example, from ZnO, TiO2, SnO2, BaO, Ta2O3, Al2O3, or ZrO2, and the molar amount of the doping element accounts for no more than 50% of the total molar amount of the doped first compound. The first doped compound is selected from one or more of zinc magnesium oxide, zinc calcium oxide, zinc zirconium oxide, zinc gallium oxide, zinc aluminum oxide, zinc lithium oxide, zinc titanium oxide, yttrium zinc oxide, indium tin oxide, and lithium titanium oxide, for example, ZnO, TiO2, SnO2, BaO, Ta2O3, Al2O3, ZrO2, and Zn. (1-x) Mg x O, Zn (1-x) Ca x O, Zn (1-x) Zr x O, Zn (1-x) Ga x O, Zn (1-x) Al x O, Zn (1-x) Li x O, Al (1-x) Zn x O, Zn (1-x) Ti x O, Zn(1-x) Y x O、In (1-x) Sn x O and Ti (1-x) Li x One or more of O, wherein 0 < x ≤ 0.5. It should be noted that the first inorganic compound material and the doped first compound can be, for example, in the form of nanoparticles, nanosheets, nanoneedles or nanorods, respectively, with nanoparticles as an example, and the average particle size of the nanoparticles being, for example, 2 nm to 50 nm.

[0055] In some embodiments of this application, the optoelectronic device 10 is a light-emitting device; see further details. Figure 1 The optoelectronic device 10 includes a light-emitting layer 104 disposed between the electronic functional layer 103 and the anode 101. The material of the light-emitting layer 104 includes one or more of organic light-emitting materials and light-emitting quantum dots, and the thickness of the light-emitting layer 104 is, for example, 10 nm to 100 nm.

[0056] Among them, organic light-emitting materials include, but are not limited to, one or more of the following: 4,4'-bis(N-carbazole)-1,1'-biphenyl:tri[2-(p-tolyl)pyridinium(III), 4,4',4”-tri(carbazole-9-yl)triphenylamine:tri[2-(p-tolyl)pyridinium, diaromatic anthracene derivatives, stilbene aromatic derivatives, pyrene derivatives, fluorene derivatives, TBPe fluorescent materials, TTPX fluorescent materials, TBRb fluorescent materials, DBP fluorescent materials, delayed fluorescent materials, TTA materials, thermally activated delayed materials, polymers containing BN covalent bonds, hybrid local charge transfer excited state materials, excitopolymer light-emitting materials, polyacetylene and its derivatives, poly(p-phenylene) and its derivatives, polythiophene and its derivatives, and polyfluorene and its derivatives.

[0057] The luminescent quantum dots include, but are not limited to, one or more of red quantum dots (emission wavelength greater than 600 nm), green quantum dots (emission wavelength selected from 501 nm to 600 nm), and blue quantum dots (emission wavelength selected from 450 nm to 500 nm). Furthermore, the luminescent quantum dots include, but are not limited to, one or more of single-component quantum dots, core-shell structured quantum dots, inorganic perovskite quantum dots, organic perovskite quantum dots, and organic-inorganic hybrid perovskite quantum dots, wherein the shell of the core-shell structured quantum dots has one or more layers. The average particle size of the luminescent quantum dots can be, for example, 2 nm to 20 nm, with examples being 2 nm, 5 nm, 6 nm, 7 nm, 8 nm, 9 nm, 10 nm, 15 nm, 20 nm, or any value between any two of the aforementioned values.

[0058] For single-component quantum dots and core-shell quantum dots, the material of the single-component quantum dot, the material of the core of the core-shell quantum dot, or the material of the shell of the core-shell quantum dot includes, but is not limited to, at least one of group II-VI compounds, group III-V compounds, group III-VI compounds, group IV-VI compounds, or group I-III-VI compounds. Among them, the II-VI group compounds include, but are not limited to, one or more of CdS, CdSe, CdTe, ZnS, ZnSe, ZnTe, ZnO, HgS, HgSe, HgTe, MgSe, MgS, CdSeS, CdSeTe, CdSTe, ZnSeS, ZnSeTe, ZnSTe, HgSeS, HgSeTe, HgSTe, CdZnS, CdZnSe, CdZnTe, CdHgS, CdHgSe, CdHgTe, HgZnS, HgZnSe, HgZnTe, MgZnSe, MgZnS, CdZnSeS, CdZnSeTe, CdZnSTe, CdHgSeS, CdHgSeTe, CdHgSTe, HgZnSeS, HgZnSeTe, and HgZnSTe. III-VI group compounds include, but are not limited to, one or more of In2S3, In2Se3, InGaS3, and InGaSe3. III-V group compounds include, but are not limited to, one or more of GaN, GaP, GaAs, GaSb, AlN, AlP, AlAs, AlSb, InN, InP, InAs, InSb, GaNP, GaNAs, GaNSb, GaPAs, GaPSb, AlNP, AlNAs, AlNSb, AlPAs, AlPSb, InNP, InNAs, InNSb, InPAs, InPSb, GaAlNP, GaAlNAs, GaAlNSb, GaAlPAs, GaAlPSb, GaInNP, GaInNAs, GaInNSb, GaInPAs, GaInPSb, InAlNP, InAlNAs, InAlNSb, InAlPAs, and InAlPSb. Group IV-VI compounds include, but are not limited to, one or more of SnS, SnSe, SnTe, PbS, PbSe, PbTe, SnSeS, SnSeTe, SnSTe, PbSeS, PbSeTe, PbSTe, SnPbS, SnPbSe, SnPbTe, SnPbSSe, SnPbSeTe, and SnPbSTe. Group I-III-VI compounds include, but are not limited to, one or more of AgInS, AgInS2, CuInS, CuInS2, AgGaS2, CuGaS2, CuGaO2, AgGaO2, AgAlO2, AgInGaS2, and CuInGaS2.

[0059] For inorganic perovskite quantum dots, the general structural formula is AMX3, where A is Cs. + M is a divalent metal cation, and M includes, but is not limited to, Pb. 2+ Sn 2+ Cu 2+ Ni 2+ Cd 2+ Cr 2+ Mn 2+ Co 2+ Fe 2+ 、Ge 2+ Yb 2+ Or Eu 2+ X is a halide anion, including but not limited to Cl. - ,Br - or I - .

[0060] For organic perovskite quantum dots, the general structural formula is CMX3, where C is a formamidinyl group and M is a divalent metal cation, which may include, but is not limited to, Pb. 2+ Sn 2+ Cu 2+ Ni 2+ Cd 2+ Cr 2+ Mn 2+ Co 2+ Fe 2+ 、Ge 2+ Yb 2+ Or Eu 2+ X is a halide anion, including but not limited to Cl. - ,Br - or I - .

[0061] For organic-inorganic hybrid perovskite quantum dots, the general structural formula is BMX3, where B is selected from organic amine cations, including but not limited to CH3(CH2). n-2 NH 3+ (n≥2) or NH3(CH2) n NH3 2+ (n≥2), M is a divalent metal cation, and M includes, but is not limited to, Pb. 2+ Sn 2+ Cu 2+ Ni 2+ Cd 2+ Cr 2+ Mn 2+ Co 2+ Fe2+ 、Ge 2+ Yb 2+ Or Eu 2+ X is a halide anion, including but not limited to Cl. - ,Br - or I - .

[0062] When the material of the light-emitting layer 104 includes light-emitting quantum dots, in order to improve the solution processing performance of the light-emitting quantum dots and further enhance the device efficiency of the optoelectronic device 10, in some embodiments of this application, ligands are also attached to the surface of the light-emitting quantum dots. The ligands can be common ligands in the art, including but not limited to C1 to C2. 30 aliphatic carboxylic acid ligands, C6-C 30 Aromatic carboxylic acid ligands, C1-C 30 Aliphatic thiol ligands, C6-C 30 Thiol aromatic ligands, C1-C 30 fatty amine ligands, C6-C 30 Aromatic amine ligands, C1-C 30 Aliphatic phosphine ligands, C6~C 30 Aromatic phosphine ligands and C6-C 30 One or more of the aromatic phosphate ligands and halogen ligands.

[0063] Among them, C1~C 30 The aliphatic carboxylic acid ligands include, but are not limited to, one or more of the following: octanoic acid, nonanoic acid, decanoic acid, undecanoic acid, dodecanoic acid, tetradecanoic acid, hexadecanoic acid, octadecanoic acid, eicosanoic acid, teicosanoic acid, oleic acid, linoleic acid, arachidic acid, arachidonic acid, erucic acid, and docosahexaenoic acid; C6~C 30 Aromatic carboxylic acid ligands include, but are not limited to, one or more of benzoic acid, biphenylic acid, and 1-naphthoic acid. (C1-C2) 30 The aliphatic thiol ligands include, but are not limited to, one or more of hexamethylenetetramine, octanethiol, nonanethiol, decanethiol, undecylthiol, dodecathiol, hexadecylthiol, and octadecylthiol, C6–C6. 30 Thiol aromatic ligands include, but are not limited to, one or more of benzenethiol, triphenylmethanethiol, and p-terphenyl-4,4”-dithiol. C1~C 30 The aliphatic amine ligands include, but are not limited to, one or more of hexylamine, octylamine, dioctylamine, trioctylamine, nonylamine, decylamine, dodecylamine, trideamine, tetradeamine, pentadecylamine, hexadecylamine, heptadecanamine, octadecylamine, and oleylamine, C6-C6. 30 The aromatic amine ligands include, but are not limited to, one or more of aniline, indenepropylamine, 4-octylaniline, and benzidine. (C1-C2) 30The aliphatic phosphine ligands include, but are not limited to, one or more of trimethylphosphine, triethylphosphine, tripropylphosphine, tributylphosphine, trihexylphosphine, trioctylphosphine, tridecylphosphine, tributylphosphine oxide, trihexylphosphine oxide, trioctylphosphine oxide, and tridecylphosphine oxide, C6–C6. 30 Aromatic phosphine ligands include, but are not limited to, one or more of bis(2-diphenylphosphineethyl)phenylphosphine and triphenylphosphine oxide, C6-C6. 30 The aromatic phosphate ligands include, but are not limited to, one or more of tetraethyl p-xylene diphosphate and ethyl diphenyl phosphate. Halogen ligands include, but are not limited to, -Cl, -F, -I, or -Br.

[0064] It is understandable that when the material of the luminescent layer 104 includes green quantum dots, a composite material containing gold nanoparticles and tobacco mosaic virus can be used as the material of the auxiliary layer 1032. When the material of the luminescent layer 104 includes red quantum dots, a composite material containing silver nanoparticles and tobacco mosaic virus can be used as the material of the auxiliary layer 1032. When the material of the luminescent layer 104 includes blue quantum dots, a composite material containing platinum nanoparticles and tobacco mosaic virus can be used as the material of the auxiliary layer 1032.

[0065] To further improve the photoelectric performance and device lifespan of the optoelectronic device 10, further reference is made to some embodiments of this application. Figure 1 The optoelectronic device 10 also includes a hole functional layer 105, which is disposed between the electronic functional layer 103 and the anode 101. For optoelectronic devices including a light-emitting layer 104, the hole functional layer 105 is disposed between the anode 101 and the light-emitting layer 104.

[0066] In the optoelectronic device 10 of this application embodiment, the thickness of the hole functional layer 105 is, for example, 10 nm to 100 nm. The hole functional layer 105 can be a single-layer structure or a multi-layer structure. The hole functional layer 105 includes, for example, a hole injection layer 1051 and / or a hole transport layer 1052. For the optoelectronic device 10 including the hole injection layer 1051 and the hole transport layer 1052, please continue to refer to... Figure 1 Hole injection layer 1051 is closer to anode 101 than hole transport layer 1052.

[0067] The hole functional layer 105 is made of one or more of the following: organic compounds, third inorganic compound materials, and fourth inorganic compound materials. Among these, organic compounds include, but are not limited to, poly(3,4-vinyldioxythiophene):poly(styrene sulfonic acid) (PEDOT:PSS, CAS No. 155090-83-8), copper phthalocyanine (CAS No. 147-14-8), titanium phthalocyanine (CAS No. 26201-32-1), 2,3,5,6-tetrafluoro-7,7',8,8'-tetracyanodimethyl-p-benzoquinone (CAS No. 29261-33-4), 2,3,6,7,10,11-hexacyano-1,4,5,8,9,12-hexaazabenzophenanthrene (CAS No. 105598-27-4), and polyaniline (CAS No. 25233-30-1). Polypyrrole (CAS No. 30604-81-0), 3-hexyl-substituted polythiophene (CAS No. 104934-50-1), poly(9-vinylcarbazole) (abbreviated as PVK, CAS No. 25067-59-8), 4,4'-bis(9-carbazole)biphenyl (abbreviated as CBP, CAS No. 58328-31-7), poly[bis(4-phenyl)(4-butylphenyl)amine], 4,4'-cyclohexylbis[N,N-bis(4-methylphenyl)aniline] (abbreviated as TAPC, CAS No. 58473-78-2), poly[(9,9-dioctylfluorenyl-2,7-diyl)-co-(4,4'-(N-(4-sec-butylphenyl)di- 4,4',4'-tris(N-3-methylphenyl-N-phenylamino)triphenylamine (CAS No. 124729-98-2), 4,4',4'-tris(carbazole-9-yl)triphenylamine (CAS No. 139092-78-7), 4,4',4'-tris(2-naphthylphenylamino)triphenylamine (CAS No. 185) 690-41-9), N,N'-diphenyl-N,N'-(1-naphthyl)-1,1'-biphenyl-4,4'-diamine (abbreviated as NPB, CAS number 123847-85-8), N,N'-diphenyl-N,N'-di(3-methylphenyl)-1,1'-biphenyl-4,4'-diamine (abbreviated as TPD, CAS number 65181-78-4), N,N'-bis[4-(diphenylamino)phenyl]-N,N'-diphenylbenzidine (CAS number 209980-53-0), N,N'-bis(3-methylphenyl)-N,N'-diphenyl-9,9-spirodifluorene-2,7-diamine (abbreviated as Spiro-TPD),One or more of the following: N2,N7-di-1-naphthyl-N2,N7-diphenyl-9,9'-spirobis[9H-fluorene]-2,7-diamine (CAS No. 932739-76-9), poly[bis(4-phenyl)(2,4,6-trimethylphenyl)amine] (PTTA, CAS No. 1333317-99-9), and 2,2',7,7'-tetratetra[N,N-di(4-methoxyphenyl)amino]-9,9'-spirobisfluorene (Spiro-omeTAD, CAS No. 207739-72-8); and / or, the third inorganic compound material includes, but is not limited to, graphene, C60, nickel oxide, molybdenum oxide, tungsten oxide, vanadium oxide, p-type gallium nitride, and chromium oxide. The fourth inorganic compound material comprises one or more of copper oxide, copper sulfide, molybdenum sulfide, and tungsten sulfide; and / or, the host material of the doped second compound is selected from graphene, C60, nickel oxide (e.g., NiO), molybdenum oxide (e.g., MoO3), tungsten oxide (e.g., WO3), vanadium oxide (e.g., V2O5), p-type gallium nitride, chromium oxide (e.g., Cr2O3), copper oxide (e.g., CuO or Cu2O), copper sulfide (e.g., CuS), molybdenum sulfide (e.g., MoS2), or tungsten sulfide (e.g., WS2), and the doping element of the doped second compound is selected from one or more of nickel, molybdenum, tungsten, vanadium, chromium, copper, and platinum group metals, and the molar amount of the doping element accounts for no more than 50% of the total molar amount of the doped second compound.

[0068] It is understood that when the hole functional layer 105 comprises multiple materials and the hole functional layer 105 has a multi-layer structure, the multiple materials can all be in the same layer, or be in different layers, or be partially in the same layer. For example, see [continued] Figure 1 When the hole functional layer 105 is composed of a hole injection layer 1051 and a hole transport layer 1052 stacked together, the material of the hole functional layer 105 includes PEDOT:PSS and TFB, with PEDOT:PSS and TFB located in different layers. The material of the hole injection layer 1051 is PEDOT:PSS, and the material of the hole transport layer 1052 is TFB.

[0069] This application also provides a method for fabricating an optoelectronic device, comprising the following steps:

[0070] S10. Provide a first electrode and form an electronic functional layer on one side of the first electrode;

[0071] S20. A second electrode is formed on the side of the electronic functional layer away from the first electrode.

[0072] In this configuration, one of the first electrode and the second electrode is the anode, and the other is the cathode. Forming the electronic functional layer includes the steps of: depositing a dispersion containing the composite material, and drying the deposited dispersion to obtain the electronic functional layer. The composite material, the dispersion containing the composite material, the drying process, and the deposition method of the dispersion are all described above.

[0073] In some embodiments of this application, the first electrode is an anode and the second electrode is a cathode. Forming the electronic functional layer includes the steps of: forming an electron transport layer on one side of the first electrode, then depositing a dispersion containing a composite material on the side of the electron transport layer away from the first electrode, and drying the deposited dispersion to obtain an auxiliary layer. The electronic functional layer includes an electron transport layer and an auxiliary layer stacked together. The structural composition of the electron transport layer is as described above.

[0074] To further improve the hydrophilicity of the electron transport layer, thereby enhancing the bonding force between the auxiliary layer and the electron transport layer and achieving monolayer deposition of the composite material, in some embodiments of this application, after the step of forming the electron transport layer and before the step of depositing a dispersion containing the composite material on the side of the electron transport layer away from the first electrode, the formation of the electronic functional layer further includes the step of subjecting the electron transport layer to ultraviolet (UV) irradiation treatment, wherein the UV irradiation treatment time is, for example, 20s to 60s, and the UV irradiation intensity is, for example, 6W / cm². 2 ~10W / cm 2 The wavelength of the ultraviolet light treatment is, for example, 345 nm to 395 nm. It is understood that if there are other films between the electron transport layer and the auxiliary layer, the film adjacent to the auxiliary layer is subjected to ultraviolet light treatment before the auxiliary layer is prepared, so as to improve the bonding force between the auxiliary layer and the film.

[0075] In some other embodiments of this application, the first electrode is a cathode and the second electrode is an anode. Forming the electronic functional layer includes the steps of: depositing a dispersion containing a composite material on one side of the first electrode, drying the deposited dispersion to obtain an auxiliary layer, and then forming an electron transport layer on the side of the auxiliary layer away from the first electrode. The electronic functional layer includes the auxiliary layer and the electron transport layer stacked together. The structural composition of the electron transport layer is as described above.

[0076] To further improve the bonding force between the auxiliary layer and the first electrode and achieve monolayer deposition of the composite material, in some embodiments of this application, before the step of forming the electronic functional layer, the method for fabricating the optoelectronic device includes the step of subjecting the first electrode to ultraviolet light irradiation, wherein the ultraviolet light irradiation time is, for example, 20s to 60s, and the intensity of the ultraviolet light irradiation is, for example, 6W / cm². 2 ~10W / cm 2The wavelength of the ultraviolet light treatment is, for example, 345 nm to 395 nm. It is understood that if there are other films between the first electrode and the auxiliary layer, the upper film adjacent to the auxiliary layer is subjected to ultraviolet light treatment before the auxiliary layer is prepared to improve the adhesion between the auxiliary layer and the upper film.

[0077] In some embodiments of this application, the method for fabricating the optoelectronic device further includes the step of forming a light-emitting layer and a hole-functional layer between the anode and the electronic functional layer. Specifically, when the first electrode is the anode and the second electrode is the cathode, the method for fabricating the optoelectronic device includes the steps of providing a first electrode and sequentially forming a hole-functional layer, a light-emitting layer, an electronic functional layer, and a second electrode on one side of the first electrode; when the first electrode is the cathode and the second electrode is the anode, the method for fabricating the optoelectronic device includes the steps of providing a first electrode and sequentially forming an electronic functional layer, a light-emitting layer, a hole-functional layer, and a second electrode on one side of the first electrode.

[0078] It should be noted that the methods for forming various films in optoelectronic devices include, but are not limited to, chemical and / or physical methods. Among them, chemical methods include, but are not limited to, one or more of chemical vapor deposition, continuous ion layer adsorption and reaction, anodic oxidation, electrolytic deposition, and co-precipitation. Physical methods include, but are not limited to, physical coating and solution methods. Physical coating methods include, but are not limited to, one or more of thermal evaporation coating, electron beam evaporation coating, magnetron sputtering, multi-arc ion plating, physical vapor deposition, atomic layer deposition, and pulsed laser deposition. Solution methods include, but are not limited to, one or more of spin coating, printing, inkjet printing, blade coating, dip coating, immersion coating, spray coating, roller coating, casting, slot coating, and strip coating.

[0079] It should be noted that after the various film layers of the optoelectronic device are prepared, an encapsulation process is required. The encapsulation process can be carried out by commonly used machine encapsulation or manual encapsulation. In the encapsulation environment, the oxygen content and water content are both below 0.1 ppm to ensure the stability of the optoelectronic device.

[0080] This application also provides an electronic device, which includes any of the optoelectronic devices described above, or optoelectronic devices prepared by any of the methods described above. The electronic device can be, for example, any electronic product with a display function, including but not limited to smartphones, tablet personal computers, mobile phones, video phones, e-book readers, laptop PCs, netbook computers, workstations, servers, personal digital assistants, portable multimedia players, MP3 players, mobile medical devices, cameras, game consoles, digital cameras, car navigation systems, electronic billboards, ATMs, smart bracelets, smartwatches, virtual reality (VR) devices, or wearable devices.

[0081] The technical solutions and effects of this application will be described in detail below through specific embodiments, comparative examples and experimental examples. The following embodiments are only some embodiments of this application and are not intended to limit this application.

[0082] Material Example 1

[0083] This embodiment provides a composite material, a thin film, and a method for preparing the same. The composite material includes tobacco mosaic virus TMV-U1 and gold nanoparticles, with the gold nanoparticles bound to the outer shell protein of the tobacco mosaic virus.

[0084] The method for preparing the composite material in this embodiment includes the following steps:

[0085] S1.1. Amplify tobacco mosaic virus TMV-U1 according to standard virological procedures. Disperse the amplified tobacco mosaic virus TMV-U1 in n-butanol to obtain a TMV-U1 dispersion. The titer of TMV-U1 in the TMV-U1 dispersion is 3 × 10⁻⁶. 10 PFU / mL;

[0086] S1.2. Provide a gold nanoparticle dispersion, wherein the dispersion medium of the gold nanoparticle dispersion is n-butanol, the concentration of gold nanoparticles in the gold nanoparticle dispersion is 10 mg / mL, and the average particle size of the gold nanoparticles is 5 nm. Mix 5 mL of TMV-U1 dispersion with 5 mL of gold nanoparticle dispersion and sonicate for 5 min to disperse and assemble the gold nanoparticles into the shell protein of TMV-U1 to obtain a mixture.

[0087] S1.3 Place the mixture in a centrifuge tube and centrifuge at 7000 r / min for 30 min. Remove the residual solid after removing the suspension to obtain the composite material. Then add 5 mL of n-butanol to the centrifuge tube to obtain the composite material dispersion for later use.

[0088] The material of the thin film in this embodiment includes the composite material of this embodiment. The thin film includes a biological carrier based on TMV-U1 and a metal film layer formed by the self-assembly of gold nanoparticles on the biological carrier.

[0089] The thin film preparation method in this embodiment includes the following steps: providing a substrate, spin-coating the composite material dispersion obtained in step S1.3 onto one side of the substrate under a nitrogen atmosphere at room temperature and pressure, and then heat-treating it for 20 minutes under a nitrogen atmosphere at 80°C to obtain a thin film with an average thickness of 7 nm.

[0090] Material Example 2

[0091] This embodiment provides a composite material, a thin film, and a method for preparing the same. Compared with the composite material in Material Example 1, the difference in this embodiment is that the proportion of the mass of gold nanoparticles to the total mass of the composite material is different.

[0092] Compared with the preparation method of the composite material in Material Example 1, the difference in the preparation method of the composite material in this example is that the step S1.2, "mixing 5 mL of TMV-U1 dispersion with 5 mL of gold nanoparticle dispersion", is replaced with "mixing 5 mL of TMV-U1 dispersion with 10 mL of gold nanoparticle dispersion".

[0093] The material of the thin film in this embodiment includes the composite material of this embodiment. The thin film includes a biological carrier based on TMV-U1 and a metal film layer formed by the self-assembly of gold nanoparticles on the biological carrier.

[0094] The preparation method of the thin film in this embodiment is the same as that in Material Example 1.

[0095] Material Example 3

[0096] This embodiment provides a composite material, a thin film, and a method for preparing the same. Compared with the composite material in Material Example 1, the difference in this embodiment is that the proportion of the mass of gold nanoparticles to the total mass of the composite material is different.

[0097] Compared with the preparation method of the composite material in Material Example 1, the difference in the preparation method of the composite material in this example is that the step S1.2, "mixing 5 mL of TMV-U1 dispersion with 5 mL of gold nanoparticle dispersion", is replaced with "mixing 5 mL of TMV-U1 dispersion with 3 mL of gold nanoparticle dispersion".

[0098] The material of the thin film in this embodiment includes the composite material of this embodiment. The thin film includes a biological carrier based on TMV-U1 and a metal film layer formed by the self-assembly of gold nanoparticles on the biological carrier.

[0099] The preparation method of the thin film in this embodiment is the same as that in Material Example 1.

[0100] Material Example 4

[0101] This embodiment provides a composite material, a thin film, and a method for preparing the same. Compared with the composite material in Material Example 1, the difference in this embodiment is that the gold nanoparticles in the composite material are replaced with silver nanoparticles.

[0102] The method for preparing the composite material in this embodiment includes the following steps:

[0103] S2.1, Consistent with step S1.1;

[0104] S2.2 Provide a silver nanoparticle dispersion, wherein the dispersion medium of the silver nanoparticle dispersion is n-butanol, the concentration of silver nanoparticles in the silver nanoparticle dispersion is 10 mg / mL, and the average particle size of the silver nanoparticles is 13 nm. Mix 5 mL of TMV-U1 dispersion with 5 mL of silver nanoparticle dispersion and sonicate for 5 min to disperse and assemble the silver nanoparticles into the shell protein of TMV-U1 to obtain a mixture.

[0105] S2.3, Refer to step S1.3.

[0106] The material of the thin film in this embodiment includes the composite material of this embodiment. The thin film includes a biological carrier based on TMV-U1 and a metal film layer formed by the self-assembly of silver nanoparticles on the biological carrier.

[0107] The preparation method of the thin film in this embodiment is the same as that in Material Example 1.

[0108] Material Example 5

[0109] This embodiment provides a composite material, a thin film, and a method for preparing the same. Compared with the composite material in Material Example 4, the difference in this embodiment is that the proportion of the mass of silver nanoparticles to the total mass of the composite material is different.

[0110] Compared with the preparation method of the composite material in Material Example 4, the difference in the preparation method of the composite material in this example is that the step S1.2 "mixing 5 mL of TMV-U1 dispersion with 5 mL of gold nanoparticle dispersion" is replaced with "mixing 5 mL of TMV-U1 dispersion with 10 mL of silver nanoparticle dispersion".

[0111] The material of the thin film in this embodiment includes the composite material of this embodiment. The thin film includes a biological carrier based on TMV-U1 and a metal film layer formed by the self-assembly of silver nanoparticles on the biological carrier.

[0112] The preparation method of the thin film in this embodiment is the same as that in Material Example 1.

[0113] Material Example 6

[0114] This embodiment provides a composite material, a thin film, and a method for preparing the same. Compared with the composite material in Material Example 4, the difference in this embodiment is that the proportion of the mass of silver nanoparticles to the total mass of the composite material is different.

[0115] Compared with the preparation method of the composite material in Material Example 4, the difference in the preparation method of the composite material in this example is that the step S1.2, "mixing 5 mL of TMV-U1 dispersion with 5 mL of gold nanoparticle dispersion", is replaced with "mixing 5 mL of TMV-U1 dispersion with 3 mL of silver nanoparticle dispersion".

[0116] The material of the thin film in this embodiment includes the composite material of this embodiment. The thin film includes a biological carrier based on TMV-U1 and a metal film layer formed by the self-assembly of silver nanoparticles on the biological carrier.

[0117] The preparation method of the thin film in this embodiment is the same as that in Material Example 1.

[0118] Material Example 7

[0119] This embodiment provides a composite material, a thin film, and a method for preparing the same. Compared with the composite material in Material Example 1, the difference in this embodiment is that the gold nanoparticles in the composite material are replaced with "platinum nanoparticles".

[0120] The method for preparing the composite material in this embodiment includes the following steps:

[0121] S3.1, Consistent with step S1.1;

[0122] S3.2 Provide a platinum nanoparticle dispersion, wherein the dispersion medium of the platinum nanoparticle dispersion is n-butanol, the concentration of platinum nanoparticles in the platinum nanoparticle dispersion is 10 mg / mL, and the average particle size of the platinum nanoparticles is 13 nm. Mix 5 mL of TMV-U1 dispersion with 5 mL of platinum nanoparticle dispersion and sonicate for 5 min to disperse and assemble the platinum nanoparticles into the shell protein of TMV-U1 to obtain a mixture.

[0123] S3.3, Refer to step S1.3.

[0124] The material of the thin film in this embodiment includes the composite material of this embodiment. The thin film includes a TMV-U1-based biological carrier and a metal film layer formed by the self-assembly of platinum nanoparticles on the biological carrier.

[0125] The preparation method of the thin film in this embodiment is the same as that in Material Example 1.

[0126] Material Example 8

[0127] This embodiment provides a composite material, a thin film, and a method for preparing the same. Compared with the composite material in Material Example 7, the difference in this embodiment is that the proportion of platinum nanoparticles to the total mass of the composite material is different.

[0128] Compared with the preparation method of the composite material in Material Example 7, the difference in the preparation method of the composite material in this example is that the step S1.2, "mixing 5 mL of TMV-U1 dispersion with 5 mL of gold nanoparticle dispersion", is replaced with "mixing 5 mL of TMV-U1 dispersion with 10 mL of platinum nanoparticle dispersion".

[0129] The material of the thin film in this embodiment includes the composite material of this embodiment. The thin film includes a TMV-U1-based biological carrier and a metal film layer formed by the self-assembly of platinum nanoparticles on the biological carrier.

[0130] The preparation method of the thin film in this embodiment is the same as that in Material Example 1.

[0131] Material Example 9

[0132] This embodiment provides a composite material, a thin film, and a method for preparing the same. Compared with the composite material in Material Example 7, the difference in this embodiment is that the proportion of platinum nanoparticles to the total mass of the composite material is different.

[0133] Compared with the preparation method of the composite material in Material Example 7, the difference in the preparation method of the composite material in this example is that the step S1.2 "mixing 5 mL of TMV-U1 dispersion with 5 mL of gold nanoparticle dispersion" is replaced with "mixing 5 mL of TMV-U1 dispersion with 3 mL of platinum nanoparticle dispersion".

[0134] The material of the thin film in this embodiment includes the composite material of this embodiment. The thin film includes a TMV-U1-based biological carrier and a metal film layer formed by the self-assembly of platinum nanoparticles on the biological carrier.

[0135] The preparation method of the thin film in this embodiment is the same as that in Material Example 1.

[0136] Material Example 10

[0137] This embodiment provides a composite material, a thin film, and a method for preparing the same. Compared with the composite material in Material Example 1, the difference in this embodiment is that the gold nanoparticles in the composite material are replaced with aluminum nanoparticles.

[0138] The method for preparing the composite material in this embodiment includes the following steps:

[0139] S4.1, Consistent with step S1.1;

[0140] S4.2 Provide an aluminum nanoparticle dispersion, wherein the dispersion medium of the aluminum nanoparticle dispersion is n-butanol, the concentration of aluminum nanoparticles in the aluminum nanoparticle dispersion is 10 mg / mL, and the average particle size of the aluminum nanoparticles is 3 nm. Mix 5 mL of TMV-U1 dispersion with 5 mL of aluminum nanoparticle dispersion and sonicate for 5 min to disperse and assemble the aluminum nanoparticles into the shell protein of TMV-U1 to obtain a mixture.

[0141] S4.3, Refer to step S1.3.

[0142] The material of the thin film in this embodiment includes the composite material of this embodiment. The thin film includes a biological carrier based on TMV-U1 and a metal film layer formed by the self-assembly of aluminum nanoparticles on the biological carrier.

[0143] The preparation method of the thin film in this embodiment is the same as that in Material Example 1.

[0144] Material Comparison Example 1

[0145] This comparative example provides a thin film with an average thickness of 7 nm, and the material of the thin film is gold nanoparticles (average particle size of 5 nm).

[0146] The thin film preparation method includes the following steps: providing a substrate, spin-coating a gold nanoparticle dispersion onto one side of the substrate under a nitrogen atmosphere at room temperature and pressure (preparation method refers to step S1.2), and then heat-treating it at 80°C under a nitrogen atmosphere for 20 min to obtain the thin film.

[0147] Material Comparison Example 2

[0148] This comparative example provides a thin film with an average thickness of 7 nm, and the material of the thin film is silver nanoparticles.

[0149] The thin film preparation method includes the following steps: providing a substrate, spin-coating a silver nanoparticle dispersion onto one side of the substrate under a nitrogen atmosphere at room temperature and pressure (preparation method refers to step S2.2), and then heat-treating it at 80°C under a nitrogen atmosphere for 20 min to obtain the thin film.

[0150] Material Comparison Example 3

[0151] This comparative example provides a thin film with an average thickness of 7 nm, and the material of the thin film is platinum nanoparticles.

[0152] The thin film preparation method includes the following steps: providing a substrate, spin-coating a platinum nanoparticle dispersion onto one side of the substrate under a nitrogen atmosphere at room temperature and pressure (preparation method refers to step S3.2), and then heat-treating it at 80°C under a nitrogen atmosphere for 20 min to obtain the thin film.

[0153] Device Example 1

[0154] This embodiment provides an optoelectronic device and its fabrication method. The optoelectronic device is a quantum dot light-emitting diode with a positive-position structure, such as... Figure 1 As shown, in the direction from bottom to top, the optoelectronic device 10 includes an anode 101, a hole functional layer 105, a light-emitting layer 104, an electron functional layer 103, and a cathode 102 stacked sequentially. The hole functional layer 105 is composed of a hole injection layer 1051 and a hole transport layer 1052 stacked sequentially, with the hole injection layer 1051 being closer to the anode 101 than the hole transport layer 1052. The electron functional layer 103 is composed of an electron transport layer 1031 and an auxiliary layer 1032 stacked sequentially, with the auxiliary layer 1032 being closer to the cathode 102 than the electron transport layer 1031.

[0155] The materials and thicknesses of each layer in optoelectronic device 10 are as follows:

[0156] The material of anode 101 includes ITO, and the average thickness of anode 101 is 15 nm;

[0157] The cathode 102 is made of Ag and has an average thickness of 35 nm.

[0158] The material of electron transport layer 1031 includes Zn 0.85 Mg 0.15 O nanoparticles (average particle size of 5 nm), and the electron transport layer 1031 has an average thickness of 45 nm;

[0159] The material of the auxiliary layer 1032 includes the composite material in Material Example 1, and the average thickness of the auxiliary layer 1032 is 12 nm;

[0160] The material of the light-emitting layer 104 includes green light-emitting quantum dots with a core-shell structure. The core of the green light-emitting quantum dots is made of CdSe, and the green light-emitting quantum dots have a shell made of ZnS. The average thickness of the light-emitting layer 104 is 25 nm.

[0161] The hole injection layer 1051 is made of PEDOT:PSS and has an average thickness of 30 nm.

[0162] The hole transport layer 1052 is made of TFB material and has an average thickness of 30 nm.

[0163] The fabrication method of the light-emitting device in this embodiment includes the following steps:

[0164] S10.1 Provide a substrate (material is glass and average thickness is 0.4mm), sputter ITO on one side of the substrate to obtain an ITO layer, wipe the surface of the ITO layer with a cotton swab dipped in a small amount of soapy water to remove visible impurities on the surface, and then sequentially ultrasonically clean the substrate including ITO with deionized water for 15min, acetone for 15min, ethanol for 15min and isopropanol for 15min, dry it and then perform ultraviolet-ozone surface treatment for 15min to obtain a substrate containing an anode;

[0165] S10.2 Under normal temperature and pressure air environment, spin-coat PEDOT:PSS aqueous solution on the side of the anode away from the substrate, and then place it at 150℃ for constant temperature heat treatment for 30 min to obtain hole injection layer.

[0166] S10.3 Under a nitrogen atmosphere at normal temperature and pressure, spin-coat a TFB solution on the side of the hole injection layer away from the anode. The concentration of TFB in the TFB solution is 8 mg / mL and the solvent of the TFB solution is chlorobenzene. Then, place it under a nitrogen atmosphere and heat-treat at 150°C for 30 min to obtain the hole transport layer.

[0167] S10.4 Under a nitrogen atmosphere at normal temperature and pressure, spin-coat a luminescent quantum dot solution on the side of the hole transport layer away from the hole injection layer. The concentration of luminescent quantum dots in the luminescent quantum dot solution is 20 mg / mL, and the solvent of the luminescent quantum dot solution is n-octane. Then, place it under a nitrogen atmosphere and heat-treat at 80°C for 5 min to obtain the luminescent layer.

[0168] S10.5. Under a nitrogen atmosphere at room temperature and pressure, spin-coat nano-Zn onto the side of the luminescent layer furthest from the hole transport layer. 0.85 Mg 0.15 O solution, nano Zn 0.85 Mg 0.15 Nano Zn in O solution 0.85 Mg 0.15 The concentration of O is 30 mg / mL, and the nano-Zn 0.85 Mg 0.15 The solvent for solution O was ethanol. The solution was then subjected to heat treatment at 80°C for 20 minutes under a nitrogen atmosphere to obtain an electron transport layer. The electron transport layer was then subjected to ultraviolet (UV) irradiation for 30 seconds at an intensity of 10 W / cm². 2 ;

[0169] S10.6. Referring to the thin film preparation method in Example 1, an auxiliary layer is formed on the side of the electron transport layer away from the light-emitting layer;

[0170] S10.7 Place the prefabricated device after completing step S10.6 in a vacuum with a vacuum degree not exceeding 3×10⁻⁶. -4 In the vapor deposition chamber of Pa, Ag is thermally vaporized on the side of the electronic functional layer away from the light-emitting layer through a mask to obtain the cathode, and then encapsulated with epoxy resin to obtain the optoelectronic device.

[0171] Device Example 2

[0172] This embodiment provides an optoelectronic device and its fabrication method. Compared with the optoelectronic device in Device Embodiment 1, the difference of the optoelectronic device in this embodiment is that the material of the auxiliary layer is replaced with the composite material in Material Embodiment 2.

[0173] Compared to the method for preparing the optoelectronic device in Device Example 1, the method for preparing the optoelectronic device in this example differs in that step S10.5 is replaced with "forming an auxiliary layer on the side of the electron transport layer away from the light-emitting layer, referring to the method for preparing the thin film in Material Example 2".

[0174] Device Example 3

[0175] This embodiment provides an optoelectronic device and its fabrication method. Compared with the optoelectronic device in Device Embodiment 1, the difference of the optoelectronic device in this embodiment is that the material of the auxiliary layer is replaced with the composite material in Material Embodiment 3.

[0176] Compared to the method for preparing the optoelectronic device in Device Example 1, the method for preparing the optoelectronic device in this example differs in that step S10.5 is replaced with "forming an auxiliary layer on the side of the electron transport layer away from the light-emitting layer, referring to the method for preparing the thin film in Material Example 3".

[0177] Device Example 4

[0178] This embodiment provides an optoelectronic device and its fabrication method. Compared with the optoelectronic device in Device Embodiment 1, the difference of the optoelectronic device in this embodiment is that the material of the auxiliary layer is replaced with "the composite material in Material Embodiment 4", and the material of the light-emitting layer is replaced with "a red light-emitting quantum dot with a core-shell structure, the core of the red light-emitting quantum dot is made of CdSe, the red light-emitting quantum dot has a shell, and the shell is made of ZnS".

[0179] Compared to the method for fabricating the optoelectronic device in Device Example 1, the method for fabricating the optoelectronic device in this example differs in that step S10.5 is replaced with "forming an auxiliary layer on the side of the electron transport layer away from the light-emitting layer, referring to the method for fabricating the thin film in Material Example 4".

[0180] Device Example 5

[0181] This embodiment provides an optoelectronic device and its fabrication method. Compared with the optoelectronic device in Device Embodiment 1, the difference of the optoelectronic device in this embodiment is that the material of the auxiliary layer is replaced with "the composite material in Material Embodiment 5", and the material of the light-emitting layer is replaced with "a red light-emitting quantum dot with a core-shell structure, the core of the red light-emitting quantum dot is made of CdSe, the red light-emitting quantum dot has a shell, and the shell is made of ZnS".

[0182] Compared to the method for fabricating the optoelectronic device in Device Example 1, the method for fabricating the optoelectronic device in this example differs in that step S10.5 is replaced with "forming an auxiliary layer on the side of the electron transport layer away from the light-emitting layer, referring to the thin film preparation method in Material Example 5".

[0183] Device Example 6

[0184] This embodiment provides an optoelectronic device and its fabrication method. Compared with the optoelectronic device in Device Embodiment 1, the difference of the optoelectronic device in this embodiment is that the material of the auxiliary layer is replaced with "the composite material in Material Embodiment 6", and the material of the light-emitting layer is replaced with "a red light-emitting quantum dot with a core-shell structure, the core of the red light-emitting quantum dot is made of CdSe, the red light-emitting quantum dot has a shell, and the shell is made of ZnS".

[0185] Compared to the method for fabricating the optoelectronic device in Device Example 1, the method for fabricating the optoelectronic device in this example differs in that step S10.5 is replaced with "forming an auxiliary layer on the side of the electron transport layer away from the light-emitting layer, referring to the method for fabricating the thin film in Material Example 6".

[0186] Device Example 7

[0187] This embodiment provides an optoelectronic device and its fabrication method. Compared with the optoelectronic device in Device Embodiment 1, the difference of the optoelectronic device in this embodiment is that the material of the auxiliary layer is replaced with "the composite material in Material Embodiment 7", and the material of the light-emitting layer is replaced with "blue light-emitting quantum dots with a core-shell structure, the core material of the blue light-emitting quantum dots is CdSe, the blue light-emitting quantum dots have a shell layer, and the shell layer is made of ZnS".

[0188] Compared to the method for fabricating the optoelectronic device in Device Example 1, the method for fabricating the optoelectronic device in this example differs in that step S10.5 is replaced with "forming an auxiliary layer on the side of the electron transport layer away from the light-emitting layer, referring to the method for fabricating the thin film in Material Example 7".

[0189] Device Example 8

[0190] This embodiment provides an optoelectronic device and its fabrication method. Compared with the optoelectronic device in Device Embodiment 1, the difference of the optoelectronic device in this embodiment is that the material of the auxiliary layer is replaced with "the composite material in Material Embodiment 8", and the material of the light-emitting layer is replaced with "blue light-emitting quantum dots with a core-shell structure, the core material of the blue light-emitting quantum dots is CdSe, the blue light-emitting quantum dots have a shell layer, and the shell layer is made of ZnS".

[0191] Compared to the method for fabricating the optoelectronic device in Device Example 1, the method for fabricating the optoelectronic device in this example differs in that step S10.5 is replaced with "forming an auxiliary layer on the side of the electron transport layer away from the light-emitting layer, referring to the method for fabricating the thin film in Material Example 8".

[0192] Device Example 9

[0193] This embodiment provides an optoelectronic device and its fabrication method. Compared with the optoelectronic device in Device Embodiment 1, the difference of the optoelectronic device in this embodiment is that the material of the auxiliary layer is replaced with "the composite material in Material Embodiment 9", and the material of the light-emitting layer is replaced with "blue light-emitting quantum dots with a core-shell structure, the core material of the blue light-emitting quantum dots is CdSe, the blue light-emitting quantum dots have a shell layer, and the shell layer is made of ZnS".

[0194] Compared to the method for preparing the optoelectronic device in Device Example 1, the method for preparing the optoelectronic device in this example differs in that step S10.5 is replaced with "forming an auxiliary layer on the side of the electron transport layer away from the light-emitting layer, according to the method for preparing the thin film in Material Example 9".

[0195] Device Example 10

[0196] This embodiment provides an optoelectronic device and its fabrication method. Compared with the optoelectronic device in Device Embodiment 1, the difference of the optoelectronic device in this embodiment is that the average thickness of the auxiliary layer is replaced with "20nm".

[0197] The fabrication method of the optoelectronic device in this embodiment is the same as that in Device Example 1.

[0198] Device Example 11

[0199] This embodiment provides an optoelectronic device and its fabrication method. Compared with the optoelectronic device in Device Embodiment 1, the difference of the optoelectronic device in this embodiment is that the material of the auxiliary layer is replaced with the composite material in Material Embodiment 4.

[0200] Compared to the method for fabricating the optoelectronic device in Device Example 1, the method for fabricating the optoelectronic device in this example differs in that step S10.5 is replaced with "forming an auxiliary layer on the side of the electron transport layer away from the light-emitting layer, referring to the method for fabricating the thin film in Material Example 4".

[0201] Device Example 12

[0202] This embodiment provides an optoelectronic device and its fabrication method. Compared with the optoelectronic device in Device Embodiment 1, the difference of the optoelectronic device in this embodiment is that the material of the auxiliary layer is replaced with "the composite material in Material Embodiment 10", and the material of the light-emitting layer is replaced with "a red light-emitting quantum dot with a core-shell structure, the core of the red light-emitting quantum dot is made of CdSe, the red light-emitting quantum dot has a shell, and the shell is made of ZnS".

[0203] Compared to the method for fabricating the optoelectronic device in Device Example 1, the method for fabricating the optoelectronic device in this example differs in that step S10.5 is replaced with "forming an auxiliary layer on the side of the electron transport layer away from the light-emitting layer, referring to the thin film preparation method in Material Example 10".

[0204] Device Example 13

[0205] This embodiment provides an optoelectronic device and its fabrication method. Compared with the optoelectronic device in Device Embodiment 1, the difference of the optoelectronic device in this embodiment is that the material of the auxiliary layer is replaced with "the composite material in Material Embodiment 10", and the material of the light-emitting layer is replaced with "blue light-emitting quantum dots with a core-shell structure, the core of the blue light-emitting quantum dots is made of CdSe, the blue light-emitting quantum dots have a shell, and the shell is made of ZnS".

[0206] Compared to the method for fabricating the optoelectronic device in Device Example 1, the method for fabricating the optoelectronic device in this example differs in that step S10.5 is replaced with "forming an auxiliary layer on the side of the electron transport layer away from the light-emitting layer, referring to the thin film preparation method in Material Example 10".

[0207] Device Comparison Example 1

[0208] This comparative example provides an optoelectronic device and its fabrication method. Compared with the optoelectronic device in Device Example 1, the difference in the optoelectronic device in this comparative example is that the auxiliary layer is omitted.

[0209] Compared to the method for fabricating the optoelectronic device in Device Example 1, the method for fabricating the optoelectronic device in this comparative example differs in that step S10.5 is omitted.

[0210] Device Comparison Example 2

[0211] This comparative example provides an optoelectronic device and its fabrication method. Compared with the optoelectronic device in Device Example 1, the difference in this comparative example is that the material of the auxiliary layer is replaced with "gold nanoparticles".

[0212] Compared to the method for fabricating the optoelectronic device in Device Example 1, the method for fabricating the optoelectronic device in this example differs in that step S10.5 is replaced with "the method for fabricating the thin film in Comparative Example 1 of the reference material forms an auxiliary layer on the side of the electron transport layer away from the light-emitting layer".

[0213] Device Comparison Example 3

[0214] This comparative example provides an optoelectronic device and its fabrication method. Compared with the optoelectronic device in Device Example 1, the difference in this comparative example is that the auxiliary layer is omitted, and the material of the light-emitting layer is replaced with "a red light-emitting quantum dot with a core-shell structure, the core of the red light-emitting quantum dot is made of CdSe, and the red light-emitting quantum dot has a shell made of ZnS".

[0215] Compared to the method for fabricating the optoelectronic device in Device Example 1, the method for fabricating the optoelectronic device in this comparative example differs in that step S10.5 is omitted.

[0216] Device Comparison Example 4

[0217] This comparative example provides an optoelectronic device and its fabrication method. Compared with the optoelectronic device in Device Example 1, the difference in this comparative example is that the material of the auxiliary layer is replaced with "silver nanoparticles", and the material of the light-emitting layer is replaced with "red light-emitting quantum dots with a core-shell structure, the core of the red light-emitting quantum dots is made of CdSe, and the red light-emitting quantum dots have a shell made of ZnS".

[0218] Compared to the method for preparing the optoelectronic device in Device Example 1, the method for preparing the optoelectronic device in this example differs in that step S10.5 is replaced with "the method for preparing the thin film in Comparative Example 2 of the reference material forms an auxiliary layer on the side of the electron transport layer away from the light-emitting layer".

[0219] Device Comparison Example 5

[0220] This comparative example provides an optoelectronic device and its fabrication method. Compared with the optoelectronic device in Device Example 1, the difference in this comparative example is that the auxiliary layer is omitted, and the material of the light-emitting layer is replaced with "blue light-emitting quantum dots with a core-shell structure, the core of the blue light-emitting quantum dots is made of CdSe, and the blue light-emitting quantum dots have a shell made of ZnS".

[0221] Compared to the method for fabricating the optoelectronic device in Device Example 1, the method for fabricating the optoelectronic device in this comparative example differs in that step S10.5 is omitted.

[0222] Device Comparison Example 6

[0223] This comparative example provides an optoelectronic device and its fabrication method. Compared with the optoelectronic device in Device Example 1, the difference in this comparative example is that the material of the auxiliary layer is replaced with "platinum nanoparticles", and the material of the light-emitting layer is replaced with "blue light-emitting quantum dots with a core-shell structure, the core of the blue light-emitting quantum dots is made of CdSe, and the blue light-emitting quantum dots have a shell made of ZnS".

[0224] Compared to the method for preparing the optoelectronic device in Device Example 1, the method for preparing the optoelectronic device in this example differs in that step S10.5 is replaced with "the method for preparing the thin film in Comparative Example 3 of the reference material is used to form an auxiliary layer on the side of the electron transport layer away from the light-emitting layer".

[0225] Experimental Example 1

[0226] The performance of the thin films from Material Examples 1 to 10 and Material Comparative Examples 1 to 3 was tested. The surface roughness Ra of each thin film was measured using an atomic force microscope. The test results are shown in Table 1 below.

[0227] Table 1

[0228]

[0229] As shown in Table 1, compared with the films in Material Comparative Examples 1 to 3, the surface roughness Ra of the films in Material Examples 1 to 10 is significantly lower. For example, the Ra of the film in Material Example 3 is only 52% of the Ra of the film in Material Comparative Example 1.

[0230] The films in Material Examples 1 to 10 are made of composite materials, utilizing tobacco mosaic virus with a nanorod structure as a self-assembling biological template for metal nanoparticles. Based on the high specific surface area and nanorod structure of tobacco mosaic virus, and the specific binding energy between certain peptide chains in the outer shell protein of tobacco mosaic virus and different types of metal nanoparticles, the metal nanoparticles can be orderly assembled onto the outer shell protein of tobacco mosaic virus, effectively improving the problem of easy aggregation of metal nanoparticles and thus improving the film quality. The films formed by the solution method have good surface smoothness. In contrast, the films in Comparative Examples 1 to 3 are made of metal nanoparticles, which are prone to aggregation during the solution-based film formation process, resulting in poor film quality and a high Ra value.

[0231] Experiment Example 2

[0232] The performance of the optoelectronic devices in Device Examples 1 to 13 and Device Comparative Examples 1 to 6 after 1 hour of packaging was tested. The performance tests were conducted in an environment with a temperature of 25°C and a relative humidity of 50%.

[0233] The testing instruments include the Fostar FPD optical characteristic measurement equipment and the external quantum efficiency optical testing instrument. The Fostar FPD optical characteristic measurement equipment is an efficiency testing system built from components such as Ocean Optics USB2000, LabVIEW-controlled QE-PRO spectrometer, Keithley 2400, high-precision digital source meter Keithley 6485, 50μm inner diameter optical fiber, device test probes and fixtures, various connecting cables and data cards, efficiency test dark box and data acquisition system. It acquires parameters such as the turn-on voltage, current, brightness, and emission spectrum of each optoelectronic device, and then calculates key parameters such as external quantum efficiency and power efficiency.

[0234] Lifetime testing refers to detecting the time it takes for a device's brightness to decay to a certain percentage of its maximum brightness under a constant current of 2mA. The time it takes for the brightness to decay to 95% of the maximum brightness is defined as T95, and this lifetime is the measured lifetime. To shorten the lifetime testing cycle, device lifetime testing is usually performed at high brightness by accelerating device aging, and the lifetime at low brightness is obtained by fitting a decay fitting formula. For example, the lifetime at a brightness of 1000 nits is denoted as T95@1000nits, and the calculation formula is as follows:

[0235]

[0236] Among them, T95 L The lifespan at low brightness is typically taken as the lifespan at 1000 nits, T95. H The lifetime at high brightness, i.e., the measured lifetime, L H L is the maximum brightness that the device accelerates to. L The typical value is 1000 nits, where A is the acceleration factor, which is set to 1.7.

[0237] The external quantum efficiency (EQE) is measured as the ratio of electron-hole pairs injected into a quantum dot to emitted photons, expressed as a percentage (%). It is a crucial parameter for evaluating the quality of electroluminescent devices and can be obtained using an EQE optical testing instrument. The specific calculation formula is as follows:

[0238]

[0239] Where ηe is the optical output coupling efficiency, ηγ is the ratio of the number of recombinated carriers to the number of injected carriers, x is the ratio of the number of excitons that generate photons to the total number of excitons, KR is the radiative process rate, and KNR is the non-radiative process rate.

[0240] EQE max This represents the maximum external quantum efficiency.

[0241] Voltage@1000nits(V) is the operating voltage under the condition of 1000 nits brightness.

[0242] The performance test data for each optoelectronic device are detailed in Table 2 below:

[0243] Table 2

[0244]

[0245]

[0246] As shown in Table 2, compared with the optoelectronic devices in Device Comparative Examples 1 and 2, the optoelectronic devices in Device Examples 1 to 3 and Device Example 10 have better optoelectronic performance and device lifespan; compared with the optoelectronic devices in Device Comparative Examples 3 and 4, the optoelectronic devices in Device Examples 4 to 6 have better optoelectronic performance and device lifespan; compared with Device Comparative Examples 5 and 6, the optoelectronic devices in Device Examples 7 to 9 have better optoelectronic performance and device lifespan.

[0247] This demonstrates that the electronic functional layer in optoelectronic devices, which includes composite materials based on tobacco mosaic virus and metal nanoparticles, achieves several advantages. On one hand, the orderly assembly of metal nanoparticles onto the outer shell protein of tobacco mosaic virus effectively mitigates the problem of easy aggregation of metal nanoparticles and improves the uniformity of the electronic functional layer. On the other hand, under the excitation of specific wavelength light (red, green, or blue light), the metal nanoparticles generate hot electrons based on the LSPR effect, which locally enhances electron injection, promotes the carrier injection balance of optoelectronic devices, and thus improves the device efficiency and device lifetime.

[0248] In Device Comparison Example 1, Device Comparison Example 3, and Device Comparison Example 5, the auxiliary layer was omitted in all optoelectronic devices, resulting in limited electron injection levels and thus poor device efficiency and lifespan.

[0249] In Comparative Examples 2, 4, and 6, although the optoelectronic devices contain an auxiliary layer, the material of the auxiliary layer is metal nanoparticles. On the one hand, the auxiliary layer formed by the solution method has problems such as uneven film thickness and large surface roughness. On the other hand, the auxiliary layer is a dense metal film, and the light emitted by the light-emitting layer is difficult to excite the metal nanoparticles to resonate, resulting in a limited electron injection level of the optoelectronic device, thus the device efficiency and device lifetime are still poor.

[0250] The foregoing has provided a detailed description of a composite material, a method for preparing the composite material, a thin film, and an optoelectronic device provided in the embodiments of this application. Specific examples have been used to illustrate the principles and implementation methods of this application. The descriptions of the embodiments above are only for the purpose of helping to understand the technical solutions and core ideas of this application; those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of this application.

Claims

1. A composite material, characterized in that, The composite material comprises tobacco mosaic virus and metal nanoparticles, wherein the metal nanoparticles are bound to the outer shell protein of the tobacco mosaic virus.

2. The composite material according to claim 1, characterized in that, The metal nanoparticles include one or more of gold nanoparticles, silver nanoparticles, and platinum nanoparticles. And / or, the average particle size of the metal nanoparticles is 3 nm to 50 nm; And / or, the tobacco mosaic virus is selected from TMV-U1; And / or, by weight percentage, the composite material comprises: 50% to 80% of the metal nanoparticles and 20% to 50% of the tobacco mosaic virus.

3. The composite material according to claim 1 or 2, characterized in that, The genome of the tobacco mosaic virus includes one or more of the first nucleotide sequence shown in SEQ.NO.1, the second nucleotide sequence shown in SEQ.NO.2, and the third nucleotide sequence shown in SEQ.NO.

3. The peptide chains encoded by the first nucleotide sequence, the second nucleotide sequence, and the third nucleotide sequence are respectively bound to the metal nanoparticles. Optionally, when the metal nanoparticles are gold nanoparticles, the metal nanoparticles are bound to the peptide chains encoded by the first nucleotide sequence; or, when the metal nanoparticles are silver nanoparticles, the metal nanoparticles are bound to the peptide chains encoded by the second nucleotide sequence; or, when the metal nanoparticles are platinum nanoparticles, the metal nanoparticles are bound to the peptide chains encoded by the third nucleotide sequence.

4. A method for preparing a composite material, characterized in that, The steps include: providing tobacco mosaic virus and metal nanoparticles, mixing the tobacco mosaic virus, the metal nanoparticles and a first dispersion medium to obtain the composite material.

5. The method for preparing the composite material according to claim 4, characterized in that, The first dispersion medium comprises a fatty alcohol compound of C1 to C10; optionally, the first dispersion medium comprises at least one of methanol, ethanol, ethylene glycol, isopropanol and n-butanol. And / or, the metal nanoparticles include one or more of gold nanoparticles, silver nanoparticles, and platinum nanoparticles. And / or, the average particle size of the metal nanoparticles is 3 nm to 50 nm; And / or, the tobacco mosaic virus is selected from TMV-U1; And / or, in the mixture obtained by mixing the tobacco mosaic virus, the metal nanoparticles, and the first dispersion medium, the titer of the tobacco mosaic virus is less than or equal to 10. 9 PFU / mL; And / or, in the step of mixing the tobacco mosaic virus, the metal nanoparticles and the first dispersion medium, the mass ratio of the tobacco mosaic virus to the metal nanoparticles is 1:(1-4); And / or, after the step of mixing the tobacco mosaic virus, the metal nanoparticles and the first dispersion medium and before the step of obtaining the composite material, the method for preparing the composite material further includes the step of: performing solid-liquid separation on the mixture obtained by mixing the tobacco mosaic virus, the metal nanoparticles and the first dispersion medium, and collecting the solid, wherein the solid is the composite material; Optionally, the solid-liquid separation includes centrifugation, wherein the centrifugation speed is 5000 r / min to 8000 r / min and the centrifugation time is 20 min to 50 min; And / or, the genome of the tobacco mosaic virus includes one or more of the first nucleotide sequence shown in SEQ.NO.1, the second nucleotide sequence shown in SEQ.NO.2, and the third nucleotide sequence shown in SEQ.NO.3, wherein the peptide chain encoded by the first nucleotide sequence, the peptide chain encoded by the second nucleotide sequence, and the peptide chain encoded by the third nucleotide sequence are respectively bound to the metal nanoparticles.

6. A thin film, characterized in that, The material of the film includes the composite material as described in any one of claims 1 to 3, or the composite material prepared by the method described in claim 4 or 5.

7. The thin film according to claim 6, characterized in that, The film includes a biological carrier based on the tobacco mosaic virus and a metal film layer formed by the self-assembly of the metal nanoparticles onto the biological carrier. And / or, the surface roughness of the film is 1.3 nm to 1.8 nm.

8. An optoelectronic device, characterized in that, include: Anode and cathode arranged opposite each other; as well as An electronic functional layer is disposed between the anode and the cathode; The material of the electronic functional layer includes the composite material as described in any one of claims 1 to 3, or the composite material prepared by the method of the composite material preparation method as described in claim 4 or 5, or the electronic functional layer includes the thin film as described in claim 6 or 7.

9. The optoelectronic device according to claim 8, characterized in that, The electronic functional layer includes an electron transport layer and an auxiliary layer stacked together, wherein the auxiliary layer is closer to the cathode than the electron transport layer; the material of the auxiliary layer includes the composite material as described in any one of claims 1 to 3, or the composite material prepared by the method of the composite material preparation as described in claim 4 or 5, or the auxiliary layer includes the thin film as described in claim 6 or 7; And / or, the optoelectronic device further includes a light-emitting layer disposed between the anode and the electronic functional layer, the material of the light-emitting layer including one or more of organic light-emitting materials and light-emitting quantum dots; optionally, the light-emitting quantum dots include one or more of red quantum dots with emission wavelengths greater than 600 nm, green quantum dots with emission wavelengths selected from 501 nm to 600 nm, and blue quantum dots with emission wavelengths selected from 450 nm to 500 nm; And / or, the optoelectronic device further includes a hole functional layer, the hole functional layer including a hole injection layer and / or a hole transport layer, wherein for the hole functional layer including the hole injection layer and the hole transport layer, the hole injection layer is closer to the anode than the hole transport layer; And / or, the average thickness of the auxiliary layer is 7nm to 20nm.

10. The optoelectronic device according to claim 9, characterized in that, The electron transport layer material includes one or more of a first inorganic compound material, a second inorganic compound material, a group IIB-VIA semiconductor material, a group IIIA-VA semiconductor material, and a group IB-IIIA-VIA semiconductor material; wherein the first inorganic compound material includes one or more of ZnO, TiO2, SnO2, BaO, Ta2O3, Al2O3, and ZrO2, and / or the group IIB-VIA semiconductor material is selected from one or more of ZnS, ZnSe, and CdS, and / or the group IIIA-VA semiconductor material... The material is selected from one or more of InP and GaP, and / or the IB-IIIA-VIA group semiconductor material is selected from one or more of CuInS and CuGaS, and / or the second inorganic compound material includes one or more doped first compounds, the host material of the doped first compound is selected from ZnO, TiO2, SnO2, BaO, Ta2O3, Al2O3 or ZrO2, and the doping element of the doped first compound includes one or more of Mg, Ca, Zr, W, Ga, Li, Al, Ti, Y, In and Sn; And / or, the average thickness of the auxiliary layer is 7 nm to 20 nm; And / or, when the material of the light-emitting layer includes the green quantum dots, the metal nanoparticles include gold nanoparticles; when the material of the light-emitting layer includes the red quantum dots, the metal nanoparticles include silver nanoparticles; when the material of the light-emitting layer includes the blue quantum dots, the metal nanoparticles include platinum nanoparticles. And / or, the material of the hole functional layer includes one or more of organic compounds, a third inorganic compound material, and a fourth inorganic compound material; wherein, the organic compound includes poly(3,4-vinyldioxythiophene):poly(styrene sulfonic acid), copper phthalocyanine, titanium phthalocyanine, 2,3,5,6-tetrafluoro-7,7',8,8'-tetracyanodimethyl-p-benzoquinone, 2,3,6,7,10,11-hexacyano-1,4,5,8,9,12-hexaazabenzophenanthrene, polyaniline, polypyrrole, 3-hexyl-substituted polythiophene, poly(9-vinylcarbazole), 4,4'-bis(9-carbazole)biphenyl, poly[bis(4-phenyl)(4-butylphenyl)amine], 4 4'-Cyclohexylbis[N,N-di(4-methylphenyl)aniline], poly[(9,9-dioctylfluorenyl-2,7-diyl)-co-(4,4'-(N-(4-sec-butylphenyl)diphenylamine)], poly[(N,N'-(4-n-butylphenyl)-N,N'-diphenyl-1,4-phenylenediamine)-ALT-(9,9-di-n-octylfluorenyl-2,7-diyl)], 4,4',4'-tris(N-3-methylphenyl-N-phenylamino)triphenylamine, 4,4',4”-tris(carbazole-9-yl)triphenylamine, 4,4',4'-tris(2-naphthylphenylamino)triphenylamine, N,N'-diphenyl-N,N'-(1-naphthyl) -1,1'-biphenyl-4,4'-diamine, N,N'-diphenyl-N,N'-di(3-methylphenyl)-1,1'-biphenyl-4,4'-diamine, N,N'-bis[4-(diphenylamino)phenyl]-N,N'-diphenylbenzidine, N,N'-bis(3-methylphenyl)-N,N'-diphenyl-9,9-spirodifluorene-2,7-diamine, N2,N7-di-1-naphthyl-N2,N7-diphenyl-9,9'-spirodi[9H-fluorene]-2,7-diamine, poly[bis(4-phenyl)(2,4,6-trimethylphenyl)amine] and 2,2',7,7'-tetra[N,N-di(4-methoxyphenyl)amino]- The fourth inorganic compound material comprises one or more of 9,9'-spirofluorene, and / or the third inorganic compound material comprises one or more of graphene, C60, nickel oxide, molybdenum oxide, tungsten oxide, vanadium oxide, p-type gallium nitride, chromium oxide, copper oxide, copper sulfide, molybdenum sulfide, and tungsten sulfide, and / or the fourth inorganic compound material comprises one or more doped second compounds, wherein the host material of the doped second compound comprises graphene, C60, nickel oxide, molybdenum oxide, tungsten oxide, vanadium oxide, p-type gallium nitride, chromium oxide, copper oxide, copper sulfide, molybdenum sulfide, or tungsten sulfide, and the doping element of the doped second compound is selected from one or more of nickel, molybdenum, tungsten, vanadium, chromium, copper, and platinum group metals.

Images