Engineered strain modified based on metabolic pathway of mycolic acid

Abstract

The invention provides an engineered strain as well as a construction method and application thereof. Provided are engineered strains comprising modifications, the modifications comprising: (a) expression of a gene FbpC1 that reduces transfer of trehalose monomycoic acid methyltransferase (TMM) to the cell wall; (b) the expression of a gene UmaA1 of the cyclopropane mycolic acid methyltransferase family that reduces a chemical modification process that diverse the structure of mycolic acid (MA); or (c) increasing the expression of a gene PatA that negatively regulates the enzyme of the mycolic acid synthetic pathway; wherein the alteration of expression is relative to the source strain that does not comprise the modification. According to the invention, the damage of chemical or physical methods to thalli is avoided, and the method has the advantages of simple process, low cost, high conversion efficiency and good stability.

Description

Technical Field

[0001] This disclosure relates to the field of microbiology, and more specifically, to an engineered strain based on a modified mycobacterial acid metabolic pathway. Background Technology

[0002] Currently, approximately 400 types of steroidal drugs have been approved for clinical use both domestically and internationally, making its market size second only to antibiotics. China, as the world's largest producer of steroidal hormone drugs and steroidal raw materials, has an annual output value exceeding 10 billion yuan. Therefore, improving the efficient production of steroidal raw materials is of great strategic significance for promoting the development of my country's steroidal pharmaceutical industry. Androstenedione (4-AD), as a steroidal drug intermediate, can be used to synthesize almost all hormone-based steroidal drugs, such as cortisone, progesterone, testosterone, and prednisolone.

[0003] Although various microorganisms such as actinomycetes, molds, and yeasts can degrade phytosterol side chains and produce 4-AD, such as Pseudomonas... Pseudomonas sp. NCIB 10590 can degrade the β-sitosterol side chain to generate 4-AD. However, only mycobacteria can be used for large-scale industrial production to convert different steroidal components in commercial phytosterols into steroid drug intermediates. Mycobacteria isolated from nature... Mycobacterium sp. NRRL B-3805 is the first bacterium used for the industrial-scale conversion of phytosterols to 4-AD, and its process of degrading the β-sitosterol side chain to produce 4-AD has been elucidated, identifying 11 enzymes involved in a 16-step side-chain-catalyzed reaction. Other mycobacterial strains for industrial applications, such as *Mycobacterium*, have subsequently been isolated. Mycobacterium sp. NwIB-01 and Mycobacterium HGMS2. So far, all these strains belong to the Mycobacterium neogoldenense group. However, the natural barrier function of the bacterial cell wall severely hinders the entry of steroid substrates into the cell to contact the converting enzyme, and also limits product secretion, which has become the core bottleneck restricting the improvement of transformation efficiency.

[0004] In existing technologies, improving cell wall permeability mainly relies on chemical reagents (such as EDTA and lysozyme) or physical methods (such as ultrasonic disruption and high-pressure homogenization). However, these methods have significant drawbacks: 1. Highly destructive, easily leading to cell inactivation: The above methods are essentially "violent" destruction of the cell wall. While increasing permeability, they easily damage the cell structure, leading to cell death or loss of invertase activity, thus reducing the overall conversion efficiency; 2. Complex process and high cost: Chemical methods require the addition of a large amount of reagents, and subsequent complex separation and purification steps are needed to remove impurities, significantly increasing production costs and process complexity; 3. Poor stability and repeatability: The effects of chemical or physical treatments are easily affected by various factors such as temperature, pH, and reagent concentration, resulting in large fluctuations in experimental results and making it difficult to achieve stable and controllable large-scale production.

[0005] Although some studies have attempted to modify bacterial strains through genetic engineering, their strategies have mostly focused on regulating transport proteins on the cell membrane or secretion-related accessory proteins, lacking a systematic and targeted approach to modifying the cell wall, the main barrier. Currently, there is no mature technology to gently and controllably alter the cell wall structure by precisely regulating the expression of the main cell wall synthetic genes, thereby efficiently enhancing its permeability to steroid substances.

[0006] Therefore, there is an urgent need in this field for a method that can accurately, gently, stably and at low cost improve bacterial cell wall permeability in order to overcome the many shortcomings of existing technologies. Summary of the Invention

[0007] The technical problem to be solved by this disclosure is to provide a genetically engineered strain HGMS10 (strain preservation number CCTCC NO: M 2019493) to improve its cell permeability, which can be used for the efficient preparation of 4-androsten-3,17-dione (4-AD).

[0008] To address the aforementioned technical problems, this disclosure improves the permeability of the mycobacterial cell wall by knocking out the gene DXK33_RS09625 (FbpC1), which reduces the normal transfer of trehalose monocarboxylate (TMM, mature mycoic acid (MA)) to the cell wall; the gene DXK33_RS19915 (UmaA1), which is a member of the cyclopropane mycoic acid methyltransferase family that enables chemical modification processes that diversify MA structures; and the enzyme DXK33_RS12760 (PatA), which negatively regulates the MA synthesis pathway. This increases the uptake of β-sitosterol and the production of 4-AD.

[0009] This disclosure provides an engineered bacterial strain comprising modifications, the modifications including:

[0010] (a) Reduce the expression of FbpC1, a gene involved in the translocation of trehalose monocarboxylate (TMM) to the cell wall;

[0011] (b) Reduce the expression of UmaA1, a gene in the cyclopropanemycolate methyltransferase family involved in chemical modifications that contribute to the structural diversity of mycolic acid (MA); or

[0012] (c) Increase the expression of the gene PatA, which is an enzyme that negatively regulates the mycolic acid synthesis pathway;

[0013] The change in expression is relative to the source strain that does not contain the modification.

[0014] In some embodiments, the source strain is Mycobacterium HGMS10.

[0015] In some embodiments, reducing the expression of the gene FbpC1, which reduces the transfer of trehalose monomycobacterial acid methyltransferase (TMM) to the cell wall, includes knocking out the FbpC1 gene from the source strain.

[0016] In some embodiments, reducing the expression of the gene UmaA1, a member of the cyclopropane mycolic acid methyltransferase family, which is involved in chemical modification processes that contribute to the diversity of mycolic acid (MA) structures, includes knocking out the UmaA1 gene from the source strain.

[0017] In some embodiments, increasing the expression of the enzyme PatA, which negatively regulates the mycolic acid synthesis pathway, includes introducing a vector expressing the PatA gene into the source strain.

[0018] In some embodiments, the modification includes at least two of (a), (b), and (c).

[0019] Another embodiment of this disclosure provides a method for constructing engineered bacterial strains, including:

[0020] (a) Knockout of the FbpC1 gene from the source strain;

[0021] (b) Knock out the UmaA1 gene from the source strain; or

[0022] (c) Introduce a vector expressing the gene PatA into the source strain.

[0023] In some embodiments, the method includes at least two of (a), (b), and (c).

[0024] In some embodiments, the source strain is Mycobacterium HGMS10.

[0025] This disclosure also provides the use of engineered strains containing modifications or engineered strains constructed by the above methods in the preparation of 4-androstene-3,17-dione (4-AD).

[0026] This disclosure does not rely on "violent" disruption or the expansion of "transport windows," but directly modifies the synthesis pathway of mycolic acid (MA), a core component of the cell wall. By knocking out genes related to TMM transport and MA modification, and overexpressing key enzymes that negatively regulate the MA synthesis pathway, the cell wall structure is fundamentally weakened, achieving a significant increase in permeability, and consequently, a qualitative leap in steroid conversion rate. Because this disclosure achieves precise regulation at the gene level, it avoids direct damage to the bacterial cells from chemical reagents or physical methods; the modified strain can maintain normal physiological metabolism and high activity, thus ensuring continuous and efficient conversion capabilities. The genetically engineered strain obtained by this disclosure undergoes a fermentation process essentially the same as ordinary strains, requiring no additional chemical reagents or complex processing steps. This greatly simplifies the process, reduces production costs, and is highly suitable for large-scale industrial production. The strain of this disclosure exhibits high consistency and stability in different batches of fermentation, making product quality easier to control. Attached Figure Description

[0027] Figure 1 (A): PCR validation of p2NILSac-KasB vector knockout; HGMS10 ΔKasB (A) PCR product amplified from a putative colony carrying the p2NILSac-KasB vector; (B) PCR verification of the p2NILSac-HadA vector knockout. HGMS10 ΔHadA (C) PCR product amplified from a putative colony carrying the p2NILSac-HadA vector. PCR validation of pMV261-HadAB vector overexpressing HGMS10. Marker: DNA marker; HGMS10 HadAB (D) PCR product amplified from a putative colony carrying the pMV261-HadAB vector; PCR verification of p2NILSac-HadD vector knockout; HGMS10 ΔHadD (E) PCR product amplified from putative colonies carrying the p2NILSac-HadD vector; (E) PCR validation of p2NILSac-UmaA1 vector knockout; HGMS10 ΔUmaA1 : PCR product amplified from putative colonies carrying the p2NILSac-UmaA1 vector; (F): PCR verification of p2NILSac-CMAS1 / CMAS2 vector knockout; HGMS10 ΔCMAS1 PCR product amplified from a putative colony carrying the p2NILSac-CMAS1 vector; HGMS10 ΔCMAS2: PCR product amplified from a putative colony carrying the p2NILSac-CMAS2 vector; (G): PCR verification of p2NILSac-CMAS3 vector knockout; HGMS10 ΔCMAS3 : PCR product amplified from a putative colony carrying the p2NILSac-CMAS3 vector; (H): PCR verification of the p2NILSac-CMAS4 vector knockout; HGMS10 ΔCMAS4 (I) PCR products amplified from putative colonies carrying the p2NILSac-CMAS4 vector; (II) PCR verification of p2NILSac-MmpL3 vector knockout; HGMS10 ΔMmpL3 PCR products amplified from putative colonies carrying the p2NILSac-MmpL3 vector; (J): PCR verification of p2NILSac-FbpC1 vector knockout; HGMS10 ΔFbpC1 (K): PCR product amplified from putative colonies carrying the p2NILSac-FbpC1 vector; HGMS10 ΔFbpC2 : PCR product amplified from putative colonies carrying the p2NILSac-FbpC2 vector; (L): PCR verification of p2NILSac-PatA vector knockout; HGMS10 KI PatA : PCR product amplified from putative colonies carrying the p2NILSac-PatA vector; (M): PCR verification of p2NILSac-EphD vector knockout; HGMS10 ΔEphD : PCR product amplified from putative colonies carrying the p2NILSac-EphD vector; Marker: DNA marker; HGMS10: PCR product amplified from colonies without gene knockout.

[0028] Figure 2 Transformation of recombinant strains in 1 g / L β-sitosterol.

[0029] Figure 3 (A) in: HGMS10, HGMS10 KI PatA HGMS10 ΔUmaA1 HGMS10 ΔFbpC1 Growth characteristics of recombinant strains with two and three gene combinations in F1 medium containing 1 g / L β-sitosterol. (B): Evaluation of 4-AD yield of recombinant strains in a transformation system containing 5 g / L β-sitosterol. Data are presented as mean ± standard deviation of three measurements.

[0030] Figure 4 HGMS10 ΔFbpC1+KI PatA HPLC chromatogram of the fermentation broth extract of the strain. 1: 4-AD; 2: BA.

[0031] Figure 5 The effects of gene recombination on cell permeability and mycolic acid (MAME) of the strain are shown. (A): FDA penetration in the recombinant strain. (B): Polar mycolic acids TMM and TDM isolated from cells after culture in the presence of 1.0 g / L β-sitosterol transformation, analyzed by TLC. (C): Relative strengths of TDM and TMM relative to total mycolic acids. (D): MAME isolated from cells after culture in the presence of 1.0 g / L β-sitosterol transformation, analyzed by TLC. (E): Relative strengths of α-, methoxy-, and keto-MA relative to total MAME. Detailed Implementation

[0032] The following embodiments are intended to enable those skilled in the art to more fully understand the present invention, but do not limit the invention in any way.

[0033] Mycobacterium ginseng HGMS2 ( Mycobacterium sp. HGMS2 is one of the most important strains used in the pharmaceutical industry for the conversion of phytosterols. Its cell wall core is composed of mycolic acid (MA), arabinogalactan (AG), and peptidoglycan (PG) covalently linked together. Among them, MA accounts for 40-60% of the cell dry weight and may be one of the key factors in maintaining cell wall stability and low cell permeability.

[0034] The biosynthesis of melatonin (MA) involves a multi-step enzymatic pathway. The fatty acid synthase I (FAS I) system is the initiator of MA, providing Malonyl-ACP to the FAS II system simultaneously with the synthesis of Carboxyacyl-CoA (α-branch). After synthesizing an acyl-ACP of a certain length, FAS II undergoes a series of modifications to yield Meromycoloy I-AMP. These modifications include the introduction of a cis double bond and catalysis by the S-adenosyl-Methionine (SAM)-dependent methyltransferase (MT) family (UmaA1, PacA (formerly UmaA2), CmaA1-2, MmaA1-4), which are crucial for the structural diversity of MA. Finally, Carboxyacyl-CoA and Meromycoloy I-AMP undergo Claisen condensation to form trehalose monocarboxylate (TMM). TMM is transported to the periplasmic domain via MmpL3 flipping, and then crosses the pericytoplasm to the mycolic acid layer with the assistance of molecular chaperones. There, it is converted into trehalose dimycoester (TDM) or a mycolic acid-arabinogalactan-peptidoglycan complex (m-AGP) by a complex composed of three transesterases (Encoded by FbpA, FbpB, and FbpC, respectively). TDM is the most abundant glycolipid on the mycobacterial outer membrane and determines the hydrophobic barrier properties of the cell wall. Recently, the inventors identified two genes encoding AG85C, FbpC1 and FbpC2, in the HGMS10 strain. The deletion of FbpC2 has no effect on sterol conversion, suggesting it may not be a key gene affecting AG85C function.

[0035] Several essential proteins are involved in MA biosynthesis, such as the genes encoding FAS I (fas, AccD4, AccD5, and AccD6) in FAS I, and InhA, MabA, KasA, HadB, and DesA2 (desaturation of acyl-ACP) in FAS II. Studies have shown that knockout of non-essential genes in the MA biosynthetic pathway can induce stable defects only in the cell wall without hindering cell survival, while simultaneously enhancing the conversion efficiency of sterols in engineered strains. For example, knockout of the genes encoding β-ketoacyl-ACP synthase KasB, the transmembrane transport protein MmpL3, and FbpC3 (AG85C) can disrupt the integrity of the MA layer, thereby significantly increasing cell wall permeability and enhancing sterol substrate conversion.

[0036] UmaA1, as a member of the methyltransferase (MT) family, can perform cyclopropaneation and methylation modifications on desaturated meromycolic chains. In Mycobacterium smegmatis MC2 155, the UmaA homolog MSMEG_0913 is responsible for introducing methyl groups at positions adjacent to the trans-cyclopropyl or trans-double bonds near the proximal ends of α-MA and epoxy-MA, thereby affecting the structural diversity of MA.

[0037] Phosphatidylinositol mannoside acyltransferase (PatA) is responsible for transferring the palmitoyl group to the 6-position of the mannose ring, which is linked to the 2-position of inositol in PIM1 and PIM2, forming Ac1PIM1 and Ac1PIM2. PatA also has a negative regulatory effect on MA.

[0038] Therefore, this disclosure uses an internal homologous recombination method to knock out KasB, HadA, HadAB, HadD, UmaA1 (DXK33_RS19915), CMAS1 (DXK33_RS18860), CMAS2 (DXK33_RS18865), CMAS3 (DXK33_RS19960), CMAS4 (DXK33_RS19965), MmpL3, FbpC1, FbpC2, and EphD, a gene related to cell permeability, from HGMS10, while overexpressing PatA, which has a negative regulatory effect on MA. The effects of these gene deletions / overexpressions and their combination expression on 4-AD production were measured, and then changes in cell permeability and MA components in the strain were investigated.

[0039] A preliminary analysis was conducted on the accumulation of 4-AD molar conversion efficiency of the recombinant strain after transformation in F1 medium containing 1 g / L β-sitosterol for 196 h. Figure 2 Compared to HGMS10, HGMS10... ΔUmaA1 and HGMS10 ΔFbpC1 and HGMS10 KI PatA The conversion rates increased by 42.7%, 57.3%, and 33%, respectively, for HGMS10. ΔKasB HGMS10 ΔCMAS1 HGMS10 ΔCMAS2 and HGMS10 ΔCMAS3 The conversion rate decreased significantly.

[0040] Based on the above results, strains that improved sterol conversion were initially screened, and the recombinant strain HGMS10 was subsequently further investigated. ΔUmaA1 HGMS10 ΔFbpC1 HGMS10 KI PatA Effects on sterol conversion and cell growth. Regarding sterol conversion, HGMS10... ΔFbpC1+KI PatAThe recombinant strain produced 2.72 g / L of 4-AD 144 h after transformation, which was comparable to that of HGMS10 at the same time. ΔFbpC1 The 4-AD yields (2.70 g / L) were similar, but HGMS10 ΔFbpC1 After 192 hours of transformation, the recombinant strain showed a slight decrease in 4-AD production to 2.48 g / L, while HGMS10... ΔFbpC1+KI patA The yield of recombinant strain 4-AD increased to 3.21 g / L, with a molar yield of 92.38%, both higher than that of HGMS10. ΔFbpC1 HGMS10 KI patA In terms of cell growth, HGMS10 ΔFbpC1+KI PatA HGMS10 ΔUmaA1+KI PatA The logarithmic growth phase of HGMS10 was 24–60 h, while that of HGMS10 was 24–48 h. Furthermore, at 60 h, the recombinant strain showed a slightly higher growth rate than HGMS10. ΔUmaA1 / ΔFbpC1 The growth rate of HGMS10 was significantly lower than that of HGMS10 during the 36–60 h period. ΔUmaA1 / ΔFbpC1+KI PatA The growth rate during the logarithmic growth phase was lower than that of HGMS10, and a rapid decline occurred after 48 hours. Therefore, combining the two genes (FbpC1 and PatA) involved in the synthesis and assembly of MA-related components through recombination is an effective method to further improve biotransformation efficiency. Figure 3 ).

[0041] Based on the above results, it is speculated that this change is due to altered cell permeability. To confirm this hypothesis, the cell permeability of the recombinant strain was assessed using a fluorescein diacetate (FDA) assay. Intracellular nonspecific esterases cleave the ester bond of FDA, producing fluorescein, which can be excited by an argon laser at a wavelength of 492 nm. By analyzing the fluorescence intensity of the FDA-labeled recombinant strain, the cell permeability of the recombinant strain can be indirectly detected. HGMS10 KI PatA HGMS10 ΔFbpC1 HGMS10 ΔUmaA1 The fluorescence intensity of the recombinant strain was approximately 60.7%, 21.2%, and 39.3% higher than that of HGMS10 after 30 minutes of reaction, indicating that the FDA penetration rate in the cells of the recombinant strain was significantly higher than that of HGMS10. Furthermore, HGMS10... ΔFbpC1+KI PatA The recombinant strain showed a 68.6% increase in FDA penetration after 30 min of incubation compared to HGMS10. This confirmed that the improved cell permeability was associated with the deletion of UmaA1 and FbpC1 and the overexpression of PatA, thereby accelerating sterol utilization. Figure 5 ).

[0042] The increased cell permeability may be due to alterations in the corresponding metabolites (MAs) in the cell wall caused by modifications of PatA, FbpC1, and UmaA1, leading to increased cell wall fluidity. The changes in the contents of polar TDM, TMM, and methyl mycotoxin (MAME) in the recombinant strain were determined by thin-layer chromatography (TLC). HGMS10, HGMS10 ΔUmaA1 HGMS10 ΔFbpC1 HGMS10 KI PatA HGMS10 ΔFbpC1+KI PatA The relative abundances of polar TDM and TMM strains were 26.8:73.2, 24.7:75.3, 23.4:76.7, 39.6:60.4, and 37.6:62.4, respectively. Compared with HGMS10, HGMS10... ΔFbpC1+KI PatA The relative content of TDM increased by 40.1%, while the composition of α-, methoxy-, and keto-MA remained largely unchanged; HGMS10 ΔFbpC1+KI PatA The absence of FbpC1 in the strain resulted in a lower relative content of TMM compared to HGMS10. Figure 5 ).

[0043] Therefore, this disclosure confirms that UmaA1, FbpC1, and PatA participate in regulating the biosynthesis of steroidal antimicrobial agents (MA), and they can effectively increase the production of 4-AD by modifying the cell wall. The deletion of FbpC1 combined with overexpression of PatA has been proven to be an effective method to increase cell permeability and promote the production of the steroidal intermediate 4-AD. The technical solution of this disclosure directly targets the core pathway of cell wall biosynthesis, achieving efficient, stable, and heritable modification of cell permeability. Therefore, this disclosure not only deepens the theoretical understanding of the mechanism of microbial cell wall synthesis, but also provides a highly valuable technical means for improving the production efficiency of steroidal drugs in industrial applications, possessing broad industrialization prospects and economic value.

[0044] The following description, in conjunction with specific embodiments, will provide a better understanding of this disclosure.

[0045] Example 1: Construction of gene knockout homologous recombination vectors and gene overexpression vectors

[0046] This disclosure uses a homologous recombination method to obtain... Mycobacterium The gene knockout vector was constructed by knocking out KasB, HadA, HadAB, HadD, UmaA1, CMAS1, CMAS2, CMAS3, CMAS4, MmpL3, FbpC1, FbpC2, and EphD from the genome of strain sp. HGMS10. Kanamycin was selected as the antibiotic resistance marker, and the sucrose lethal gene (SacB) was selected as the secondary selection marker. M. neoaurumPatA was amplified on the HGMS2 genome and ligated into the pMV261 vector to overexpress the function of the corresponding defective gene in HGMS10.

[0047] Using the plasmid p2NIL containing the kanamycin gene as a template, SacB was integrated into the plasmid p2NILSac. To knock out these genes, PCR amplification was performed on DNA fragments flanking each target gene (1000 bp), which were then inserted into the BamHI and HindIII sites of the p2NILSac vector. Two recombinant vectors were ultimately constructed to knock out these genes from the M.sp. HGMS10 genome. PCR assays confirmed the effectiveness of the constructed vectors. Figure 1 Using plasmid pMV261 containing the kanamycin gene as a template, PatA was integrated into the EcoRI and HindIII sites of plasmid pMV261. This vector was named pMV261-PatA, and PCR analysis confirmed the successful integration of the constructed vector. Figure 1 Table 1 lists the primers used for constructing knockout and overexpression vectors.

[0048] Table 1.

[0049] Primers Description -UF&UR CGGGATCCactggaactcctcgaacggc&GCTCTA gaaccaaagtaagacccgaggg -DF&DR GCTCTAGAtccccacctcatgtactgcg&CCCAAGCTT gctggccgttcagatgatca -UF&UR CGGGATCCagcgccatgaatcaggccaa&GCTCTAGAggcttttcagatggcactgc -DF&DR GCTCTAGAgggatagcgatagtgcatccc&CCCAAGCTTcagcagaaaaccggcctca -UF&UR CGGGATCCccatctcgacatcgtcgcg&GCTCTAGAgtccggttcagctgagttcagt -DF&DR GCTCTAGAgccgacccgttcttgaagtg&CCCAAGCTTcggtaaccagccgatgaacg -UF&UR CGGGATCCcacctccgaactgtcgaagc&GCTCTAGA gacttcttccgccggggtat -DF&DR GCTCTAGAgtcgtagatggactgcgact&CCCAAGCTTggtgctggtcttcgagccca -UF&UR CGGGATCCgctggatcaactcggcatcg&GCTCTAGAacgtccggtcaatgttgtatc 1-DF&DR GCTCTAGAcagttcacgatggtcaagtaagacg&CCCAAGCTTtggaagacgccgaagaaatcat 2-UF&UR ​ ​ ​ ​ ​ ​ GCTCTAGAcagttcaccctcgaaaaggg&CCCAAGCTTtcggtgatgatgaatttcacga 4-UF&UR CGGGATCCcgatggtgtgatgatgctgc&GCTCTAGAaaactcgtcggacaggtcgtag 4-DF&DR GCTCTAGAtgatcggtcgtcagaggcag&CCCAAGCTTggagtcggcagaagtcacaca -UF&UR CGGGATCCcttgcacgaagaccaggagg&GCTCTAGAaccaggcgaacacgtcagct -DF&DR GCTCTAGAgtctgtaagggcttcgggct&CCCAAGCTTggcattggtggatcaagtgtct -UF&UR CGGGATCCgaacgaatagatgatgcccagg&GCTCTAGAtgacggactgacccgacac -DF&DR GCTCTAGAgcaatcgccgttgctttct&CCCAAGCTTaccgacgagttcagtacccc 2-UF&UR CGGGATCCgaacatcgtcttgggtgcc&GCTCTAGActtccgccctcctgagtatt 2-DF&DR GCTCTAGAatgcgtcatgcacggcaaac&CCCAAGCTTcccccttcggagaccaaac -F&R CGGAATTCccgaacgtgcgcggtttcc&CCCAAGCTTctagcttccttcgaggcgag -UF&UR CGGGATCCtacctcgagcagtggctcgt&CGGAATTCtgacatggctacccctctagttc -DF&DR CGGAATTCacacggcttctcgtgaaaagc&CCCAAGCTTcacatgacctccgatatgggc

[0050] Example 2: Fermentation process for converting β-sitosterol using HGMS10 wild-type and mutant strains

[0051] This experiment was conducted in 250ml Erlenmeyer flasks. F1 medium was used for phenotypic identification: 1g / L β-sitosterol, 15g / L yeast extract, 5.4g / L ammonium nitrate, 0.6g / L diammonium hydrogen phosphate, 8g / L glucose, 3g / L β-cyclodextrin, and 0.5g / L Tw80. F2 medium was used for fermentation: 5g / L β-sitosterol, 15g / L yeast extract, 5g / L ammonium nitrate, 0.6g / L diammonium hydrogen phosphate, 10g / L glucose, 15g / L β-cyclodextrin, 3g / L lecithin, 180g / L soybean oil, and 1g / L antifoaming agent. Both F1 and F2 media were sterilized at 115℃ for 20min. Mycobacteria were cultured at 30℃ and 200 rpm, with samples taken periodically for testing until fermentation was complete.

[0052] Example 3 HPLC analysis of 4-AD in fermentation extract

[0053] M.sp. HGMS10 exhibits good conversion rate and 4-AD yield. The successful HGMS10 will be validated. ΔUmaA1 HGMS10 ΔFbpC1 and HGMS10 KI PatAThe strain underwent small-scale fermentation of β-sitosterol. After 7 days of fermentation, the fermentation broth was thoroughly mixed with ethyl acetate at a 1:1 ratio for extraction, and the relative yield of the product was determined. The amount of product could be accurately determined using HPLC under the following conditions: a UV x detector was used; the detection wavelength for steroidal compounds with conjugated double bonds was set to 254 nm; the detection wavelength for steroidal compounds without conjugated double bonds was set to 210 nm; the chromatographic column was a SunFire™ C18 (4.6 mm × 150 mm, 5.0 μL, Waters); the mobile phase was chromatographic grade acetonitrile and water (V methanol:V water = 8:2); the flow rate was set to 1 mL / min; the injection volume was 5 μL; and the column temperature was set to 30 °C. Figure 2 As shown, the main component in the fermentation process is 4-AD, and the byproduct is androst-4-en-3-one-17β-ol (BA).

[0054] Example 4: Cell permeability and lipid extraction from mycobacterial mutants

[0055] 1. Cell permeability: Mycobacterial cells were suspended in 5 mL of phosphate buffer and mixed with 0.1 mL of fluorescein diacetate (FDA) acetone solution (1 g / L). The mixture was shaken at 30 °C and 200 rpm for 30 min. The cells were then detected by a fluorescence spectrophotometer. The maximum excitation wavelength of FDA was 485 nm and the emission wavelength was 540 nm.

[0056] 2. Lipid Extraction: 100 mg (wet weight) of mycobacterial cells were collected by centrifugation at 12000×g for 10 min. The cells were incubated at 56℃ for 2 h, then incubated for 1 h with a mixture of 1 mL methanol and chloroform (2:1, 1:1, 1:2, v / v). The supernatants were combined and dried. The cells were washed with a mixture of 1 mL chloroform and water (1:1) to remove the supernatant. Polar lipids, including TMM and TDM, dissolved in the lower chloroform layer. After drying, the cells were resuspended in methanol and chloroform (1:2). Next, 1.2 mL of 10% tetrabutylammonium hydroxide was added to 50 mg of whole cells, and the mixture was heated at 100℃ overnight. After cooling, 1 mL of dd H2O, 500 μL of dichloromethane, and 500 μL of iodomethane were added to the mixture, and the mixture was stirred for 30 min. The mixture was then centrifuged at 12000×g for 10 min to remove the supernatant. The lower organic layer was washed with 1.5 mL of 1 M hydrochloric acid, followed by 1.5 mL of dd H2O. The reaction solution was dried under a nitrogen stream. The residue was dissolved in a mixture of 200 μL toluene and 100 μL acetonitrile, then 400 μL acetonitrile was added, and the mixture was incubated at 4 °C for 1 h. The extract containing metabolites (MAME) was centrifuged at 12000 × g for 10 min and then resuspended in 50 μL dichloromethane. The extracted polar mycolic acid was analyzed using a silica gel thin-layer chromatography plate in a solvent system (chloroform:methanol, 90:10, v / v). MAME was developed three times in n-hexane:ethyl acetate (95:5). After carbonization and development, the mean gray intensity of the spots in the thin-layer chromatography plate was analyzed in Image J, and the relative abundances of TMM, TDM, and MAME were calculated. Figure 5 The corresponding results are shown.

[0057] This disclosed method employs genetic engineering to precisely modify bacteria in two ways: firstly, by knocking out the key genes UmaA1 and FbpC1 responsible for TMM transport and MA structural modification; and secondly, by overexpressing PatA, which negatively regulates MA synthesis. These two strategies work synergistically to fundamentally weaken the structural integrity of the cell wall and significantly increase its permeability. Compared to existing technologies, this disclosure avoids damage to the bacterial cells using chemical or physical methods, and boasts advantages such as simple process, low cost, high conversion efficiency, and good stability. Fermentation production using the genetically engineered strains disclosed herein can significantly improve the conversion efficiency of β-sitosterol to 4-AD, providing a basis for large-scale industrial production.

[0058] Those skilled in the art should understand that the above embodiments are merely exemplary embodiments, and various changes, substitutions, and modifications can be made without departing from the spirit and scope of the present invention.

Claims

1. An engineered strain comprising modifications, characterized in that, The modifications include: (a) Reduce the expression of FbpC1, a gene that controls the transfer of trehalose monomycobacterium acid methyltransferase (TMM) to the cell wall; (b) Reduce the expression of UmaA1, a gene in the cyclopropanemycolate methyltransferase family involved in chemical modifications that contribute to the structural diversity of mycolic acid (MA); or (c) Increase the expression of the gene PatA, which is an enzyme that negatively regulates the mycolic acid synthesis pathway; The change in expression is relative to the source strain that does not contain the modification.

2. The engineered strain containing the modification according to claim 1, characterized in that, The source strain is Mycobacterium HGMS10.

3. The engineered strain containing the modification according to claim 1, characterized in that, Reducing the expression of FbpC1, a gene that inhibits the transfer of trehalose monomycobacterial acid methyltransferase (TMM) to the cell wall, involves knocking out the FbpC1 gene from the source strain.

4. The engineered strain containing the modification according to claim 1, characterized in that, Reducing the expression of the cyclopropanemycolate methyltransferase family gene UmaA1, which involves chemical modifications that contribute to the structural diversity of mycolic acid (MA), includes knocking out the UmaA1 gene from the source strain.

5. The engineered strain comprising the modification according to claim 1, characterized in that, Increasing the expression of the enzyme PatA, which negatively regulates the mycolic acid synthesis pathway, involves introducing the PatA gene into the source strain.

6. The engineered strain comprising the modification according to claim 1, characterized in that, The modifications include at least two of (a), (b) and (c).

7. A method for constructing engineered bacterial strains, characterized in that, include: (a) Knockout of the FbpC1 gene from the source strain; (b) Knock out the UmaA1 gene from the source strain; or (c) Introduce the PatA gene into the source strain.

8. The method according to claim 7, characterized in that, The method includes at least two of (a), (b) and (c).

9. The method according to claim 7, characterized in that, The source strain is Mycobacterium HGMS10.

10. Use of the engineered strain comprising the modification according to any one of claims 1 to 6 or the engineered strain constructed by the method according to any one of claims 7 to 9 in the preparation of 4-androstene-3,17-dione (4-AD).

Images