Application of StDGD1 gene related to potato greening and yield

Abstract

The invention discloses application of an StDGD1 gene related to potato greening and yield, and belongs to the technical field of genetic engineering. According to the invention, the potato StDGD1 gene is accurately edited by virtue of a CRISPR / Cas9 gene editing technology, so that the potato mutant with remarkable improved characters is successfully created. Under the light condition, the chlorophyll content in the tuber of the mutant is remarkably reduced, the greening degree is remarkably delayed, the shelf life of potatoes is prolonged, and the appearance quality of the potatoes is improved. Meanwhile, the accumulation amount of toxic solanine (including alpha-solanine and alpha-canthine) in the mutant tubers is greatly reduced, and the edible safety of the potatoes is improved. The mutation does not cause adverse effects on the tuber yield while realizing the quality improvement, the yield level equivalent to that of a wild type is maintained, and the research result of the invention provides an important gene resource for cultivating a new potato variety with excellent anti-greening character and stable yield.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a method related to potato greening and yield. StDGD1 Applications of genes. Background Technology

[0002] Potatoes are one of the world's most important food crops, containing B vitamins such as B1, B2, B6, and pantothenic acid, as well as a large amount of high-quality fiber, making them highly nutritious. However, when potato tubers are exposed to sunlight, chlorophyll accumulates in large quantities in the tuber epidermis, causing the potato surface to turn green, a condition known as green staining. Along with green staining, toxic alkaloids such as solanine also accumulate. These toxins, at high concentrations, are harmful to human health, causing gastrointestinal discomfort, hallucinations, and allergic reactions. Developing green stain-resistant varieties through genetic modification is considered an ideal solution.

[0003] From a physiological perspective, greening originates from the formation of chloroplasts and the synthesis of chlorophyll, which are closely related to photosynthesis, the core process that determines yield. Therefore, any genetic manipulation that inhibits greening by weakening chloroplast development or chlorophyll synthesis (such as mutation or suppression of related genes) is generally understood to almost inevitably lead to a decrease in photosynthetic capacity, thereby causing slower plant growth and reduced tuber yield.

[0004] Potatoes StDGD1 The gene is annotated to encode digalactosyldiglyceride synthase 1 (DGD1), which is crucial for maintaining thylakoid membrane stability and photosynthetic function. Theoretically, manipulation of this gene might affect chlorophyll metabolism, but it would most likely also result in impaired photosynthesis and reduced yield. Therefore, no reports to date indicate that... StDGD1 Deletion mutations in genes can fundamentally alleviate the problems of greening and toxin accumulation in potatoes while ensuring no yield loss. Therefore, it is of great research significance to combine the quality improvement goal of inhibiting light-induced greening of potato tubers with the core agronomic requirement of maintaining stable yield, and to create an ideal germplasm that achieves both. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide a method related to potato greening and yield. StDGD1 In its application to genes, this invention utilizes gene editing technology to verify... StDGD1 Gene deletion mutations can delay potato greening without changing yield, and reduce the chlorophyll and solanine content in potato tubers, providing important support for the cultivation of superior potato germplasm resources.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a potato StDGD1 The application of genes in any of the following (1)-(3): (1) Reduce the chlorophyll content in potatoes after exposure to light and stabilize yield; (2) Reduce the solanine content in potatoes after exposure to light and stabilize yield; (3) Develop new potato varieties that are resistant to greening, low in toxins and have stable yield.

[0007] The potato StDGD1 The nucleotide sequence of the gene coding region is shown in SEQ ID NO: 1, as follows:

[0008] Preferably, through the processing of potatoes StDGD1 Editing the coding region of a gene to render it nonfunctional can reduce the chlorophyll content in potato tubers after exposure to light and stabilize yield and / or reduce the solanine content in potatoes after exposure to light and stabilize yield. Or, by using potatoes StDGD1 The promoter region of the gene was edited to reduce its transcription level, thereby reducing the chlorophyll content in potato tubers after exposure to light and stabilizing yield, and / or reducing the solanine content in potatoes after exposure to light and stabilizing yield.

[0009] The potato StDGD1 The nucleotide sequence of the promoter region of the gene is shown in SEQ ID NO: 3, as follows:

[0010] In a second aspect, the present invention provides the aforementioned potato StDGD1 The application of the gene-encoded protein in the following (1) or (2): (1) Reduce the chlorophyll content in potatoes after exposure to light and stabilize yield; (2) Reduce the solanine content in potatoes after exposure to light and stabilize yield; The potato StDGD1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 2, as follows: .

[0011] Preferably, by inhibiting potato StDGD1 The activity of gene-encoded proteins can be used to reduce chlorophyll content in potato tubers after exposure to light and stabilize yield, and / or reduce solanine content in potatoes after exposure to light and stabilize yield.

[0012] In a third aspect, the present invention provides a potato StDGD1 Gene mutants, said mutants are produced by modifying potatoes StDGD1The potato was obtained by editing its genes to render them non-functional. StDGD1 The nucleotide sequence of the gene mutant is any one of the following DNA molecules: i)-iii) i) The nucleotide sequence is the DNA molecule shown in SEQ ID NO: 4, as follows: SEQ ID NO: 4:

[0013] ii) The nucleotide sequence is the DNA molecule shown in SEQ ID NO: 5, as follows: SEQ ID NO: 5:

[0014] iii) Equivalent mutant sequences that have greater than 90% sequence identity with SEQ ID No: 4 or SEQ ID No: 5 and result in loss of function of the StDGD1 protein.

[0015] The potato StDGD1 Compared with wild-type potatoes, the gene mutants have at least one of the following phenotypes: (1) Under light conditions, the degree of greening of the tubers is significantly delayed; (2) The chlorophyll content in the tuber epidermis was significantly reduced; (3) The content of solanine in the tubers was significantly reduced; (4) There was no significant difference in tuber yield compared with the wild type.

[0016] In a fourth aspect, the present invention provides a method for preparing potatoes. StDGD1 The method for handling gene mutants includes the following steps: (1) In potatoes StDGD1 Target sequences were selected in the gene coding region, and sgRNA coding sequences were designed and synthesized using sequences complementary to the target sequences as spacers. (2) After ligating the sgRNA coding sequence to the AtU6-26 promoter, it was cloned into the vector PHSN / BUN401-Cas9 to construct a... StDGD1 Gene editing vectors; (3) StDGD1 Gene editing vectors are introduced into potato recipient cells or tissues for screening. StDGD1 Positive plants resulting from gene deletion mutations are potato plants. StDGD1 Gene mutants.

[0017] Preferably, in step (1), the selected target sequence is as shown in SEQ ID No: 6-SEQ ID No: 9.

[0018] In a fifth aspect, the present invention provides a biomaterial containing the nucleotide sequence shown in SEQ ID No: 4 or SEQ ID No: 5, characterized in that the biomaterial is any one of the following: (1) A recombinant expression vector containing the nucleotide sequence shown in SEQ ID NO: 4 or SEQ ID NO: 5; (2) Host cells containing the recombinant expression vector described in (1); (3) Transgenic plant tissues, organs or plants whose genomes contain the nucleotide sequences shown in SEQ ID NO: 4 or SEQ ID NO: 5.

[0019] In a sixth aspect, the present invention provides the aforementioned potato. StDGD1 The use of gene mutants or the above-mentioned biological materials in any of the following (1)-(3): (1) Reduce the chlorophyll content in potatoes after exposure to light and stabilize yield; (2) Reduce the solanine content in potatoes after exposure to light and stabilize yield; (3) Develop new potato varieties that are resistant to greening, low in toxins and have stable yield.

[0020] The beneficial effects of this invention are: 1. This invention is the first to discover that by inhibiting potato... StDGD1 The gene function can simultaneously achieve multiple objectives, such as delaying postharvest greening and significantly reducing the accumulation of toxic solanine (α-solanine and α-carboxine), while maintaining tuber yield no significant difference from the wild type. This breaks the traditional understanding that genes inhibiting chlorophyll synthesis often come at the cost of photosynthetic efficiency and yield, providing important genetic resources and breeding methods for cultivating new potato varieties that combine excellent greening resistance with stable yield.

[0021] 2. This invention is the first to utilize CRISPR / Cas9 gene editing technology to edit potatoes. StDGD1 Precise gene editing successfully created a potato mutant with significantly improved traits. Under light conditions, this mutant exhibits a significantly delayed rate of tuber greening and a significantly reduced chlorophyll content in the tuber epidermis, effectively mitigating field losses caused by tuber greening and extending the potato's shelf life and appearance. Simultaneously, the mutant tubers show a substantial decrease in the accumulation of toxic solanine (including α-solanine and α-carboxine), improving the potato's safety for consumption. Crucially, this mutation, while achieving these quality improvements, did not adversely affect tuber yield, maintaining a yield level comparable to the wild type, demonstrating significant application potential. Attached Figure Description

[0022] Figure 1 for StDGD1 A schematic diagram of gene editing vector construction.

[0023] Figure 2 A homozygous mutant line of potato stdgd1 - 1. stdgd1 - 2 Sequencing results of the mutation target.

[0024] Figure 3 For the wild type and StDGD1 Gene mutants stdgd1 Appearance phenotype after 6 days of exposure under simulated shelf-life conditions.

[0025] Figure 4For the wild type and StDGD1 Gene mutants ( stdgd1 - 1. stdgd1 - 2 The difference in chlorophyll content.

[0026] Figure 5 For the wild type and StDGD1 Gene mutants ( stdgd1 - 1. stdgd1 - 2 The differences in concentrations of α-solanine and α-carbohydrate.

[0027] Figure 6 For the wild type and StDGD1 Gene mutants ( stdgd1 - 1. stdgd1 - 2 Production statistics. Detailed Implementation

[0028] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0029] Currently, potatoes face technical problems during planting, transportation, storage, and sales, including susceptibility to greening and high chlorophyll and solanine content. To address these issues, this invention discloses a mutant potato. StDGD1 Application of gene inhibition of potato greening, reducing the chlorophyll and solanine content in potato tubers, while maintaining the same yield as the wild type.

[0030] This invention is based on the potato variety " Desiree "cloning" StDGD1 The full-length cDNA sequence of the gene (as shown in SEQ ID No: 1) was obtained, and based on this, the gene was targeted for modification using CRISPR / Cas9 gene editing technology. Through screening and identification of the edited plants, successful [editing techniques were achieved]. StDGD1 Novel mutant material with gene loss of function. Sequencing results show that the mutant... stdgd1-1 The nucleotide sequence is shown in SEQ ID No: 4, with frameshift mutations occurring after amino acid codons 85 and 184 in the coding region; the mutant stdgd1 - 2 The nucleotide sequence is shown in SEQ ID No: 5, which shows a frameshift mutation after the 85th amino acid codon. All of these mutations lead to potato... StDGD1 The protein encoded by the gene (SEQ ID No: 2) is prematurely truncated, forming a mutant StDGD1 protein that loses its function.

[0031] The mutant potatoes obtained have the following characteristics: (1) The degree of greening of the mutant potato tubers is significantly lower than that of the wild type. (2) The yield of the mutant potato tubers is unchanged compared with that of the wild type. (3) The chlorophyll content, α-solanine and α-carboxine content of the mutant potato tubers are significantly lower than those of the wild type.

[0032] The research findings of this invention provide a research foundation for the quality improvement of potato crops and the breeding of new varieties, and are of great significance in production practice.

[0033] The specific embodiments of the present invention will be described in further detail below with reference to examples. The following detailed descriptions are illustrative and intended to provide further explanation of this application, rather than limiting the scope of the invention.

[0034] Example 1: Potato StDGD1 Creation and identification of mutants 1. StDGD1 Construction of gene editing vectors With potato varieties " Desiree Using [the material], total RNA was extracted from its tubers and reverse transcribed to synthesize cDNA. Primers were designed based on the reported potato DGD1 homologous gene sequence, and cDNA was obtained by PCR amplification. StDGD1 The full-length cDNA sequence of the gene was obtained. Sequencing results showed that the nucleotide sequence of the gene is shown in SEQ ID NO: 1, with a full length of 2403 bp, encoding 800 amino acids, and its amino acid sequence is shown in SEQ ID NO: 2.

[0035] Using the CRISPR-2.0 online tool, in StDGD1 Four target sequences were selected from the gene coding region, namely: Target 1: ccttacctggaggggggtcctcg (SEQ ID NO: 6) Target 2: gccagtgttcttcagagtactgg (SEQ ID NO: 7) Target 3: ccaagcagaatctagaaggcgat (SEQ ID NO: 8) Target 4: ccttccttggatgacaggaactg (SEQ ID NO: 9) Based on the target sequences described above, their corresponding complementary sequences were synthesized as spacer sequences and assembled with the sgRNA backbone sequence to construct a complete sgRNA coding frame. After gene synthesis using the sgRNA coding frame and the AtU6-26 promoter, it was then inserted into the BasI restriction site of the CRISPR / Cas9 vector PHSN / BUN401-Cas9, thereby constructing a complete sgRNA coding frame. StDGD1 Gene editing vector (structural diagram) Figure 1 Sequencing confirmed that the vector construction was correct.

[0036] The sgRNA coding sequence is shown in SEQ ID NO: 10, and is as follows:

[0037] 2. Potatoes StDGD1 Creation of mutants The above is correctly constructed StDGD1 Gene-editing vectors were transformed into Agrobacterium GV3101 to obtain engineered host cells. Using potato as an example... Desiree "The cotyledonary explants of the variety are used as recipient materials. The explants are infected by Agrobacterium-mediated genetic transformation. After callus induction, resistance screening, differentiation and rooting culture, transgenic plants are obtained."

[0038] Extracting genomic DNA from transgenic plants, targeting StDGD1 PCR amplification and sequencing analysis were performed on the gene editing target region. The results showed that two homozygous mutation types were successfully obtained: stdgd1 - 1 A 65 bp deletion occurs at the target site, resulting in a frameshift of the coding sequence, the nucleotide sequence of which is shown in SEQ ID NO: 4; stdgd1 - 2 A 103 bp deletion occurs at the target site, which also leads to a frameshift mutation, and its nucleotide sequence is shown in SEQ ID NO: 5.

[0039] See mutant sequencing sequence Figure 2 .

[0040] Example 2: Determination and analysis of the green phenotype of mutant tubers and chlorophyll content in the epidermis wild type and StDGD1 Gene mutants ( stdgd1 - 1 and stdgd1 - 2 After treating the tubers under simulated shelf-life conditions (temperature 20 ℃, humidity 80-85%, light intensity 150-200 lux, 16 h / d) for 6 days, their appearance changes were observed. The results are as follows: Figure 3 As shown, the degree of greening on the surface of the mutant tubers was significantly lower than that of the wild type, indicating that... StDGD1 The deletion of genes can effectively delay the greening of potatoes after exposure to light.

[0041] Further, ultraviolet spectrophotometry was used. Potato peels were ground into powder using a grinder. 1.0 g of potato peel sample was taken and 25 mL of 95% ethanol was added. Extraction was carried out at 0°C in the dark for 24 h, followed by filtration into a glass centrifuge tube. The residue, filter paper, and glass rod were washed with the same ethanol. The filtrate was transferred to a volumetric flask and the extraction was continued until no green color was observed on the residue and filter paper. The volume was then adjusted to 30 mL with 95% ethanol. Using 95% ethanol as a blank control, the absorbance of the extract was measured at wavelengths of 665 nm and 649 nm.

[0042] Ca = 13.95A665 - 6.88A649 Cb = 24.96A649 - 7.32A665 Total chlorophyll concentration (mg / L): C (a+b) =C a +C b The sum of the total concentrations of chlorophyll a and chlorophyll b is the total chlorophyll concentration.

[0043] Total chlorophyll mass fraction (mg / kg) = C (a+b) ×50 / M, where M is the fresh weight of the sample.

[0044] The results are as follows Figure 4 As shown, StDGD1 The chlorophyll content of the gene mutant was significantly lower than that of the wild type, indicating that StDGD1 Gene deletion can inhibit chlorophyll accumulation.

[0045] Example 3: Determination of solanine content in mutant tubers Take wild type and StDGD^1 The contents of α-solanine and α-carboxine in the tubers of the gene mutant were determined by high-performance liquid chromatography (HPLC). The determination steps are as follows: Weigh approximately 0.2 g of sample, add 1 mL of 5% acetic acid solution, homogenize in an ice bath, sonicate in an ice-water bath for 30 min, extract overnight, centrifuge at 8000 g for 10 min, collect the supernatant, add 0.5 mL of 5% acetic acid solution to the precipitate, sonicate for 30 min for re-extraction, combine the supernatants, adjust the pH to approximately 11.0 with NaOH aqueous solution, extract three times with chloroform, combine the organic phases, dry under nitrogen, redissolve in 1 mL of methanol, filter with a syringe filter, and then proceed with the analysis.

[0046] HPLC conditions: Thermo U3000 high-performance liquid chromatograph, Thermo C18 reversed-phase column (250 mm × 4 mm, 5 μm), mobile phase preparation: A: acetonitrile, B: 0.02 M potassium dihydrogen phosphate solution (A:B = 25:75), injection volume 10 μL, flow rate 1 mL / min, column temperature 30℃, UV wavelength 270 nm. After the baseline stabilized, the sample was added and measured.

[0047] The results are as follows Figure 5 As shown, StDGD1 The levels of α-solanine and α-carboxine in the mutant were significantly lower than those in the wild type.

[0048] Example 4: Statistics on the yield of mutant tubers Wild-type and... under the same cultivation conditions StDGD1 The yield of tubers per plant was calculated after harvesting the mutant plants. Results are as follows: Figure^6 As shown, there was no significant difference in tuber yield between the mutant and the wild type, indicating that... StDGD1 While significantly improving the traits of tuber greening and toxin accumulation, the gene deletion did not affect the yield trait of potatoes.

[0049] The above description is merely a preferred embodiment of this application and is not intended to limit this application. The above embodiments, through CRISPR / Cas9-mediated coding region knockout, specifically and sufficiently demonstrate the suppression of... StDGD1 The superior effects achievable by the gene function. Those skilled in the art will understand that loss or severe impairment of the gene function is a sufficient condition for obtaining the phenotype described in this invention.

[0050] Based on the same inventive concept, any other genetic manipulation that can achieve the same or similar functional repression effect, such as deleting or mutating the promoter region of the gene to significantly weaken its transcription, or using artificial transcription repressors to specifically bind to its regulatory sequence, can also achieve the purpose of this invention. These technical means, which are not listed one by one in the embodiments but are of the same principle, are all simple modifications or equivalent substitutions to the technical solutions of this invention, and should be considered to be included within the protection scope of this invention.

Claims

1. Potatoes StDGD1 The application of genes in any of the following (1)-(3): (1) Reduce the chlorophyll content in potatoes after exposure to light and stabilize yield; (2) Reduce the solanine content in potatoes after exposure to light and stabilize yield; (3) Develop new potato varieties that are resistant to greening, low in toxins, and have stable yields; The potato StDGD1 The nucleotide sequence of the gene coding region is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that, Through potatoes StDGD1 Editing the coding region of a gene to render it nonfunctional can reduce the chlorophyll content in potato tubers after exposure to light and stabilize yield and / or reduce the solanine content in potatoes after exposure to light and stabilize yield. Or, by using potatoes StDGD1 The promoter region of the gene was edited to reduce its transcription level, thereby reducing the chlorophyll content in potato tubers after exposure to light and stabilizing yield, and / or reducing the solanine content in potatoes after exposure to light and stabilizing yield.

3. The potato according to claim 1 StDGD1 The application of the gene-encoded protein in the following (1) or (2): (1) Reduce the chlorophyll content in potatoes after exposure to light and stabilize yield; (2) Reduce the solanine content in potatoes after exposure to light and stabilize yield; The potato StDGD1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:

2.

4. The application according to claim 3, characterized in that, By inhibiting potatoes StDGD1 The activity of gene-encoded proteins can be used to reduce chlorophyll content in potato tubers after exposure to light and stabilize yield, and / or reduce solanine content in potatoes after exposure to light and stabilize yield.

5. A type of potato StDGD1 Gene mutants, characterized by, The mutant is obtained by modifying the potato according to claim 1. StDGD1 The potato was obtained by editing its genes to render them non-functional. StDGD1 The nucleotide sequence of the gene mutant is any one of the following DNA molecules: i)-iii) i) The nucleotide sequence is the DNA molecule shown in SEQ ID NO: 4; ii) The nucleotide sequence is the DNA molecule shown in SEQ ID NO: 5; iii) Equivalent mutant sequences that have greater than 90% sequence identity with SEQ ID No:4 or SEQ ID No:5 and result in loss of function of the StDGD1 protein.

6. The potato according to claim 5 StDGD1 Gene mutants, characterized by, The potato StDGD1 Compared with wild-type potatoes, the gene mutants have at least one of the following phenotypes: (1) Under light conditions, the degree of greening of the tubers is significantly delayed; (2) The chlorophyll content in the tuber epidermis was significantly reduced; (3) The content of solanine in the tubers was significantly reduced; (4) There was no significant difference in tuber yield compared with the wild type.

7. A method for preparing potatoes StDGD1 The method for gene mutants is characterized by, Includes the following steps: (1) The potato as described in claim 1 StDGD1 Target sequences were selected in the gene coding region, and sgRNA coding sequences were designed and synthesized using sequences complementary to the target sequences as spacers. (2) After linking the sgRNA coding sequence to the AtU6-26 promoter, it was cloned into the vector PHSN / BUN401-Cas9 to construct a... StDGD1 Gene editing vectors; (3) StDGD1 Gene editing vectors are introduced into potato recipient cells or tissues for screening. StDGD1 Positive plants resulting from gene deletion mutations are potato plants. StDGD1 Gene mutants.

8. The method according to claim 7, characterized in that, In step (1), the selected target sequence is shown as SEQ ID No:6-SEQ ID No:

9.

9. A biomaterial containing the nucleotide sequence shown in SEQ ID No: 4 or SEQ ID No: 5, characterized in that, The biomaterial is any one of the following: (1) A recombinant expression vector containing the nucleotide sequence shown in SEQ ID NO: 4 or SEQ ID NO: 5; (2) Host cells containing the recombinant expression vector described in (1); (3) Transgenic plant tissues, organs or plants whose genomes contain the nucleotide sequences shown in SEQ ID NO: 4 or SEQ ID NO:

5.

10. The potato according to claim 5 StDGD1 The use of the gene mutant or the biological material of claim 9 in any one of the following (1)-(3): (1) Reduce the chlorophyll content in potatoes after exposure to light and stabilize yield; (2) Reduce the solanine content in potatoes after exposure to light and stabilize yield; (3) Develop new potato varieties that are resistant to greening, low in toxins and have stable yield.

Images