Method for inducing embryonic stem cells to be differentiated into original endoderm stem cells

Abstract

The invention discloses application of an epigenetic modification regulation and control substance in inducing transdifferentiation of embryonic stem cells to original endoderm stem cells. The epigenetic modification regulation and control substance is a substance for reducing the expression level of H3K27me3 in the embryonic stem cells. By regulating epigenetic modification, an in-vitro culture system capable of inducing efficient transdifferentiation of ESCs to PrESC is constructed, and functional verification shows that a PrESC cell line is successfully constructed.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method for inducing embryonic stem cells to differentiate into primitive endoderm stem cells. Background Technology

[0002] Preimplantation mouse embryos undergo two important cell fate transitions. The first transition is marked by the formation of the inner cell mass (ICM) and extraembryonic trophectoderm (TE) cell lineages, signifying the transformation from totipotent to pluripotent embryos. The ICM continues to develop to 4.5 days post-coitum, where a second cell fate decision occurs: the ICM forms the embryonic epiblast (EPI) and primitive endoderm (PrE) (Yao, C.; Zhang, W.; Shuai, L., The first cell fate decision in pre-implantation mouse embryos. Cell Regen 2019, 8(2), 51-57.; Gerovska, D.; Arauzo-Bravo, MJ, Computational analysis of single-cell transcriptomics data elucidates the stabilization of Oct4 expression in the E3.25 mouse). Preimplantation embryo. Sci Rep 2019, 9(1), 8930.). In vivo, EPI forms all fetal tissues, and PrE forms the yolk sac. During mouse pregnancy before placental circulation is established, the yolk sac participates in protecting and nourishing the embryo at the maternal-fetal interface (Chowdhary, S.; Hadjantonakis, AK, Journey of the mouse primitive endoderm: from specification to maturation. Philos Trans R Soc Lond B Biol Sci 2022, 377(1865), 20210252.). In vitro, EPI forms embryonic stem cell (ESC) lines, and PrE constructs extraembryonic endoderm (XENC) cell lines. The establishment of these cell lines provides a good cell model for studying the function and mechanism of EPI and PrE. Although XENC originates from PrE, XENC can only be integrated into the parietal endoderm (PE) and cannot fully represent the developmental potential of PrE.Until Yasuhide Ohinata developed a new PrE culture system, culturing a cell type from embryos that can replace the complete function of PrE in the embryo, the PrESC line (primitive endoderm stem cells), has the ability to chimerize into the visceral endoderm (VE) and luminal endoderm. This indicates that PrESC is more representative of the developmental potential of PrE than XENC. Therefore, PrESC is more representative of the in vivo state for studying the transdifferentiation regulation between ESC and PrESC (Ohinata, Y.; Endo, TA; Sugishita, H.; Watanabe, T.; Iizuka, Y.; Kawamoto, Y.; Saraya, A.; Kumon, M.; Koseki, Y.; Kondo, T.; Ohara, O.; Koseki, H., Establishment of mouse stem cells that can recapitulate the developmental potential of primitive endoderm. Science). 2022, 375(6580), 574-578.). Epigenetic modifications play an important regulatory role in the establishment of cell lineage fate and transdifferentiation in early embryonic cells (Dietrich, JE; Hiiragi, T., Stochastic patterning in the mouse pre-implantation embryo. Development 2007, 134(23), 4219-31.), but the mechanisms by which epigenetics regulate the transdifferentiation of ESCs into PrESCs are still poorly understood. This makes it very difficult to construct a culture system that can effectively induce the transdifferentiation of ESCs into PrESCs in vitro by regulating epigenetic modifications.

[0003] PrE cells are one of the three cell types in mouse blastocysts and are crucial for early embryonic development. Previous studies have mainly focused on the transdifferentiation of mouse ESCs into XENCs (which have some of the functions of PrE cells), but the transdifferentiation of ESCs into functional PrESCs has not yet been reported. Summary of the Invention

[0004] The first aspect of the present invention is to provide a method for inducing embryonic stem cells to differentiate into primitive endoderm stem cells.

[0005] A second aspect of the present invention is to provide a primitive endoderm stem cell.

[0006] The third aspect of this invention aims to provide applications of primitive endoderm stem cells.

[0007] The fourth aspect of this invention aims to provide the application of EZH2 inhibitors.

[0008] The fifth aspect of this invention aims to provide a product.

[0009] The sixth aspect of this invention aims to provide a method for constructing primitive endoderm stem cell lines.

[0010] The seventh aspect of this invention aims to provide a method for preparing blastocysts.

[0011] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0012] In a first aspect, the present invention provides a method for inducing embryonic stem cells to differentiate into primitive endoderm stem cells, comprising the step of reducing the content and / or activity of histone H3K27me3 methyltransferase in the embryonic stem cells.

[0013] In one embodiment, the method for reducing the content and / or activity of histone H3K27me3 methyltransferase in the embryonic stem cells is to treat the embryonic stem cells with an EZH2 inhibitor.

[0014] In one embodiment, the EZH2 inhibitor comprises at least one of a substance that inhibits EZH2 activity, a substance that degrades EZH2, and a substance that reduces the expression level of EZH2.

[0015] In one embodiment, the substance that reduces EZH2 expression levels is at least one of (a1)-(a3):

[0016] (a1) siRNA, dsRNA, miRNA, ribozyme, sgRNA or shRNA targeting EZH2;

[0017] (a2) expresses the nucleic acid molecule of (a1);

[0018] (a3) includes expression cassettes, vectors, transgenic cell lines, microorganisms, or viruses that contain (a2).

[0019] In one implementation, (a1) is an sgRNA that targets EZH2.

[0020] In one embodiment, the sequence of the sgRNA is:

[0021] GCGCTGTAGTATGTAATGCAC(SEQ ID NO.3);

[0022] GCTGATGCCCTGAAGTATGT(SEQ ID NO.6);

[0023] In one embodiment, the substance inhibiting EZH2 activity comprises at least one of (b1)-(b3):

[0024] (b1) Antibodies that specifically bind to EZH2;

[0025] (b2) Ligand proteins or peptides that specifically bind to EZH2;

[0026] (b3) Non-protein compounds that specifically bind to EZH2.

[0027] In one embodiment, the substance inhibiting EZH2 activity is a non-protein compound that specifically binds to EZH2; further selected from at least one of EPZ-6438, EL1, GSK126, CPI-169, ZLD10A, GSK503, JQEZ5, GSK926, GSK343, PF-06726304, MS1943, EZH-IN-3, CPI-1205, EBI-2511, UNC1999, Valemetostat, (R)-OR-S1, PF-06821497, Oxetinib, and Astemizole; and even more specifically, EPZ-6438.

[0028] In one embodiment, the method for reducing the content and / or activity of histone H3K27me3 methyltransferase in the embryonic stem cells is as follows:

[0029] (c1) The embryonic stem cells are cultured in a culture medium, wherein the culture medium is PrESC medium containing an EZH2 inhibitor; or,

[0030] (c2) Reduce the expression level of EZH2 in the embryonic stem cells and culture the embryonic stem cells with reduced EZH2 expression level in PrESC medium.

[0031] In one embodiment, the EZH2 inhibitor mentioned in (c1) is the substance that inhibits EZH2 activity.

[0032] In one embodiment, the concentration of the EZH2 inhibitor described in (c1) in the culture medium is 1-5 μM.

[0033] In one embodiment, the method for reducing the expression level of EZH2 in the embryonic stem cells in (c2) is to treat the embryonic stem cells with the substance that reduces the expression level of EZH2.

[0034] In one embodiment, the PrESC medium described in (c1) and (c2) is a basal medium containing fibroblast growth factor, platelet-derived growth factor, and Wnt / β-catenin signaling pathway activator.

[0035] In one embodiment, the fibroblast growth factor is at least one of FGF1-23, such as FGF1, FGF2, FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, FGF10, FGF11, FGF12, FGF13, FGF14, FGF15, FGF16, FGF17, FGF18, FGF19, FGF20, FGF21, FGF22 or FGF23; and further, FGF4.

[0036] In one embodiment, the platelet-derived growth factor is selected from at least one of PDGF-AA, PDGF-BB, and PDGF-AB; more specifically, it is PDGF-AA.

[0037] In one embodiment, the Wnt / β-catenin signaling pathway activator is further described as CHIR-99021.

[0038] In one embodiment, the basal culture medium is selected from at least one of StemFit Basic03, MDM medium, DMEM medium, RPMI1640 medium, mTESR medium, StemFit Basic 04, StemMACS iPS Brew medium, and TeSR2 medium; more specifically, StemFit Basic03 medium.

[0039] In one embodiment, the concentration of the fibroblast growth factor in the PrESC medium is 40-60 ng / mL.

[0040] In one embodiment, the concentration of the platelet-derived growth factor in the PrESC medium is 20-50 ng / mL.

[0041] In one embodiment, the concentration of the Wnt / β-catenin signaling pathway activator in the PrESC medium is 5-15 μM.

[0042] In one embodiment, the culture time described in (c1) and (c2) is 72-120 h; more specifically, 96 h.

[0043] In one embodiment, the culture temperature described in (c1) and (c2) is 35-40°C; more specifically, 37°C.

[0044] In one embodiment, the carbon dioxide concentration for cultivation in (c1) and (c2) is 2.5-7.5%; more specifically, 5%.

[0045] In one embodiment, the embryonic stem cells are derived from mammals.

[0046] In one embodiment, the embryonic stem cells are derived from rodents; further, from mice; and even further, from mice.

[0047] A second aspect of the present invention provides a primitive endoderm stem cell prepared by the method provided in the first aspect of the present invention.

[0048] In one embodiment, the content of Pdgfra+Nanog- cells in the primitive endoderm stem cells is not less than 30%.

[0049] The third aspect of the invention provides the use of the primitive endoderm stem cells provided in the second aspect of the invention in the construction of primitive endoderm stem cell lines and / or the preparation of blastocysts.

[0050] A fourth aspect of the present invention provides the use of EZH2 inhibitors in inducing embryonic stem cells to differentiate into primitive endoderm stem cells.

[0051] In one embodiment, the EZH2 inhibitor comprises at least one of a substance that inhibits EZH2 activity, a substance that degrades EZH2, and a substance that reduces the expression level of EZH2.

[0052] In one embodiment, the substance that reduces EZH2 expression levels is at least one of (a1)-(a3):

[0053] (a1) siRNA, dsRNA, miRNA, ribozyme, sgRNA or shRNA targeting EZH2;

[0054] (a2) expresses the nucleic acid molecule of (a1);

[0055] (a3) includes expression cassettes, vectors, transgenic cell lines, microorganisms, or viruses that contain (a2).

[0056] In one implementation, (a1) is an sgRNA that targets EZH2.

[0057] In one embodiment, the sequence of the sgRNA is:

[0058] GCGCTGTAGTATGTAATGCAC(SEQ ID NO.3);

[0059] GCTGATGCCCTGAAGTATGT(SEQ ID NO.6);

[0060] In one embodiment, the substance inhibiting EZH2 activity comprises at least one of (b1)-(b3):

[0061] (b1) Antibodies that specifically bind to EZH2;

[0062] (b2) Ligand proteins or peptides that specifically bind to EZH2;

[0063] (b3) Non-protein compounds that specifically bind to EZH2.

[0064] In one embodiment, the substance inhibiting EZH2 activity is a non-protein compound that specifically binds to EZH2; further selected from at least one of EPZ-6438, EL1, GSK126, CPI-169, ZLD10A, GSK503, JQEZ5, GSK926, GSK343, PF-06726304, MS1943, EZH-IN-3, CPI-1205, EBI-2511, UNC1999, Valemetostat, (R)-OR-S1, PF-06821497, Oxetinib, and Astemizole; and even more specifically, EPZ-6438.

[0065] In one embodiment, the product is a reagent, a reagent combination, or a kit.

[0066] A fifth aspect of the present invention provides a product for inducing embryonic stem cells to differentiate into primitive endoderm stem cells, comprising an EZH2 inhibitor and PrESC medium.

[0067] In one embodiment, the EZH2 inhibitor and PrESC medium are either mixed or exist independently.

[0068] In one embodiment, the EZH2 inhibitor comprises at least one of a substance that inhibits EZH2 activity, a substance that degrades EZH2, and a substance that reduces the expression level of EZH2.

[0069] In one embodiment, the substance that reduces EZH2 expression levels is at least one of (a1)-(a3):

[0070] (a1) siRNA, dsRNA, miRNA, ribozyme, sgRNA or shRNA targeting EZH2;

[0071] (a2) expresses the nucleic acid molecule of (a1);

[0072] (a3) includes expression cassettes, vectors, transgenic cell lines, microorganisms, or viruses that contain (a2).

[0073] In one implementation, (a1) is an sgRNA that targets EZH2.

[0074] In one embodiment, the sequence of the sgRNA is:

[0075] GCGCTGTAGTATGTAATGCAC(SEQ ID NO.3);

[0076] GCTGATGCCCTGAAGTATGT(SEQ ID NO.6);

[0077] In one embodiment, the substance inhibiting EZH2 activity comprises at least one of (b1)-(b3):

[0078] (b1) Antibodies that specifically bind to EZH2;

[0079] (b2) Ligand proteins or peptides that specifically bind to EZH2;

[0080] (b3) Non-protein compounds that specifically bind to EZH2.

[0081] In one embodiment, the substance inhibiting EZH2 activity is a non-protein compound that specifically binds to EZH2; further selected from at least one of EPZ-6438, EL1, GSK126, CPI-169, ZLD10A, GSK503, JQEZ5, GSK926, GSK343, PF-06726304, MS1943, EZH-IN-3, CPI-1205, EBI-2511, UNC1999, Valemetostat, (R)-OR-S1, PF-06821497, Oxetinib, and Astemizole; and even more specifically, EPZ-6438.

[0082] In one embodiment, the PrESC medium is a basal medium containing fibroblast growth factor, platelet-derived growth factor, and Wnt / β-catenin signaling pathway activator.

[0083] In one embodiment, the fibroblast growth factor is at least one of FGF1-23, such as FGF1, FGF2, FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, FGF10, FGF11, FGF12, FGF13, FGF14, FGF15, FGF16, FGF17, FGF18, FGF19, FGF20, FGF21, FGF22 or FGF23; and further, FGF4.

[0084] In one embodiment, the platelet-derived growth factor is selected from at least one of PDGF-AA, PDGF-BB, and PDGF-AB; more specifically, it is PDGF-AA.

[0085] In one embodiment, the Wnt / β-catenin signaling pathway activator is further described as CHIR-99021.

[0086] In one embodiment, the basal culture medium is selected from at least one of StemFit Basic03, MDM medium, DMEM medium, RPMI1640 medium, mTESR medium, StemFit Basic 04, StemMACS iPS Brew medium, and TeSR2 medium; more specifically, StemFit Basic03 medium.

[0087] In one embodiment, the concentration of the fibroblast growth factor in the PrESC medium is 40-60 ng / mL.

[0088] In one embodiment, the concentration of the platelet-derived growth factor in the PrESC medium is 20-50 ng / mL.

[0089] In one embodiment, the concentration of the Wnt / β-catenin signaling pathway activator in the PrESC medium is 5-15 μM.

[0090] In one implementation, the product is (d1) or (d2):

[0091] (d1) The product consists of an EZH2 inhibitor and PrESC medium, wherein the EZH2 inhibitor and PrESC medium are mixed together.

[0092] (d2) The product consists of an EZH2 inhibitor and a PrESC medium, wherein the EZH2 inhibitor and the PrESC medium exist independently.

[0093] In one embodiment, (d1) the EZH2 inhibitor is a substance that inhibits the activity of EZH2.

[0094] In one embodiment, (d1) the concentration of the EZH2 inhibitor in the product is 1-5 μM.

[0095] In one embodiment, (d2) the EZH2 inhibitor is a substance that reduces the expression level of EZH2.

[0096] In one implementation, the product is (e1) or (e2):

[0097] (e1) The product consists of an EZH2 inhibitor, PrESC medium and instruction manual 1, wherein the EZH2 inhibitor and PrESC medium are mixed together, and instruction manual 1 describes the method of using the product.

[0098] (e2) The product consists of an EZH2 inhibitor, PrESC medium, and instruction manual 2. The EZH2 inhibitor and PrESC medium exist independently, and instruction manual 2 describes the method of using the product.

[0099] In one embodiment, (e1) the EZH2 inhibitor is a substance that inhibits the activity of EZH2.

[0100] In one embodiment, (e1) the concentration of the EZH2 inhibitor in the mixture of the EZH2 inhibitor and PrESC medium is 1-5 μM.

[0101] In one embodiment, the product described in (e1) is used by culturing embryonic stem cells in a culture medium, which is a mixture of EZH2 inhibitor and PrESC culture medium present in (e1).

[0102] In one embodiment, the culture time is 72-120 hours; more specifically, 96 hours.

[0103] In one embodiment, the culture temperature is 35-40°C; more specifically, 37°C.

[0104] In one embodiment, the carbon dioxide concentration in the culture is 2.5-7.5%; more specifically, 5%.

[0105] In one embodiment, the EZH2 inhibitor mentioned in (e2) is a substance that reduces the expression level of EZH2.

[0106] In one embodiment, the method of using the product described in (e2) is to reduce the expression level of EZH2 in embryonic stem cells by culturing the embryonic stem cells with reduced EZH2 expression level in PrESC medium; wherein, reducing the expression level of EZH2 in the embryonic stem cells is to treat the embryonic stem cells with the EZH2 inhibitor described in (e2).

[0107] In one embodiment, the culture time is 72-120 hours; more specifically, 96 hours.

[0108] In one embodiment, the culture temperature is 35-40°C; more specifically, 37°C.

[0109] In one embodiment, the carbon dioxide concentration in the culture is 2.5-7.5%; more specifically, 5%.

[0110] A sixth aspect of the present invention provides a method for constructing a primitive endoderm stem cell line, comprising the step of inducing embryonic stem cells to differentiate into primitive endoderm stem cells using the method provided in the first aspect.

[0111] A seventh aspect of the present invention provides a method for preparing blastocysts, comprising the step of inducing embryonic stem cells to differentiate into primitive endoderm stem cells using the method provided in the first aspect.

[0112] Beneficial effects

[0113] This invention provides a method for inducing stem cell differentiation into primitive endoderm stem cells. By regulating epigenetic modifications through histone H3K27me3 methyltransferase, an in vitro culture system capable of efficiently inducing embryonic stem cells to transdifferentiate into PrESCs was constructed. Functional validation demonstrated the successful construction of the PrESC cell line. This provides an important research tool for studying the mechanism of secondary cell fate determination in early embryos, avoiding the difficulty of studying this mechanism in vivo. It also provides an important transdifferentiated cell type for in vitro reconstructing blastocysts and offers a significant candidate scheme for obtaining large quantities of blastocysts for subsequent functional validation. Attached Figure Description

[0114] Figure 1 This study demonstrates the construction of the NGPB dual reporter cell line and the screening of epigenetic modification-related inhibitors.

[0115] Figure 2 The establishment of EPZ-iPrESC lines after EPZ-6438 induction is shown.

[0116] Figure 3 The EPZ-iPrESC functional verification is displayed.

[0117] Figure 4The results showed that H3K27me3 and H3K4me3 were highly enriched in the PrE gene region in the ESC.

[0118] Figure 5 The results showed that knockout of H3K27me3 methyltransferase significantly induced transdifferentiation of ESCs into PrESCs.

[0119] Figure 6 The results showed that EZH2 complementation inhibited the transdifferentiation of ESCs into PrESCs. Detailed Implementation

[0120] In a first aspect, the present invention provides a method for inducing embryonic stem cells to differentiate into primitive endoderm stem cells, comprising the step of reducing the content and / or activity of histone H3K27me3 methyltransferase in the embryonic stem cells.

[0121] In one embodiment, the method for reducing the content and / or activity of histone H3K27me3 methyltransferase in the embryonic stem cells is to treat the embryonic stem cells with an EZH2 inhibitor.

[0122] In one embodiment, the EZH2 inhibitor comprises at least one of a substance that inhibits EZH2 activity, a substance that degrades EZH2, and a substance that reduces the expression level of EZH2.

[0123] In one embodiment, the substance that reduces EZH2 expression levels is at least one of (a1)-(a3):

[0124] (a1) siRNA, dsRNA, miRNA, ribozyme, sgRNA or shRNA targeting EZH2;

[0125] (a2) expresses the nucleic acid molecule of (a1);

[0126] (a3) includes expression cassettes, vectors, transgenic cell lines, microorganisms, or viruses that contain (a2).

[0127] In one implementation, (a1) is an sgRNA that targets EZH2.

[0128] In one embodiment, the sequence of the sgRNA is:

[0129] GCGCTGTAGTATGTAATGCAC(SEQ ID NO.3);

[0130] GCTGATGCCCTGAAGTATGT(SEQ ID NO.6);

[0131] In one embodiment, the substance inhibiting EZH2 activity comprises at least one of (b1)-(b3):

[0132] (b1) Antibodies that specifically bind to EZH2;

[0133] (b2) Ligand proteins or peptides that specifically bind to EZH2;

[0134] (b3) Non-protein compounds that specifically bind to EZH2.

[0135] In one embodiment, the substance inhibiting EZH2 activity is a non-protein compound that specifically binds to EZH2; further selected from at least one of EPZ-6438, EL1, GSK126, CPI-169, ZLD10A, GSK503, JQEZ5, GSK926, GSK343, PF-06726304, MS1943, EZH-IN-3, CPI-1205, EBI-2511, UNC1999, Valemetostat, (R)-OR-S1, PF-06821497, Oxetinib, and Astemizole; and even more specifically, EPZ-6438.

[0136] In one embodiment, the method for reducing the content and / or activity of histone H3K27me3 methyltransferase in the embryonic stem cells is as follows:

[0137] (c1) The embryonic stem cells are cultured in a culture medium, wherein the culture medium is PrESC medium containing an EZH2 inhibitor; or,

[0138] (c2) Reduce the expression level of EZH2 in the embryonic stem cells and culture the embryonic stem cells with reduced EZH2 expression level in PrESC medium.

[0139] In one embodiment, the EZH2 inhibitor mentioned in (c1) is the substance that inhibits EZH2 activity.

[0140] In one embodiment, the concentration of the EZH2 inhibitor described in (c1) in the culture medium is 1-5 μM.

[0141] In one embodiment, the method for reducing the expression level of EZH2 in the embryonic stem cells in (c2) is to treat the embryonic stem cells with the substance that reduces the expression level of EZH2.

[0142] In one embodiment, the PrESC medium described in (c1) and (c2) is a basal medium containing fibroblast growth factor, platelet-derived growth factor, and Wnt / β-catenin signaling pathway activator.

[0143] In one embodiment, the fibroblast growth factor is at least one of FGF1-23, such as FGF1, FGF2, FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, FGF10, FGF11, FGF12, FGF13, FGF14, FGF15, FGF16, FGF17, FGF18, FGF19, FGF20, FGF21, FGF22 or FGF23; and further, FGF4.

[0144] In one embodiment, the platelet-derived growth factor is selected from at least one of PDGF-AA, PDGF-BB, and PDGF-AB; more specifically, it is PDGF-AA.

[0145] In one embodiment, the Wnt / β-catenin signaling pathway activator is further described as CHIR-99021.

[0146] In one embodiment, the basal culture medium is selected from at least one of StemFit Basic03, MDM medium, DMEM medium, RPMI1640 medium, mTESR medium, StemFit Basic 04, StemMACS iPS Brew medium, and TeSR2 medium; more specifically, StemFit Basic03 medium.

[0147] In one embodiment, the concentration of the fibroblast growth factor in the PrESC medium is 40-60 ng / mL.

[0148] In one embodiment, the concentration of the platelet-derived growth factor in the PrESC medium is 20-50 ng / mL.

[0149] In one embodiment, the concentration of the GSK-3 inhibitor in the PrESC medium is 5-15 μM.

[0150] In one embodiment, the culture time described in (c1) and (c2) is 72-120 h; more specifically, 96 h.

[0151] In one embodiment, the culture temperature described in (c1) and (c2) is 35-40°C; more specifically, 37°C.

[0152] In one embodiment, the carbon dioxide concentration for cultivation in (c1) and (c2) is 2.5-7.5%; more specifically, 5%.

[0153] In one embodiment, the embryonic stem cells are derived from mammals.

[0154] In one embodiment, the embryonic stem cells are derived from rodents; further, from mice; and even further, from mice.

[0155] It is understandable that the process of passage culture of embryonic stem cells is included before inducing differentiation of embryonic stem cells into primitive endoderm stem cells. Passage culture is the process of digesting and diluting cells, and then dispensing them into two or more culture flasks or dishes to continue their growth. Passage culture can obtain a large number of stem cells of the same type for inducing transdifferentiation. This invention does not impose any particular restrictions on the passage culture of embryonic stem cells, as long as a large number of embryonic stem cells of the same type can be obtained through passage culture for subsequent induction of transdifferentiation. For example, embryonic stem cells (ESCs) can be cultured in ESC medium for 1-3 days, then dissociated with 0.05-0.1% Trypsin, and passaged at a ratio of 1:5. ESC medium can be selected from embryonic stem cell media (serum+lif) commonly used in the field, including but not limited to DMEM high glucose medium (DMEM 4500 mg / L glucose, 1 mM sodium pyruvate, 2 mM 1-glutamine, 15% fetal serum, 100 U / ml penicillin, 100 μg / ml streptomycin, 2 mM non-essential amino acids, 100 μM β-mercaptoethanol and 1000 U / ml LIF). Embryonic stem cells are cultured at 37°C and 5% CO2.

[0156] A second aspect of the present invention provides a primitive endoderm stem cell prepared by the method provided in the first aspect of the present invention.

[0157] In one embodiment, the content of Pdgfra+Nanog- cells in the primitive endoderm stem cells is not less than 30%.

[0158] The third aspect of the invention provides the use of the primitive endoderm stem cells provided in the second aspect of the invention in the construction of primitive endoderm stem cell lines and / or the preparation of blastocysts.

[0159] A fourth aspect of the present invention provides the use of EZH2 inhibitors in inducing embryonic stem cells to differentiate into primitive endoderm stem cells.

[0160] In one embodiment, the EZH2 inhibitor comprises at least one of a substance that inhibits EZH2 activity, a substance that degrades EZH2, and a substance that reduces the expression level of EZH2.

[0161] In one embodiment, the substance that reduces EZH2 expression levels is at least one of (a1)-(a3):

[0162] (a1) siRNA, dsRNA, miRNA, ribozyme, sgRNA or shRNA targeting EZH2;

[0163] (a2) expresses the nucleic acid molecule of (a1);

[0164] (a3) includes expression cassettes, vectors, transgenic cell lines, microorganisms, or viruses that contain (a2).

[0165] In one implementation, (a1) is an sgRNA that targets EZH2.

[0166] In one embodiment, the sequence of the sgRNA is:

[0167] GCGCTGTAGTATGTAATGCAC(SEQ ID NO.3);

[0168] GCTGATGCCCTGAAGTATGT(SEQ ID NO.6);

[0169] In one embodiment, the substance inhibiting EZH2 activity comprises at least one of (b1)-(b3):

[0170] (b1) Antibodies that specifically bind to EZH2;

[0171] (b2) Ligand proteins or peptides that specifically bind to EZH2;

[0172] (b3) Non-protein compounds that specifically bind to EZH2.

[0173] In one embodiment, the substance inhibiting EZH2 activity is a non-protein compound that specifically binds to EZH2; further selected from at least one of EPZ-6438, EL1, GSK126, CPI-169, ZLD10A, GSK503, JQEZ5, GSK926, GSK343, PF-06726304, MS1943, EZH-IN-3, CPI-1205, EBI-2511, UNC1999, Valemetostat, (R)-OR-S1, PF-06821497, Oxetinib, and Astemizole; and even more specifically, EPZ-6438.

[0174] In one embodiment, the product is a reagent, a reagent combination, or a kit.

[0175] A fifth aspect of the present invention provides a product for inducing embryonic stem cells to differentiate into primitive endoderm stem cells, comprising an EZH2 inhibitor and PrESC medium.

[0176] In one embodiment, the EZH2 inhibitor and PrESC medium are either mixed or exist independently.

[0177] In one embodiment, the EZH2 inhibitor comprises at least one of a substance that inhibits EZH2 activity, a substance that degrades EZH2, and a substance that reduces the expression level of EZH2.

[0178] In one embodiment, the substance that reduces EZH2 expression levels is at least one of (a1)-(a3):

[0179] (a1) siRNA, dsRNA, miRNA, ribozyme, sgRNA or shRNA targeting EZH2;

[0180] (a2) expresses the nucleic acid molecule of (a1);

[0181] (a3) includes expression cassettes, vectors, transgenic cell lines, microorganisms, or viruses that contain (a2).

[0182] In one implementation, (a1) is an sgRNA that targets EZH2.

[0183] In one embodiment, the sequence of the sgRNA is:

[0184] GCGCTGTAGTATGTAATGCAC(SEQ ID NO.3);

[0185] GCTGATGCCCTGAAGTATGT(SEQ ID NO.6);

[0186] In one embodiment, the substance inhibiting EZH2 activity comprises at least one of (b1)-(b3):

[0187] (b1) Antibodies that specifically bind to EZH2;

[0188] (b2) Ligand proteins or peptides that specifically bind to EZH2;

[0189] (b3) Non-protein compounds that specifically bind to EZH2.

[0190] In one embodiment, the substance inhibiting EZH2 activity is a non-protein compound that specifically binds to EZH2; further selected from at least one of EPZ-6438, EL1, GSK126, CPI-169, ZLD10A, GSK503, JQEZ5, GSK926, GSK343, PF-06726304, MS1943, EZH-IN-3, CPI-1205, EBI-2511, UNC1999, Valemetostat, (R)-OR-S1, PF-06821497, Oxetinib, and Astemizole; and even more specifically, EPZ-6438.

[0191] In one embodiment, the PrESC medium is a basal medium containing fibroblast growth factor, platelet-derived growth factor, and Wnt / β-catenin signaling pathway activator.

[0192] In one embodiment, the fibroblast growth factor is at least one of FGF1-23, such as FGF1, FGF2, FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, FGF10, FGF11, FGF12, FGF13, FGF14, FGF15, FGF16, FGF17, FGF18, FGF19, FGF20, FGF21, FGF22 or FGF23; and further, FGF4.

[0193] In one embodiment, the platelet-derived growth factor is selected from at least one of PDGF-AA, PDGF-BB, and PDGF-AB; more specifically, it is PDGF-AA.

[0194] In one embodiment, the Wnt / β-catenin signaling pathway activator is further described as CHIR-99021.

[0195] In one embodiment, the basal culture medium is selected from at least one of StemFit Basic03, MDM medium, DMEM medium, RPMI1640 medium, mTESR medium, StemFit Basic 04, StemMACS iPS Brew medium, and TeSR2 medium; more specifically, StemFit Basic03 medium.

[0196] In one embodiment, the concentration of the fibroblast growth factor in the PrESC medium is 40-60 ng / mL.

[0197] In one embodiment, the concentration of the platelet-derived growth factor in the PrESC medium is 20-50 ng / mL.

[0198] In one embodiment, the concentration of the Wnt / β-catenin signaling pathway activator in the PrESC medium is 5-15 μM.

[0199] In one implementation, the product is (d1) or (d2):

[0200] (d1) The product consists of an EZH2 inhibitor and PrESC medium, wherein the EZH2 inhibitor and PrESC medium are mixed together.

[0201] (d2) The product consists of an EZH2 inhibitor and a PrESC medium, wherein the EZH2 inhibitor and the PrESC medium exist independently.

[0202] In one embodiment, (d1) the EZH2 inhibitor is a substance that inhibits the activity of EZH2.

[0203] In one embodiment, (d1) the concentration of the EZH2 inhibitor in the product is 1-5 μM.

[0204] In one embodiment, (d2) the EZH2 inhibitor is a substance that reduces the expression level of EZH2.

[0205] In one implementation, the product is (e1) or (e2):

[0206] (e1) The product consists of an EZH2 inhibitor, PrESC medium and instruction manual 1, wherein the EZH2 inhibitor and PrESC medium are mixed together, and instruction manual 1 describes the method of using the product.

[0207] (e2) The product consists of an EZH2 inhibitor, PrESC medium, and instruction manual 2. The EZH2 inhibitor and PrESC medium exist independently, and instruction manual 2 describes the method of using the product.

[0208] In one embodiment, (e1) the EZH2 inhibitor is a substance that inhibits the activity of EZH2.

[0209] In one embodiment, (e1) the concentration of the EZH2 inhibitor in the mixture of the EZH2 inhibitor and PrESC medium is 1-5 μM.

[0210] In one embodiment, the product described in (e1) is used by culturing embryonic stem cells in a culture medium, which is a mixture of EZH2 inhibitor and PrESC culture medium present in (e1).

[0211] In one embodiment, the culture time is 72-120 hours; more specifically, 96 hours.

[0212] In one embodiment, the culture temperature is 35-40°C; more specifically, 37°C.

[0213] In one embodiment, the carbon dioxide concentration in the culture is 2.5-7.5%; more specifically, 5%.

[0214] In one embodiment, the EZH2 inhibitor mentioned in (e2) is a substance that reduces the expression level of EZH2.

[0215] In one embodiment, the method of using the product described in (e2) is to reduce the expression level of EZH2 in embryonic stem cells by culturing the embryonic stem cells with reduced EZH2 expression level in PrESC medium; wherein, reducing the expression level of EZH2 in the embryonic stem cells is to treat the embryonic stem cells with the EZH2 inhibitor described in (e2).

[0216] In one embodiment, the culture time is 72-120 hours; more specifically, 96 hours.

[0217] In one embodiment, the culture temperature is 35-40°C; more specifically, 37°C.

[0218] In one embodiment, the carbon dioxide concentration in the culture is 2.5-7.5%; more specifically, 5%.

[0219] A sixth aspect of the present invention provides a method for constructing a primitive endoderm stem cell line, comprising the step of inducing embryonic stem cells to differentiate into primitive endoderm stem cells using the method provided in the first aspect.

[0220] A seventh aspect of the present invention provides a method for preparing blastocysts, comprising the step of inducing embryonic stem cells to differentiate into primitive endoderm stem cells using the method provided in the first aspect.

[0221] The present invention will be further described in detail below through specific embodiments. Unless otherwise specified, the raw materials, reagents, or apparatus used in the embodiments and comparative examples are all available from conventional commercial sources or can be obtained by existing technical methods. Unless otherwise specified, the test or experimental methods are conventional methods in the art.

[0222] Example 1: Construction of a dual reporter cell line of reporter ESC and PrESC (Nanog-2×GFP & Pdgfra-BFP; abbreviated as NGPB)

[0223] Using eSpCas9(1.1)-T2A-Puro (https: / / www.addgene.org / 101039 / ) as the backbone, the eSpCas9(1.1)-T2A-mCherry vector was constructed. sgRNAs near the Nanog and Pdgfra terminators were designed and ligated into the eSpCas9(1.1)-T2A-mCherry vector, respectively, to obtain the Cas9-Nanog and Cas9-Pdgfra vectors. Based on pUC19 (https: / / www.addgene.org / 50005 / ), two GFP (2×GFP) sequences were inserted before the Nanog terminator to construct a Nanog donor vector containing homologous arm sequences (Nanog-2×GFP vector); based on pUC19, a BFP-H2B sequence was inserted before the Pdgfra terminator to construct a Pdgfra donor vector containing homologous arm sequences (Pdgfra-BFP vector). Figure 1 (A)

[0224] Cas9-Nanog and Nanog-2×GFP were transfected into the ESCs of E14TG2A mice using a lipo3000 transfector, and GFP was sorted by flow cytometry. + Cells were monocloned, and after the clones grew, homozygous insertion cell lines were selected by genotyping PCR to obtain the Nanog-2×GFP cell line. Subsequently, Cas9-Pdgfra and Pdgfra-BFP vectors were introduced into the Nanog-2×GFP cell line using lipo3000. After transfection, monocloning was performed, and after the clones grew, homozygous insertion cell lines were selected by genotyping PCR to obtain the Nanog-2×GFP&Pdgfra-BFP (NGPB) cell line.

[0225] Example 2: Constructing an efficient induction system for transdifferentiation of mouse embryonic stem cells into primitive endoderm stem cells.

[0226] The segregation of cell fate among the three lineages in mouse blastocysts is closely related to changes in epigenetic modifications. To investigate the epigenetic modifications that play a key regulatory role in the transdifferentiation of ESCs to PrESCs, the NGPB dual reporter cell line constructed in Example 1 was used in ESC medium (DMEM high glucose medium: DMEM 4500 mg / L glucose (SH30022.01, Gibco), 110 mg / L sodium pyruvate (11360070, Gibco), 4 mM 1-glutamine (Gibco), 15% (v / v) fetal bovine serum (10099141, Gibco), 1 U / mL penicillin (15070063, Gibco), 1 mg / mL streptomycin (15070063, Gibco), 0.1 mM non-essential amino acids (11140050, Gibco), 50 mM β-mercaptoethanol (63689, Sigma) and 1000 U / mL LIF (ESG1107, Merck) was cultured at 37°C and 5% CO2 for 2 days. After 2 days, it was dissociated by 0.05% Trypsin (25200072, Gibco) at 37°C for 5 min, and then passaged at a 1:5 ratio. 3 × 10⁻⁶ cells were collected. 5 After centrifugation, cells were resuspended in 2 mL of PrESC medium and a certain concentration of inhibitor, and then cultured at 37°C and 5% CO2 for 4 days for induction; the medium was changed every 2 days. After 4 days of induction, the percentage of GFP- and BFP+ cells was detected and sorted by flow cytometry using BDFACXAria III (BD). Figure 1(B). PrESC medium contains: Stemfit Basic 03 medium (Ajinomoto), 50 ng / mL FGF4 (235-F4-025, R&D Systems), 1 μg / mL Heparin (H3149, Sigma), 25 ng / mL PDGF-AA (221-AA-025, R&D Systems), and 10 μM CHIR99021 (S1263, Selleck). Different inhibitors capable of regulating epigenetic modifications were used, specifically 100 μM DZNEP, 2 μM EPZ-6438, 10 μM CPTH2, 500 nM SGC-CBP30, 0.25 μM MGCD0103, 20 μM TH34, 1 μM JIB-04, 5 μM GSK J1, 5 μM 5-Azacytidine, 50 μM CM272, 10 μM Tubacin, 250 nM SP2509, 100 nM JQ1, 1% Valproic acid, 2 μM SGC0946, 2 μM A-366, 3 μM AS-8351, 0.5 μM Sodium butyrate, 20 nM GSK-LSD1, 2 μM LMK235, or 100 nM MS-275 (all inhibitors were purchased from Selleck).

[0227] Flow cytometry detection of Pdgfra-BFP + and Nanog-GFP - Cell proportions, results as follows Figure 1 As shown in Figure C, treatments with 2 μM EPZ-6438, 500 nM SGC-CBP300, 1% VPA, 0.5 mM NaB, and 2 μM LMK235 all significantly induced Pdgfra-BFP. + and Nanog-GFP - Increased cell proportion. Treatment with 2 μM histone H3K27me3 methyltransferase EZH2 inhibitor EPZ-6438 for 4 days resulted in Pdgfra-BFP. + and Nanog-GFP - The increase in cell proportion was most significant, at approximately 33%.

[0228] To further investigate the Pdgfra-BFP in the EPZ-6438-treated NGPB reporter cell line + and Nanog-GFP -The PrESC cell line was constructed using this method. Reporter cells were treated with different concentrations of the EZH2 inhibitor EPZ-6438 (0.1 μM, 0.5 μM, 1 μM, and 2 μM) in PrESC medium, and Pdgfra-BFP was detected by flow cytometry. + and Nanog-GFP - The proportion of cells showed that as the concentration of EPZ-6438 increased, Pdgfra-BFP... + and Nanog-GFP - The proportion of cells was significantly upregulated after 4 days of treatment with 2 μM EPZ-6438 in PrESC medium for Pdgfra-BFP. + and Nanog-GFP - The proportion of cells was 30.5% ( Figure 2 (A and B). 2 μM EPZ-6438 was selected as the optimal induction culture concentration. Cells cultured and sorted at this concentration were cultured in PrESC medium (without additional EPZ-6438) and passaged to construct a stable cell line (EPZ-iPrESC).

[0229] Example 3: Characterization of the EPZ-iPrESC cell line

[0230] Cell samples treated with 2 μM EPZ-6438 in PrESC medium for 4 days (treatment method is the same as in Example 2) were sorted into Pdgfra-BFP cells. + and Nanog-GFP - Cells were continuously cultured in PrESC medium to construct the EPZ-iPrESC line, and two stable passaged EPZ-iPrESC cell lines were successfully constructed. Figure 2 (C and D). To assess the homogeneity of EPZ-iPrESC cells, CD140a staining and flow cytometry analysis were performed on EPZ-iPrESC cells. The results showed that approximately 98% of the cells in both EPZ-iPrESC cell lines exhibited Nanog-GFP. - and Pdgfra-BFP + Approximately 99% of cells exhibit Nanog-GFP. - Approximately 90% of the cells exhibit CD140a. + This indicates that EPZ-iPrESC has good consistency. Figure 2 (E).

[0231] To compare EPZ-iPrESC cells with embryonic PrESC cells, the embryonic PrESC cell line C57-PrESC was constructed. The method was as follows: 6-8 week old C57 / ICR female mice were intraperitoneally injected with 5-6 U of pregnant mare serum gonadotropin (PMSG). 46-48 hours later, 5-6 U of human chorionic gonadotropin (hCG) was injected. After injection, the mice were placed in cages with male mice. Approximately 16-18 hours later, the ovum was checked, and fertilization was observed in the dilated portion of the oviduct. At this point, oocyte retrieval was appropriate. Before oocyte retrieval, several drops of mouse embryonic cell culture medium (KSOM) were prepared in 6 cm culture dishes and covered with mineral oil. The culture dishes were then placed in an incubator for preheating and CO2 equilibration. After euthanizing the mice by cervical dislocation, the oviducts were collected in M2 medium, and the oviduct ovum was extracted from the dilated portion of the oviduct using a syringe. The oocytes were then incubated with hyaluronidase at 37°C for approximately 1 minute, during which time pipetting was used to accelerate the separation of oocytes and cumulus cells. The separated fertilized eggs were then rapidly collected using an oviduct, washed thoroughly in M2 in vitro manipulation medium, and transferred to preheated KSOM culture drops. They were cultured at 37°C in a 5% CO2 incubator until 3.5 days post-incubation (dpc) of blastocysts were reached. The zona pellucida of the blastocysts was digested with acidic Tyrode's solution (T1788, Sigma). The zona pellucida-removed blastocysts were then transferred to pre-coated mouse MEF cells and cultured in Basic O3+3F medium (…). One blastocyst per well in a 96-well plate containing Basic03 (Ajinomoto), 1x penicillin-streptomycin (Thermo Fisher Scientific), 10 μM CHIR99021 (Selleck), 50 ng / mL FGF4 (R&D systems), 1 μg / mL Heparin (Sigma), and 25 ng / mL PDGF-AA (R&D systems). Embryos were cultured in Basic03+3F medium for at least 5 days until clones were formed. The clones were then transferred using 1x TrypLE. TM Select (Thermo Fisher 17 Scientific) cells were dissociated and transferred to new 48-well plates pre-seeded with MEF. After 5-7 days, once the cells reached confluence, they were further cultured and cryopreserved as C57-PrESCs.

[0232] RT-qPCR showed that the mRNA levels of the PrE gene in EPZ-iPrESC were consistent with those in embryo-derived C57-PrESC, and were significantly higher than those in ESC. Figure 2Immunofluorescence staining showed that ESCs did not express PrE-specific proteins SOX17 and GATA6, but highly expressed pluripotency proteins OCT4 and NANOG. Both embryonic C57-PrESCs and EPZ-iPrESCs highly expressed PrE-specific proteins SOX17, GATA6, and OCT4, and lowly expressed pluripotency protein NANOG, consistent with previous reports (Ohinata, Y.; Endo, TA; Sugishita, H.; Watanabe, T.; Iizuka, Y.; Kawamoto, Y.; Saraya, A.; Kumon, M.; Koseki, Y.; Kondo, T.; Ohara, O.; Koseki, H., Establishment of mouse stem cells that can recapitulate the developmental potential of primitive endoderm. Science 2022, 375(6580), 574-578.). Figure 2 Transcriptional profiling analysis showed that EPZ-iPrESC and embryo-derived C57-PrESC had similar transcriptional profiles. Figure 2 (HJ). These data indicate that adding the EPZ-6438 inhibitor to the PrESC medium efficiently induces ESCs to transdifferentiate into PrESCs, successfully constructing a stable passaged EPZ-iPrESC cell line.

[0233] Example 4: Functional Verification of EPZ-iPrESC Cell Line

[0234] To investigate the functional consistency between transdifferentiated EPZ-iPrESCs and embryo-derived PrESCs, this study involved mating EPZ-iPrESCs and embryo-derived C57-PrESCs with mouse superovulation-induced fertilization. The resulting zygotes were developed in vitro to the 4-8 cell stage, followed by normal embryo aggregation and blastocyst development. Staining was then performed to detect the localization of EPZ-iPrESCs within the blastocyst. Figure 3 As shown in Figure A, after the blastocyst developed to 4.5 days post-contraction (dpc), iPrESC-mCherry was observed to be mainly located on the surface of the inner cell mass. Figure 3 In the middle B), immunofluorescence staining showed that C57-PrESC and EPZ-iPrESC were located at the PrE sites in the blastocyst, and partially intersect with GATA6. + Cellular colocalization allows C57-PrESC and EPZ-iPrESC to substitute for the normal embryonic PrE in the blastocyst. Figure 3 (C)

[0235] In addition, after blastocysts were injected with EPZ-iPrESC and transferred to pseudopregnant mice, the embryos were allowed to develop to 7.5 days post-implantation (dpc). The localization of iPrESC in early embryos was observed, and developmental efficiency was statistically analyzed. Fluorescence microscopy observation of C57-PrESC and EPZ-iPrESC blastocysts after transfer to pseudopregnant mice and development to 7.5 days post-implantation showed that both EPZ-iPrESC and EPZ-iPrESC were located in the visceral endoderm (VE) and luminal endoderm (PE). Immunofluorescence staining showed co-staining of mCherry and the VE-specific protein GATA6, indicating that EPZ-iPrESC possesses the normal function and localization of PrE. Figure 3 (DG). These data indicate that EPZ-iPrESC has the function of embryo-derived PrESC.

[0236] Example 5: H3K27me3 and H3K4me3 were highly enriched in the PrE gene region in the ESC.

[0237] EPZ-6438 is an inhibitor of histone H3K27me3 methyltransferase EZH2. To investigate the target of EPZ-6438 inducing transdifferentiation of ESCs to PrESCs, transcriptome data from mouse ESCs, PrESCs, and TSCs were analyzed to screen for PrESC-specific high-expression gene clusters. ChIP-seq and CUT&TAG data were used to analyze the enrichment of H3K27me3 (the target of EPZ-6438) and H3K4me3 (a marker of the active promoter) on the PrESC-specific high-expression gene clusters in mouse ESCs under serum+lif (SL) culture conditions.

[0238] Transcript data from PrESC, TSC, and ESC were used to analyze specific genes in PrESC. The results showed that PrESC significantly downexpressed 1296 genes and significantly upexpressed 1790 genes compared to the other two cell lines. Figure 4 (A and B). ChIP data analysis combining H3K27me3, H3K4me3 modifications and EZH2 in ESCs showed enrichment of these three modifications in the ±3kb region of the promoters of PrESC-specific upregulated genes. The data showed significant enrichment of H3K27me3, H3K4me3, and EZH2 in the promoter regions of PrESC-specific upregulated genes. Figure 4 According to literature reports, the enrichment of H3K27me3 and H3K4me3 modifications suggests that PrESC-specific upregulated genes may be in a state of quiescent activation in ESCs cultured under serum+LIF conditions. Simultaneously, it was observed that the key PrESC regulatory genes Gata6, Foxq1, Sox7, Dkk1, Sox17, and Foxa2 were significantly enriched with H3K27me3, H3K4me3, and EZH2. Figure 4(D). These results suggest that PrESC-specific upregulated genes may be in a state of quiescent activation in ESCs cultured under serum+LIF conditions, and that H3K27me3 may be involved in the transcriptional regulation of PrESC-specific genes.

[0239] Example 6: Knockout of H3K27me3 methyltransferase significantly induced transdifferentiation of ESCs into PrESCs.

[0240] To investigate whether EPZ-6438 regulates the transdifferentiation of ESCs to PrESCs by directly inhibiting EZH2, Western blot was used to detect changes in H3K27me3 after EPZ-6438 treatment of ESCs (the method for EPZ-6438 treatment of ESCs was the same as in Example 2), and qPCR was used to detect changes in the mRNA level of PrESC-specific genes after treatment. After treatment with 2 μM EPZ-6438, Western blot analysis in the NGPB reporter cell line showed a significant downregulation of H3K27me3 protein levels in the treated cells. Figure 5 In the study, quantitative real-time PCR analysis showed that the mRNA levels of key PrESC regulatory genes Sox7, Sox17, and Gata6 were significantly upregulated. Figure 5 (B)

[0241] Subsequently, an Ezh2 knockout cell line was constructed in the NGPB dual reporter cell line. After introducing Cas9 and sgRNA, single cells were sorted and established. The Ezh2 knockout effect was verified by using inner and outer primers. The results showed that the Ezh2 knockout cell line was successfully constructed in the reporter cell line. Figure 5 (C)

[0242] The sgRNA sequence information is shown in the table below:

[0243]

[0244] Quantitative real-time PCR results showed that Ezh2 levels were significantly lower in the Ezh2 KO cell line compared to ESC, and the mRNA levels of key regulatory genes Sox7, Sox17, and Gata6, as well as pluripotency genes Nanog, Sox2, and Klf4 in PrESC were significantly upregulated. Figure 5 (D and F). Morphologically, Ezh2 knockout cells tend to differentiate. Figure 5 Ezh2 KO cell line was cultured in PrESC medium for 4 days and then Pdgfra-BFP was added. + and Nanog-GFP - Approximately 31% of cells were Pdgfra-BFP after 4 days in PrESC medium with 2 μM EPZ-6438. + and Nanog-GFP -Similar cell ratios ( Figure 5 The presence of G and H indicates that Ezh2 knockout can completely replace EPZ-6438 in promoting the transdifferentiation of ESCs to PrESCs. To further verify whether Ezh2 KO cells can be established in PrESC medium, in this example, Ezh2 KO cell lines were cultured in PrE medium (i.e., PrESC medium) for 4 days, and then Pdgfra-BFP cells were sorted. + and Nanog-GFP - The cells were continuously cultured in PrE medium to establish a lineage, and an Ezh2 strain was successfully constructed. - / - -iPrE, immunofluorescence staining showed Ezh2 - / - -iPrE has similar expression characteristics to embryonic PrESC, highly expressing PrE-specific proteins SOX17, GATA6, and OCT4, and low expressing the pluripotent protein NANOG ( Figure 5 (I). Transcriptional profiling analysis showed that Ezh2 - / - -iPrE and embryonic C57-PrESC have similar transcriptional profiles. Figure 5 (JL). These data indicate that EPZ-6438 efficiently induces the transdifferentiation of ESCs into PrESCs by inhibiting the function of EZH2.

[0245] Example 7: EZH2 complementation inhibits the transdifferentiation of ESCs into PrESCs

[0246] To further investigate the regulatory mechanism of EZH2 in the efficient transdifferentiation of ESCs to PrESCs induced by EPZ-6438, this study constructed an induced complementation cell line in the Ezh2 KO cell line. Quantitative fluorescence results showed that the mRNA level of Ezh2 was significantly upregulated after direct complementation of Ezh2 in the Ezh2 KO cell line. Figure 6 In the induction and replenishment cell lines, Dox was added to induce Ezh2 expression. With the extension of induction time, the mRNA levels of key PrESC regulatory genes Sox7, Sox17, Gata6, and Lama1 were significantly downregulated. Figure 6 (B) The recombinant cell line was cultured in PrESC medium for 4 days and then Pdgfra-BFP was added. + and Nanog-GFP - The proportion of cells was significantly lower than that of KO cells. Figure 6 C and D). CUT&TAG data showed that the abundance of H3K27me3 in the PrESC-specific gene region was significantly reduced after EZH2 KO, and significantly increased after Ezh2 complementation. Figure 6 These results indicate that EPZ-6438 efficiently induces the transdifferentiation of ESCs into functional PrESCs by inhibiting the function of EZH2.

[0247] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A method for inducing embryonic stem cells to differentiate into primitive endoderm stem cells, comprising the step of reducing the content and / or activity of histone H3K27me3 methyltransferase in the embryonic stem cells.

2. The method according to claim 1, characterized in that: The method for reducing the content and / or activity of histone H3K27me3 methyltransferase in the embryonic stem cells is to treat the embryonic stem cells with an EZH2 inhibitor. Preferably, the EZH2 inhibitor comprises at least one of the following: a substance that inhibits EZH2 activity, a substance that degrades EZH2, and a substance that reduces the expression level of EZH2. Preferably, the substance that reduces EZH2 expression level is at least one of (a1)-(a3): (a1) siRNA, dsRNA, miRNA, ribozyme, sgRNA or shRNA targeting EZH2; (a2) Nucleic acid molecules that express (a1); (a3) includes expression cassettes, vectors, transgenic cell lines, microorganisms, or viruses that are included in (a2); Preferably, (a1) is an sgRNA targeting EZH2; Preferably, the sequence of the sgRNA is: GCGCTGTAGTATGTAATGCAC(SEQ ID NO.3); GCTGATGCCCTGAAGTATGT(SEQ ID NO.6); Preferably, the substance inhibiting EZH2 activity comprises at least one of (b1)-(b3): (b1) Antibodies that specifically bind to EZH2; (b2) Ligand proteins or peptides that specifically bind to EZH2; (b3) Non-protein compounds that specifically bind to EZH2; Preferably, the substance inhibiting EZH2 activity is a non-protein compound that specifically binds to EZH2; further selected from at least one of EPZ-6438, EL1, GSK126, CPI-169, ZLD10A, GSK503, JQEZ5, GSK926, GSK343, PF-06726304, MS1943, EZH-IN-3, CPI-1205, EBI-2511, UNC1999, Valemetostat, (R)-OR-S1, PF-06821497, Oxetinib, and Astemizole; and even more preferably EPZ-6438. Preferably, the method for reducing the content and / or activity of histone H3K27me3 methyltransferase in the embryonic stem cells is as follows: (c1) The embryonic stem cells are cultured in a culture medium, wherein the culture medium is PrESC medium containing an EZH2 inhibitor; or, (c2) Reduce the expression level of EZH2 in the embryonic stem cells and culture the embryonic stem cells with reduced EZH2 expression level in PrESC medium; Preferably, the EZH2 inhibitor in (c1) is the substance that inhibits EZH2 activity; Preferably, the concentration of the EZH2 inhibitor in the culture medium in (c1) is 1-5 μM; Preferably, the method for reducing the expression level of EZH2 in the embryonic stem cells in (c2) is to treat the embryonic stem cells with the substance that reduces the expression level of EZH2; Preferably, the PrESC medium mentioned in (c1) and (c2) is a basic culture medium containing fibroblast growth factor, platelet-derived growth factor, and Wnt / β-catenin signaling pathway activator. Preferably, the fibroblast growth factor is at least one of FGF1-23; more preferably, it is FGF4; Preferably, the platelet-derived growth factor is selected from at least one of PDGF-AA, PDGF-BB, and PDGF-AB; more preferably, it is PDGF-AA. Preferably, the Wnt / β-catenin signaling pathway activator is CHIR-99021. Preferably, the basal culture medium is selected from at least one of StemFit Basic 03, MDM medium, DMEM medium, RPMI 1640 medium, mTESR medium, StemFit Basic 04, StemMACS iPS Brew medium, and TeSR2 medium; more preferably, it is StemFit Basic 03 medium. Preferably, the concentration of the fibroblast growth factor in the PrESC medium is 40-60 ng / mL; Preferably, the concentration of the platelet-derived growth factor in the PrESC medium is 20-50 ng / mL; Preferably, the concentration of the Wnt / β-catenin signaling pathway activator in the PrESC medium is 5-15 μM; Preferably, the culture time described in (c1) and (c2) is 72-120 hours; more preferably, it is 96 hours. Preferably, the culture temperature described in (c1) and (c2) is 35-40°C; more preferably, it is 37°C. Preferably, the carbon dioxide concentration for cultivation in (c1) and (c2) is 2.5-7.5%; more preferably 5%. Preferably, the embryonic stem cells are derived from mammals; Preferably, the embryonic stem cells are derived from rodents; further, from mice; and even further, from mice.

3. A primitive endoderm stem cell, prepared by the method described in claim 1 or 2; Preferably, the content of Pdgfra+Nanog- cells in the primitive endoderm stem cells is not less than 30%.

4. The use of the primitive endoderm stem cells as described in claim 3 in the construction of primitive endoderm stem cell lines and / or the preparation of blastocysts.

5. Application of EZH2 inhibitors in inducing embryonic stem cells to differentiate into primitive endoderm stem cells.

6. The application according to claim 5, wherein the EZH2 inhibitor comprises at least one of a substance that inhibits EZH2 activity, a substance that degrades EZH2, and a substance that reduces the expression level of EZH2; Preferably, the substance that reduces EZH2 expression level is at least one of (a1)-(a3): (a1) siRNA, dsRNA, miRNA, ribozyme, sgRNA or shRNA targeting EZH2; (a2) Nucleic acid molecules that express (a1); (a3) includes expression cassettes, vectors, transgenic cell lines, microorganisms, or viruses that are included in (a2); Preferably, (a1) is an sgRNA targeting EZH2; Preferably, the sequence of the sgRNA is: GCGCTGTAGTATGTAATGCAC(SEQ ID NO.3); GCTGATGCCCTGAAGTATGT(SEQ ID NO.6); Preferably, the substance inhibiting EZH2 activity comprises at least one of (b1)-(b3): (b1) Antibodies that specifically bind to EZH2; (b2) Ligand proteins or peptides that specifically bind to EZH2; (b3) Non-protein compounds that specifically bind to EZH2; Preferably, the substance inhibiting EZH2 activity is a non-protein compound that specifically binds to EZH2; further selected from at least one of EPZ-6438, EL1, GSK126, CPI-169, ZLD10A, GSK503, JQEZ5, GSK926, GSK343, PF-06726304, MS1943, EZH-IN-3, CPI-1205, EBI-2511, UNC1999, Valemetostat, (R)-OR-S1, PF-06821497, Oxetinib, and Astemizole; and even more preferably EPZ-6438. Preferably, the product is a reagent, a reagent combination, or a reagent kit.

7. A product for inducing embryonic stem cells to differentiate into primitive endoderm stem cells, comprising an EZH2 inhibitor and PrESC medium.

8. The product according to claim 7, characterized in that: The EZH2 inhibitor and PrESC medium may be mixed or exist independently; Preferably, the EZH2 inhibitor comprises at least one of the following: a substance that inhibits EZH2 activity, a substance that degrades EZH2, and a substance that reduces the expression level of EZH2. Preferably, the substance that reduces EZH2 expression level is at least one of (a1)-(a3): (a1) siRNA, dsRNA, miRNA, ribozyme, sgRNA or shRNA targeting EZH2; (a2) Nucleic acid molecules that express (a1); (a3) includes expression cassettes, vectors, transgenic cell lines, microorganisms, or viruses that are included in (a2); Preferably, (a1) is an sgRNA targeting EZH2; Preferably, the sequence of the sgRNA is: GCGCTGTAGTATGTAATGCAC(SEQ ID NO.3); GCTGATGCCCTGAAGTATGT(SEQ ID NO.6); Preferably, the substance inhibiting EZH2 activity comprises at least one of (b1)-(b3): (b1) Antibodies that specifically bind to EZH2; (b2) Ligand proteins or peptides that specifically bind to EZH2; (b3) Non-protein compounds that specifically bind to EZH2; Preferably, the substance inhibiting EZH2 activity is a non-protein compound that specifically binds to EZH2; further selected from at least one of EPZ-6438, EL1, GSK126, CPI-169, ZLD10A, GSK503, JQEZ5, GSK926, GSK343, PF-06726304, MS1943, EZH-IN-3, CPI-1205, EBI-2511, UNC1999, Valemetostat, (R)-OR-S1, PF-06821497, Oxetinib, and Astemizole; and even more preferably EPZ-6438. Preferably, the PrESC medium is a basal medium containing fibroblast growth factor, platelet-derived growth factor, and Wnt / β-catenin signaling pathway activator; Preferably, the fibroblast growth factor is at least one of FGF1-23; more preferably, it is FGF4. Preferably, the platelet-derived growth factor is selected from at least one of PDGF-AA, PDGF-BB, and PDGF-AB; more preferably, it is PDGF-AA. Preferably, the Wnt / β-catenin signaling pathway activator is CHIR-99021. Preferably, the basal culture medium is selected from at least one of StemFit Basic 03, MDM medium, DMEM medium, RPMI 1640 medium, mTESR medium, StemFit Basic 04, StemMACS iPS Brew medium, and TeSR2 medium; more preferably, it is StemFit Basic 03 medium. Preferably, the concentration of the fibroblast growth factor in the PrESC medium is 40-60 ng / mL; Preferably, the concentration of the platelet-derived growth factor in the PrESC medium is 20-50 ng / mL; Preferably, the concentration of the Wnt / β-catenin signaling pathway activator in the PrESC medium is 5-15 μM; Preferably, the product is (d1) or (d2): (d1) The product is composed of an EZH2 inhibitor and PrESC medium, wherein the EZH2 inhibitor and PrESC medium are mixed together; preferably, the EZH2 inhibitor is a substance that inhibits EZH2 activity; (d2) The product consists of an EZH2 inhibitor and PrESC medium, wherein the EZH2 inhibitor and PrESC medium exist independently; preferably, the EZH2 inhibitor is a substance that reduces the expression level of EZH2; Preferably, (d1) the concentration of the EZH2 inhibitor in the product is 1-5 μM; Preferably, the product is (e1) or (e2): (e1) The product consists of an EZH2 inhibitor, PrESC medium and instruction manual 1, wherein the EZH2 inhibitor and PrESC medium are mixed together, and instruction manual 1 describes the method of using the product; preferably, the EZH2 inhibitor is a substance that inhibits the activity of EZH2; (e2) The product consists of an EZH2 inhibitor, PrESC medium, and instruction manual 2. The EZH2 inhibitor and PrESC medium exist independently, and instruction manual 2 describes the method of using the product. Preferably, the EZH2 inhibitor is a substance that reduces the expression level of EZH2. Preferably, (e1) the concentration of the EZH2 inhibitor in the mixture of the EZH2 inhibitor and PrESC medium is 1-5 μM; Preferably, the method of using the product described in (e1) is to culture embryonic stem cells in a culture medium, wherein the culture medium is a mixture of EZH2 inhibitor and PrESC culture medium present in (e1); Preferably, the method of using the product described in (e2) is to reduce the expression level of EZH2 in embryonic stem cells by culturing the embryonic stem cells with reduced EZH2 expression level in PrESC medium; wherein, reducing the expression level of EZH2 in the embryonic stem cells is to treat the embryonic stem cells with the EZH2 inhibitor described in (e2).

9. A method for constructing a primitive endoderm stem cell line, comprising the step of inducing embryonic stem cells to differentiate into primitive endoderm stem cells using the method of claim 1 or 2.

10. A method for preparing blastocysts, comprising the step of inducing embryonic stem cells to differentiate into primitive endoderm stem cells using the method of claim 1 or 2.

Images