Gene related to rice tillering as well as encoding protein and application thereof

Abstract

The invention discloses a gene related to rice tillering as well as an encoding protein and application thereof, and belongs to the technical field of plant genetic engineering. According to the invention, a gene SSRP1 related to rice tillering is found, and a coding gene of the protein is reversely knocked out through a transgenic technology, so that dwarf multi-tillering transgenic rice is obtained. The tillering of the SSRP1 knockout plant is obviously increased and is 1.8 times of that of wild rice. The results prove that the SSRP1 gene participates in regulating and controlling the tiller number of rice, and can be applied to regulating the plant type and forming a reasonable plant population structure, so that the yield and quality of crops in unit area of cultivated land are improved.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to a gene related to rice tillering, its encoded protein, and its applications. Background Technology

[0002] Rice plant architecture is a crucial agronomic trait affecting yield, primarily determined by plant height, leaf type, number of tillers, tiller angle, and panicle morphology. Tillering is a significant morphological characteristic of most grasses. Each node of the stem in grasses produces a bud, which develops into a branch. Adventitious roots form at the base of these branches; these branches are tillers. Tillers share similar morphological characteristics with the main stem and can separate and survive independently. Since most of rice's vegetative organs, such as leaves, tillers, and roots, are formed during this period, the tillering stage is critical for rice growth and development. Therefore, identifying and utilizing genes controlling rice plant architecture is of great significance for rice breeding and production. Summary of the Invention

[0003] To address the aforementioned shortcomings of existing technologies, the present invention aims to provide a gene related to rice tillering, its encoded protein, and its application to increase the number of tillers in rice.

[0004] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: providing a method related to the number of rice tillers. SSRP1 Gene, SSRP1 The nucleotide sequence of the gene is one of the following sequences: (1) The nucleotide sequence as shown in SEQ ID NO.1; (2) A derivative amino acid sequence in which the nucleotide sequence shown in SEQ ID NO.1 is replaced and / or deleted and / or inserted by one or more nucleotide sequences, but the protein encoded by it still has the same function as the protein encoded by the nucleotide sequence shown in SEQ ID NO.1.

[0005] This invention provides the above-mentioned SSRP1 The protein encoded by the gene has an amino acid sequence that is one of the following: (1) The amino acid sequence as shown in SEQ ID NO.2; (2) A derived amino acid sequence of which the amino acid sequence shown in SEQ ID NO.2 is modified by substitution and / or deletion and / or insertion of one or more amino acid residues, but whose activity is the same as that of the protein composed of the amino acid sequence shown in SEQ ID NO.2.

[0006] This invention provides the above-mentioned SSRP1 Application of genes in increasing the number of plant tillers.

[0007] Furthermore, plants include both monocots and dicots.

[0008] Furthermore, the monocotyledonous plant is rice.

[0009] This invention provides a method for increasing the number of tillers in rice by knocking out the tillers of rice. SSRP1 Genes are used to increase the number of tillers in rice.

[0010] The present invention has the following beneficial effects: The present invention discovers a gene related to rice tillering. SSRP1 By using transgenic technology to knock out the coding gene of the above protein, transgenic rice with short stalks and multiple tillers was obtained. SSRP1 The number of tillers in knocked-out plants increased significantly, 1.8 times that of wild-type rice. These results demonstrate... SSRP1 Genes involved in regulating the number of tillers in rice can be applied to adjust plant architecture and form a reasonable plant community structure, thereby improving the yield and quality of crops per unit area of ​​cultivated land. Attached Figure Description

[0011] Figure 1 The pCLCSGHSRL2-2 vector spectrum; Figure 2 Phenotypic comparison of wild-type Kittake plants and T1 generation mutant plants; Figure 3 Phenotypic diagrams of tiller number and effective panicle number in wild-type Kittake plants and T1 generation mutant plants; Figure 4 The mutation pattern of the T0 generation transgenic SSRP1 rice and wild-type Kittake reference sequence at the position shown in SEQ ID NO.4. Detailed Implementation

[0012] The examples given below are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, conditions in the examples are performed under standard conditions or as recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0013] Agrobacterium tumefaciens EHA105 is described in NewAgrobacterium helper plasmids for gene transfer to plants. Hood, Elizabeth E; Gelvin, Stanton B; Melchers, Leo S; Hoekema, Andre. Transgenic Research, 2(4): p. 208-218-218 (1993), and is available to the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0014] Cultivation conditions for rice: Soak rice seeds in water for 3 days, then sow them in a seedbed. Transplant rice seedlings at the 4-leaf stage into paddy fields, planting individual seedlings.

[0015] Example 1: SSRP1 protein and its encoding gene In the reverse knockout progeny of the japonica rice variety Kittake, a loss of function of a target gene resulted in stunted growth, increased tillering, and yellowing leaves. Sequencing revealed that a specific DNA fragment (TTTCTGTTAGTGGTCAAAAC, SEQ ID NO. 4) in this rice mutant caused premature translation termination due to a base deletion or insertion, indicating that the reduced nitrogen in this mutant was caused by a mutation in this target gene. This target gene was named SSRP1, and the protein it encodes was named SSRP1 protein. The nucleotide sequence of the SSRP1 gene is shown in SEQ ID NO. 1, the nucleotide sequence of its CDS region is shown in SEQ ID NO. 3, and the amino acid sequence of its encoded protein is shown in SEQ ID NO. 2.

[0016] Example 2: Construction of the knockout vector 1. Obtaining recombinant expression vectors The pCLCSGHSRL2-2 vector (vector spectrum see...) was used. Figure 1 The small fragments between the AarI recognition sequences were replaced with the specific DNA molecule fragments shown in SEQ ID NO.4 to obtain the recombinant vector. The recombinant vectors that were correctly sequenced were labeled as pCLCSGHSRLL2-2-SSRP1.

[0017] Specific procedures: The pCLCSGHSRL2-2 vector is digested with Aar1 enzyme. The adapter sequence AGATGATCCGTGGCA…N19…GTTTTAGAGCTATGC is added before and after the specific DNA fragment as F primers. The obtained F primers are then reverse-complemented to obtain R primers, which are then synthesized. The primer sequences are shown below: F:5'-AGATGATCCGTGGCATTAGTGGTCAAAACTGGGGAGTTTTTA GAGCTATGC-3' (SEQ ID NO.5); R:5'-GCATAGCTCTAAAACTCCCCAGTTTTGACCACTAATGCCAC GGATCATCT-3' (SEQ ID NO. 6).

[0018] Add 1p F and R primers (100p primer stock solution) to a 10 μL system, incubate at 94℃ for 10 min, anneal at 0.1℃ / s to 15℃, and hold at 15℃ for 10 min to complete annealing; take 1 μL of the annealed product and infuse it with the enzyme-digested pCLCSGHSRL2-2 vector (vector 1 μL, annealed product 1 μL, recombinase 0.5 μL, 2.5 μL system), incubate at 50℃ for 20 min, transfer to DH5α, and plate on Kana solid medium; after sequencing to confirm the fragment is correct, return the plasmid to obtain the recombinant vector pCLCSGHSRLL2-2-SSRP1.

[0019] Example 3: Obtaining SSRP1 transgenic rice The pCLCSGHSRLL2-2-SSRP1 obtained above was transferred into Agrobacterium tumefaciens EHA105 by heat shock to obtain recombinant bacteria. The recombinant bacteria containing this plasmid was named EHA105 / pCLCSGHSRLL2-2-SSRP1.

[0020] Mature rice (Oryza sativa) Kittake seeds were dehulled and sterilized, then inoculated into a callus-inducing medium. After 3 weeks of culture, callus tissue grew from the scutellum. Vigorous, light yellow, and relatively loose embryogenic callus was selected as the recipient for transformation.

[0021] The EHA105 / pCLCSGHSRLL2-2-SSRP1 obtained above was used to infect embryogenic callus. After culturing at 25°C in the dark for 3 days, resistant callus and transgenic plants were screened on selective medium containing 50 mg / L hygromycin. Hygromycin-resistant plants were hardened off in a cool place and transplanted into paddy fields a few days later to obtain T0 generation SSRP1 transgenic rice (see phenotypic figure). Figure 2 By comparing SSRP1 knockout plants and wild-type Kittake plants, it was found that SSRP1 knockout plants had significantly more tillers, 1.8 times that of wild-type rice, and the number of effective panicles was also significantly increased (see...). Figure 3 This indicates that the SSRP1 gene is involved in regulating the number of tillers in rice, and can be applied to adjust plant architecture and form a reasonable plant community structure, thereby improving the yield and quality of crops per unit area of ​​cultivated land.

[0022] Using Hyg-Phe (5'-ATGACGGACGGCCATCTCTTC-3', SEQ ID NO.7) and Hyg-R (5'-ACCTGGGCTGCAGTGCGATT-3', SEQ ID NO.8) as primers, PCR amplification was performed on T0 generation transgenic SSRP1 rice, yielding a 569 bp target fragment. The sequence was found to differ from that of wild-type Kittake plants, indicating... SSRP1 Genes were edited to produce positive T0 generation rice. Figure 4 For T0 generation transgenic SSRP1 rice with two different editing methods (T0- ssrp1-cr1 and T0- ssrp1-cr2 ,in ssrp1 The figure shows the difference between the mutant (1 and 2 are two different editing methods of the same batch of T0 generation transgenic SSRP1 rice) and the wild-type Kittake reference sequence at the position shown in SEQ ID NO.4.

[0023] In this invention SSRP1 The nucleotide sequence of the gene is shown below: In this invention SSRP1 The amino acid sequence of the protein encoded by the gene is shown below: (SEQ ID NO.2); In this invention SSRP1 The nucleotide sequence of the gene's CDS region is shown below:

[0024] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A type of rice tiller number related to SSRP1 Genes, characterized by, The SSRP1 The nucleotide sequence of the gene is one of the following sequences: (1) The nucleotide sequence as shown in SEQ ID NO.1; (2) A derivative amino acid sequence in which the nucleotide sequence shown in SEQ ID NO.1 is replaced and / or deleted and / or inserted by one or more nucleotide sequences, but the protein encoded by it still has the same function as the protein encoded by the nucleotide sequence shown in SEQ ID NO.

1.

2. A protein encoded by the SSRP1 gene as described in claim 1, characterized in that, The amino acid sequence of the protein is one of the following sequences: (1) The amino acid sequence as shown in SEQ ID NO.2; (2) A derived amino acid sequence of which the amino acid sequence shown in SEQ ID NO.2 is modified by substitution and / or deletion and / or insertion of one or more amino acid residues, but whose activity is the same as that of the protein composed of the amino acid sequence shown in SEQ ID NO.

2.

3. The claim 1 SSRP1 Application of genes in increasing the number of plant tillers.

4. The application according to claim 3, characterized in that, The plants include monocotyledons and dicotyledons.

5. The application according to claim 4, characterized in that, The monocotyledonous plant is rice.

6. A method for increasing the number of tillers in rice, characterized in that, By knocking out rice SSRP1 Genes are used to increase the number of tillers in rice.

Images