Nucleic acid extraction reagent combination, kit and application of nucleic acid extraction reagent combination in preparation of prostatic cancer diagnostic product

Abstract

The invention discloses a nucleic acid extraction reagent combination. The nucleic acid extraction reagent combination is prepared from the following components: MagZol 3BD, Buffer BCP2, Buffer RW1 and Buffer RW2, the MagZol 3BD is mainly prepared from guanidine isothiocyanate, phenol and ultrapure water; the Buffer BCP2 is mainly prepared from 1-bromo-3-chloropropane, and the buffer BCP2 is prepared from 1-bromo-3-chloropropane; the Buffer RW1 is mainly prepared from guanidine isothiocyanate, ethanol and ultrapure water; and the Buffer RW2 is a 10 * STE buffer solution. The invention also discloses a nucleic acid extraction kit containing the nucleic acid extraction reagent combination, and application of the nucleic acid extraction kit in screening and diagnosis of prostatic cancer. The nucleic acid extraction reagent combines a one-step RNA extraction technology and a column RNA purification technology, can be used for blood nucleic acid extraction and prostatic cancer diagnosis, detects the expression levels of TIMP1, TMEM176B and ITGB5 genes related to prostatic cancer in blood through blood total RNA extraction and a multiple fluorescent PCR technology, and diagnoses prostatic cancer through a three-gene risk prediction model. The kit has very high specificity and sensitivity for diagnosis of the prostatic cancer, and can be used for effective screening and diagnosis of the prostatic cancer.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a nucleic acid extraction reagent combination, a kit, and their application in the preparation of prostate cancer diagnostic products. Background Art

[0002] Prostate cancer (PCa) is an epithelial malignant tumor that occurs in the prostate. It is the abnormal and uncontrolled growth of cells in the prostate gland, forming a tumor. It is one of the common malignant tumors in the male urogenital system. The incidence and mortality rates of multiple cancers in China are generally higher than the global average level. Prostate cancer may cause symptoms such as urinary problems, weakened urine flow, difficulty urinating, pain, hematuria or blood in semen, persistent bone pain, swelling, weakness or numbness in the legs or ankles, and unexplained weight loss.

[0003] The screening and diagnosis of prostate cancer are crucial for determining the treatment plan. The diagnostic methods for prostate cancer include digital rectal examination, prostate-specific antigen determination, transrectal ultrasound examination, prostate biopsy, and other imaging examinations. The diagnostic method of prostate biopsy is invasive, and the willingness of patients to be diagnosed is relatively low. The determination of prostate-specific antigen (PSA) assists in the clinical diagnosis of prostate cancer by detecting the concentration of PSA in serum. Prostate-specific antigen is a protease. When the presence of prostate-specific antigen is detected in the blood, it is usually determined that the patient has benign or malignant prostate lesions.

[0004] Currently, the clinical diagnostic indicators for prostate cancer in China are the concentrations of free and total PSA in blood. However, there is a gray zone for the diagnostic value of PSA, that is, the range of 4 ng / mL < PSA < 10 ng / mL, which brings certain risks of misdiagnosis, missed diagnosis, and over-treatment in the diagnosis of prostate cancer. Therefore, in clinical practice, it is often necessary to combine imaging examinations and pathological biopsies to further clarify the diagnosis. Since PSA is specific to the prostate tissue rather than prostate cancer, the phenomenon of increased serum PSA also appears in many benign diseases such as benign prostatic hyperplasia.

[0005] In summary, there is currently a lack of effective serological markers and other simple and effective methods for diagnosing prostate cancer. In addition, the existing methods for diagnosing prostate cancer have low sensitivity and specificity and cannot be used to accurately diagnose prostate cancer. Summary of the Invention

[0006] The first object of the present invention is to provide a nucleic acid extraction product that combines the one-step RNA extraction technology and the column RNA purification technology to solve the above technical problems, enrich the diagnostic tools for prostate cancer screening and diagnosis, and help accurately diagnose prostate cancer.

[0007] Another object of the present invention is to provide a kit comprising the above-described combination of nucleic acid extraction reagents.

[0008] Another object of the present invention is to provide the application of the nucleic acid extraction reagent combination.

[0009] To achieve the above-mentioned objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides a nucleic acid extraction reagent combination comprising: MagZol 3BD, BufferBCP2, Buffer RW1 and Buffer RW2; The MagZol 3BD was prepared by the following method: a 4M guanidine isothiocyanate solution was prepared by guanidine isothiocyanate and ultrapure water, and then uniformly mixed with a water-saturated phenol solution at a volume ratio of 1:1. The Buffer BCP2 is 1-bromo-3-chloropropane; The Buffer RW1 was prepared by the following method: after preparing a 1M guanidine isothiocyanate solution with guanidine isothiocyanate and ultrapure water, it was uniformly mixed with anhydrous ethanol at a volume ratio of 2:1. The Buffer RW2 is a 10×STE buffer solution, diluted 5 times with anhydrous ethanol as the working solution.

[0010] Furthermore, the volume ratio of MagZol 3BD, Buffer BCP2, Buffer RW1 and Buffer RW2 is 2.4 mL: 280 µL: 800 µL: 1000 µL.

[0011] Furthermore, the pH of the MagZol 3BD is 3.0-5.0, more preferably 4.0.

[0012] Furthermore, the pH of the 10×STE buffer is 8.0.

[0013] Guanidine isothiocyanate and phenol can denature proteins. Simultaneously, guanidine isothiocyanate inhibits nuclease activity, thereby improving nucleic acid extraction efficiency. 1-Bromo-3-chloropropane promotes the separation of the organic and aqueous phases. 10×STE Buffer provides a stable pH environment while inhibiting nuclease activity. The components work synergistically to enhance nucleic acid extraction efficiency.

[0014] Secondly, the present invention provides a nucleic acid extraction kit, which includes the nucleic acid extraction reagent combination described in the present invention, and a nucleic acid adsorption material.

[0015] Furthermore, the nucleic acid adsorption material includes a nucleic acid adsorption column and a collection tube.

[0016] Furthermore, the nucleic acid adsorption column is a silica gel adsorption column.

[0017] Thirdly, the present invention provides a method for extracting free nucleic acids from biological samples using the nucleic acid extraction kit, comprising the following steps: Step a: Add MagZol 3BD to the biological sample, vortex to mix, and incubate. Step b: Add Buffer BCP2, vortex to mix, let stand, centrifuge, add anhydrous ethanol, mix well, and obtain the mixture. Step c: Transfer the mixture to a nucleic acid adsorption material, centrifuge, and discard the filtrate; Step d: Add DNase mixture and digest to remove DNA; Step e: Add Buffer RW1 for washing, centrifuge, and discard the filtrate; Step f: Add Buffer RW2 for washing, centrifuge, discard the filtrate, and centrifuge again; Step g: Add sterile, nuclease-free water, let stand at room temperature, centrifuge to obtain free nucleic acids.

[0018] Preferably, the DNase mixture comprises DNase and DNase buffer.

[0019] Fourthly, the present invention also provides the application of the nucleic acid extraction reagent combination or the blood nucleic acid extraction kit in the preparation of prostate cancer diagnostic products.

[0020] Preferably, in the application, prostate cancer is diagnosed by detecting the expression levels of the TIMP1, TMEM176B, and ITGB5 genes in the blood.

[0021] Preferably, in the application, the expression levels of the TIMP1, TMEM176B and ITGB5 genes in blood are detected by multiplex fluorescent PCR technology.

[0022] Preferably, in the application, the PCR amplification primers and fluorescent probes for TIMP1, TMEM176B, and ITGB5 are as follows: TIMP1 positive primer: TCCCAGATAGCCTGAATCCT; TIMP1 antisense primer: TGCTGGGTGGTAACTCTTTATT; TIMP1 fluorescent probe: FAM-CTGTTCCCACTCCCATCTTTCTTCCG-DBQ1; TMEM176B positive primer: TGCGTGAATAGCTTCATCTG; TMEM176B antisense primer: CATTGGTTCTCTCTTGACTTCGCC; TMEM176B fluorescent probe: VIC-CATCGACACTGTGTGTGATCGCTCAGAC-DBQ1; ITGB5 positive primer: CGCTATGAAATGGCTTCAAATCCA; ITGB5 antisense primer: GGAGAAGGAAACATCAGTCCACA; ITGB5 fluorescent probe: Texas Red-ATCTCCACGCACACTGTGGACTTCACCTTC-DBQ2.

[0023] Preferably, in the application, prostate cancer is diagnosed using a risk prediction model. The model calculates the ΔCt values ​​of the TIMP1, TMEM176B, ITGB5, and internal reference genes based on the expression levels of these genes in the sample. These values ​​are then substituted into the model to calculate a risk score, and the result is judged according to the cutoff value. If the calculated value is higher than the cutoff value, the diagnosis result is positive, indicating prostate cancer; if it is lower than the cutoff value, the diagnosis result is negative, indicating that it is not prostate cancer.

[0024] More preferably, the risk prediction model formula is: Score = -5.131*ΔCt(TIMP1)+0.034*ΔCt(TMEM176B)+1.999*ΔCt(ITGB5)-4.471, with -0.545 as the critical value.

[0025] This invention provides a nucleic acid extraction reagent combining one-step RNA extraction and column RNA purification techniques. It can be used for blood nucleic acid extraction and prostate cancer diagnosis. By collecting blood samples and extracting total RNA, and combining it with mRNA primers and fluorescent probes for three genes—TIMP1, TMEM176B, and ITGB5—the expression levels of specific genes can be quantitatively detected. This invention uses total blood RNA extraction and multiplex fluorescent PCR to detect the expression levels of three prostate cancer-related genes—TIMP1, TMEM176B, and ITGB5—in blood. A three-gene risk prediction model is then used to diagnose prostate cancer, achieving a sensitivity of 89.5% and a specificity of 81.4%. This demonstrates very high specificity and sensitivity for prostate cancer diagnosis and can be used for screening, allowing patients to receive early treatment and thus reducing prostate cancer mortality. The sample used in this invention is peripheral venous blood, which is relatively non-invasive compared to tissue biopsy, making it more acceptable to patients. Furthermore, samples can be collected multiple times according to the patient's condition and treatment progress, achieving minimally invasive and dynamic monitoring. This invention is applicable to the auxiliary diagnosis of suspected cases where abnormalities are found by non-invasive methods such as digital rectal examination, serum prostate-specific antigen (PSA), or imaging, and further clinical examination is required. It is particularly suitable for cases where the aforementioned non-invasive methods cannot determine whether a biopsy should be performed. This invention not only enriches the biomarkers available for prostate cancer diagnosis but also provides a relatively non-invasive, convenient, and highly sensitive method for prostate cancer diagnosis. It effectively overcomes the limitations of the PSA diagnostic gray zone and invasive diagnostic methods, and is of great significance for the screening and diagnosis of prostate cancer. Attached Figure Description

[0026] Figure 1 This is the ROC curve of a prostate cancer diagnostic model. Detailed Implementation

[0027] To facilitate understanding of the present invention, a more complete description will be given below with reference to specific embodiments. Preferred embodiments of the invention are shown in the accompanying drawings. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the invention.

[0028] In the description of this invention, unless otherwise explicitly defined, terms such as heating, cleaning, weighing, and freezing should be interpreted broadly. Those skilled in the art can reasonably determine the specific meaning of the above terms in this invention in conjunction with the specific content of the technical solution.

[0029] In the description of this invention, references to terms such as "some embodiments" and "examples" indicate that the specific methods or materials described in connection with that embodiment or example are included in at least one embodiment or example of the invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiments or examples. Furthermore, the specific methods and materials described may be combined in any suitable manner in one or more embodiments or examples.

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0031] In the following examples and comparative examples, unless otherwise specified, the reagents, methods and equipment used in this invention are conventional reagents, methods and equipment in this technical field.

[0032] The reagents used in the following examples are: (1) guanidine isothiocyanate (Sangon Biotech (Shanghai) Co., Ltd.); (2) water-saturated phenol solution (Guangzhou Chemical Reagent Factory); (3) 1-bromo-3-chloropropane (Guangzhou Chemical Reagent Factory); (4) deoxyribonuclease I (DNase I) (Sangon Biotech (Shanghai) Co., Ltd.); (5) anhydrous ethanol (Guangzhou Chemical Reagent Factory); (6) 10×STE (Sodium Chloride-Tris-EDTA) buffer (Guangzhou Chemical Reagent Factory); (7) sterile RNase-free water (Guangzhou Chemical Reagent Factory); (8) DNase buffer (Guangzhou Chemical Reagent Factory); (9) AQ322 premixed solution for one-step qRT-PCR using multiplex probes (TransGen Biotech). The reagents and quantities used in the implementation are merely exemplary, and those skilled in the art can make corresponding adjustments according to the actual situation. Unless otherwise specified, the ultrapure water, centrifuge tubes, and pipette tips used were all enzyme-free treated and autoclaved.

[0033] The instruments used in the following examples are: (1) electric thermostatic water bath (Boson Medical Bio-Instrument Co., Ltd. HH.S21-4); (2) pH meter (Shanghai Hongyi Instrument Co., Ltd. PHS-3C); (3) electronic balance (Ohaus International Trading (Shanghai) Co., Ltd. EX125DZH); (4) micro-volume high-speed centrifuge (Hunan Hengnuo Instrument Equipment Co., Ltd. 1-4); (5) medical centrifuge (Hunan Hengnuo Instrument Equipment Co., Ltd. 4-20R); (6) fully automated medical PCR analysis system (Shanghai Hongshi Medical Technology Co., Ltd. SLAN-96S); (7) ultra-micro nucleic acid protein analyzer (Shanghai Jiapeng Technology Co., Ltd. NANO-600).

[0034] The blood samples from prostate cancer (PCa) patients used in this embodiment of the invention were obtained from the First Affiliated Hospital of Sun Yat-sen University, the Third Affiliated Hospital of Sun Yat-sen University, and the Cancer Hospital of Sun Yat-sen University.

[0035] Example 1: Blood RNA Extraction Reagent 1. Preparation of nucleic acid extraction reagents: (1) MagZol 3BD: After preparing a 4M guanidine isothiocyanate solution with guanidine isothiocyanate and ultrapure water, it was mixed with a water-saturated phenol solution at a ratio of 1:1 (V / V) and the solution pH was 4.0.

[0036] (2) Buffer BCP2: 1-bromo-3-chloropropane.

[0037] (3) Buffer RW1: Prepare a 1M guanidine isothiocyanate solution with guanidine isothiocyanate and ultrapure water, and then mix it with anhydrous ethanol at a ratio of 2:1 (V / V).

[0038] (4) Buffer RW2: 10×STE buffer (pH=8.0). Dilute with anhydrous ethanol 5 times the volume to prepare the working solution.

[0039] 2. Extraction steps: (1) Take 2 mL of anticoagulated human peripheral venous blood in a 15 mL centrifuge tube and add 2.4 mL of MagZol 3BD. Immediately after adding MagZol 3BD, shake vigorously up and down for 15 seconds to mix, and then incubate in a water bath at 60°C for 10 minutes.

[0040] (2) Add 280µL of Buffer BCP2, shake vigorously up and down by hand for 15 seconds, and let stand at room temperature for 3 minutes. Centrifuge horizontally at 2400-5000×g for 10 minutes at room temperature.

[0041] (3) Transfer the supernatant to a new centrifuge tube, add 0.5 times the volume of anhydrous ethanol, invert 3-5 times to mix, and obtain a mixture.

[0042] (4) Place the nucleic acid adsorption column in a 2mL collection tube, add 0.75mL of the mixture into the column, and centrifuge at 12000×g for 30-60 seconds.

[0043] (5) Discard the filtrate, reassemble the column into the collection tube, and transfer the remaining mixture into the column. Centrifuge at 12000×g for 30-60 seconds. Repeat this step until all solutions have been filtered through the column.

[0044] (6) Discard the filtrate, reassemble the column into the collection tube, and add 300µL of Buffer RW1 to the column. Centrifuge at 12000×g for 60 seconds.

[0045] (7) Prepare DNase mixture (90µL per person): Mix 10µL of DNase I and 80µL of DNase buffer and gently aspirate to mix.

[0046] (8) Pipette 90µL of DNase mixture into the center of the column membrane and let it stand at room temperature for 15 minutes to digest and remove DNA.

[0047] (9) Add 500µL Buffer RW1 to the column, let stand for 5 minutes, and centrifuge at 12000×g for 60 seconds.

[0048] (10) Discard the filtrate and reassemble the column into the collection tube. Add 500µL of Buffer RW2 (working solution) to the column. Centrifuge at 12000×g for 60 seconds.

[0049] (11) Discard the filtrate and reassemble the column into the collection tube. Add 500µL of Buffer RW2 (working solution) to the column. Centrifuge at 12000×g for 60 seconds.

[0050] (12) Discard the filtrate and put the column back into the collection tube. Centrifuge the empty column at 13000×g for 3 minutes and shake off the matrix from the column.

[0051] (13) Transfer the column to a 1.5 mL centrifuge tube (enzyme-free and sterile). Add sterile RNase-free water to the center of the membrane in the column. Let stand at room temperature for 2 minutes. Centrifuge at 13000×g for 1 minute.

[0052] (14) Discard the RNA column and store the RNA in the 1.5 mL centrifuge tube at -80°C.

[0053] 3. Nucleic acid analysis: (1) Concentration analysis: The concentration of the eluted sample was determined using the NANO-600 micro-volume nucleic acid and protein analyzer, and the sample concentration was recorded.

[0054] (2) The purity of the eluted sample to be tested was detected using the NANO-600 ultra-micro nucleic acid protein analyzer, and the OD260 / OD280 and OD260 / OD230 ratios were recorded.

[0055] 4. Evaluation criteria: (1) Concentration: The higher the concentration, the higher the nucleic acid yield, which proves that the extraction method is better.

[0056] (2) Purity: When the OD260 / OD280 ratio is between 1.8 and 2.2, and the OD260 / OD230 ratio is between 0.3 and 2.2, it proves that the nucleic acid purity meets the requirements.

[0057] 5. The results are shown in Table 1: Table 1. Nucleic acid extraction results of this invention

[0058] 6. Comparative experiment: To further verify the effectiveness of the nucleic acid extraction reagent of the present invention, a commercial nucleic acid extraction kit was used as a comparison. Nucleic acid extraction was performed on peripheral venous blood using commercial kits including: (1) Shenzhen Dakewei Biotechnology Co., Ltd.’s “Human Peripheral Blood Lymphocyte Separation Tube” uses density gradient sedimentation to separate and purify cells based on differences in cell density, with the help of separation solution and centrifugation; (2) "RNA isolater Total RNA ExtractionReagent" from Nanjing Novizan Medical Technology Co., Ltd.

[0059] The extraction steps include: (1) Remove the human peripheral blood lymphocyte separation tube and observe whether the separation fluid has flowed from the bottom of the septum to the top. If so, centrifuge at 20°C, 800 g for 1 minute.

[0060] (2) Pour in blood. The blood sample must be anticoagulated whole blood and does not need to be diluted.

[0061] (3) Centrifuge at 20℃, 800 g for 15 minutes.

[0062] (4) After aspirating some of the plasma, carefully transfer the PBMC cell layer to a new 15 mL centrifuge tube. The PBMC layer should be below the plasma and above the separation solution.

[0063] (5) Add 5 mL of PBS and mix well by pipetting. Centrifuge at 800 g for 5 minutes and discard the supernatant.

[0064] (6) Add 1 mL of RNA isolater lysis buffer, mix well, transfer to a 1.5 mL centrifuge tube, and let stand on ice for 5 minutes.

[0065] (7) Add 1 / 5 volume of chloroform. Shake vigorously for 15 seconds to form an emulsion, and let stand at 4°C for 5 minutes.

[0066] (8) Centrifuge at 4℃, 12000 g for 15 minutes.

[0067] (9) Carefully aspirate the upper aqueous phase into a new centrifuge tube.

[0068] (10) Add an equal volume of pre-cooled isopropanol, mix by inverting the container, and let stand at 4°C for 10 minutes.

[0069] (11) Centrifuge at 4℃, 12000 g for 10 minutes, and a white precipitate can usually be seen.

[0070] (12) Carefully discard the supernatant and add 1 mL of 75% v / v ethanol (prepared with RNase-free water). Gently tap the bottom of the tube to suspend the precipitate, and invert it several times. Let it stand at room temperature for 3-5 minutes.

[0071] (13) Centrifuge at 4℃, 12000 g for 5 minutes.

[0072] (14) Dry and settle in a clean environment at room temperature for 2-5 minutes.

[0073] (15) Add an appropriate amount of RNase Free Water to dissolve the precipitate. If necessary, gently blow the precipitate a few times with a pipette. After it is completely dissolved, take a small amount for testing and store the rest at -80℃.

[0074] The results are shown in Table 2: Table 2. Comparative Experimental Nucleic Acid Extraction Results

[0075] 7. Conclusion Table 3. Comparison of commercial nucleic acid extraction reagents and the nucleic acid extraction reagent of this invention

[0076] The comparison of the test results is shown in Table 3. Under the condition of simple operation, the nucleic acid extraction reagent of this application has a significantly higher nucleic acid yield than that of commercial nucleic acid extraction kits. Furthermore, the OD260 / OD280 and OD260 / OD230 ratios of the extraction results of this application are both between 1.8 and 2.2, indicating that the purity of the extracted nucleic acid is better.

[0077] Example 2: mRNA primers and fluorescent probes In embodiments of the present invention, the primer and fluorescent probe nucleotide sequences designed based on the TIMP1 (Gene ID: 7076), TMEM176B (Gene ID: 28959), ITGB5 (Gene ID: 3693), and GAPDH (Gene ID: 2597) genes are as follows: The TIMP1 primer pair and fluorescent probe sequences are as follows: Primer for positive reactions: 5'-TCCCAGATAGCCTGAATCCT-3' Antisense primer: 5'-TGCTGGGTGGTAACTCTTTATT -3' Fluorescent probe: FAM-CTGTTCCCACTCCCATCTTTCTTCCG-DBQ1 The TMEM176B primer pair and fluorescent probe sequences are as follows: Primer for positive reactions: 5'-TGCGTGAATAGCTTCATCTG -3' Antisense primer: 5'-CATTGGTTCTCTTGACTTCGCC-3' Fluorescent probe: VIC-CATCGACACTGTGTGTGATCGCTCAGAC-DBQ1 The ITGB5 primer pair and fluorescent probe sequences are as follows: Justice primer: 5'-CGCTATGAAATGGCTTCAAATCCA -3' Antisense primer: 5'-GGAGAAGGAAACATCAGTCCACA -3' Fluorescent probe: Texas Red-ATCTCCACGCACACTGTGGACTTCACCTTC-DBQ2 The GAPDH primer pair and fluorescent probe sequences are as follows: Primer for positive reactions: 5'-GAGCCAAAAGGGTCATCATCT-3' Antisense primer: 5'-CCAAAGTTGTCATGGATGACC-3' Fluorescent probe: Cy5-ATGTTCGTCATGGGTGTGAACCATGAGAAG-BHQ3 Example 3: A prostate cancer screening and diagnostic model constructed using TIMP1, TMEM176B, and ITGB5 triple gene detection 1. Extraction of peripheral blood RNA 289 patients from the First Affiliated Hospital of Sun Yat-sen University, the Third Affiliated Hospital of Sun Yat-sen University, and the Cancer Hospital of Sun Yat-sen University were selected, and 2 mL of peripheral venous blood samples were collected from each patient. RNA was extracted according to Example 1.

[0078] 2. Real-time quantitative PCR detection of target genes The target genes TIMP1, TMEM176B, and ITGB5 were detected by real-time quantitative PCR, with GAPDH as the internal reference gene.

[0079] The specific steps of real-time quantitative PCR are as follows: (1) Take 2×qRT-PCR buffer, primer / probe reaction solution and enzyme mixture from the qRT-PCR kit (Fullmetal Biotechnology). After the temperature has reached room temperature, gently shake the mixture in a vortex mixer for 10-30 seconds to mix it. Centrifuge the mixture in a mini centrifuge for 10-30 seconds to remove the liquid from the bottom of the tube. Prepare the qRT-PCR reaction premix according to Table 4. (2) Take out the extracted RNA sample and allow it to reach room temperature. Then, gently vortex for 10-30 seconds to mix. Centrifuge for 10-30 seconds to collect the liquid at the bottom of the tube. Add 7.5µL of the mixture to each of the PCR amplification tubes containing the premixed solution (total RNA in each well is 100-1000ng). After adding the samples in sequence, tighten the caps of the eight-tube strips, vortex for a few seconds, and then centrifuge briefly, ensuring that there are no air bubbles in the wells of the eight-tube strips. (3) Place the PCR reaction tube into the sample slot of the amplification instrument and perform amplification according to the program in Table 8. After amplification, read the Ct value and calculate the ΔCt value of the TIMP1, TMEM176B and ITGB5 genes respectively (ΔCt value = target gene Ct value - internal reference gene Ct value).

[0080] Table 4. qRT-PCR reaction system

[0081] Table 5. qRT-PCR reaction procedure

[0082] 3. Construction of a prostate cancer screening and diagnostic model Calculate the ΔCt values ​​(ΔCt value = target gene Ct value - internal reference gene (GAPDH) Ct value) for TIMP1, TMEM176B and ITGB5 genes respectively. Substitute the ΔCt values ​​of the three genes into the model to calculate the risk score and judge the results according to the critical value.

[0083] The formula for the prostate cancer diagnostic model is: Score = -5.131*ΔCt(TIMP1)+0.034*ΔCt(TMEM176B)+1.999*ΔCt(ITGB5)-4.471, with -0.545 as the critical value.

[0084] If the calculated value is higher than the threshold, the diagnosis is positive, indicating prostate cancer. If the value is lower than the threshold, the diagnosis is negative, indicating that it is not prostate cancer.

[0085] This invention constructs a model for prostate cancer diagnosis by detecting the expression levels of three genes, TIMP1, TMEM176B, and ITGB5, in blood. Different cutoff values ​​were used, and ROC curves were plotted. The results are as follows: Figure 1 As shown.

[0086] When the calculated result is higher than the cutoff value, the sample is classified as positive (i.e., diagnosed as prostate cancer), and when the calculated result is lower than the cutoff value, the sample is classified as negative (i.e., not prostate cancer). At this time, the sensitivity of the diagnosis is 89.5% and the specificity is 81.4%.

[0087] The above results indicate that the combined markers described in this invention can be effectively used for the diagnosis of prostate cancer, thereby improving the accuracy and convenience of prostate cancer diagnosis, and are of great significance in the development of minimally invasive screening and diagnosis of prostate cancer.

[0088] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Therefore, any simple modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. A nucleic acid extraction reagent combination, characterized in that, It includes the following components: MagZol 3BD, Buffer BCP2, Buffer RW1, and Buffer RW2; The MagZol 3BD was prepared by the following method: a 4M guanidine isothiocyanate solution was prepared by guanidine isothiocyanate and ultrapure water, and then uniformly mixed with a water-saturated phenol solution at a volume ratio of 1:

1. The Buffer BCP2 is 1-bromo-3-chloropropane; The Buffer RW1 was prepared by the following method: after preparing a 1M guanidine isothiocyanate solution with guanidine isothiocyanate and ultrapure water, it was uniformly mixed with anhydrous ethanol at a volume ratio of 2:

1. The Buffer RW2 is a 10×STE buffer solution, diluted 5 times with anhydrous ethanol as the working solution.

2. The nucleic acid extraction reagent combination according to claim 1, characterized in that, The volume ratio of MagZol 3BD, Buffer BCP2, Buffer RW1 and Buffer RW2 is 2.4 mL: 280 µL: 800 µL: 1000 µL.

3. A nucleic acid extraction kit, characterized in that, It includes the nucleic acid extraction reagent combination as described in claim 1 or 2, and the nucleic acid adsorption material.

4. The nucleic acid extraction kit according to claim 3, characterized in that, The nucleic acid adsorption material includes a nucleic acid adsorption column and a collection tube.

5. A method for extracting free nucleic acids from biological samples using the nucleic acid extraction kit as described in claim 3 or 4, characterized in that, Includes the following steps: Step a: Add MagZol 3BD to the biological sample, vortex to mix, and incubate. Step b: Add Buffer BCP2, vortex to mix, let stand, centrifuge, add anhydrous ethanol, mix well, and obtain the mixture. Step c: Transfer the mixture to a nucleic acid adsorption material, centrifuge, and discard the filtrate; Step d: Add DNase mixture and digest to remove DNA; Step e: Add Buffer RW1 for washing, centrifuge, and discard the filtrate; Step f: Add Buffer RW2 for washing, centrifuge, discard the filtrate, and centrifuge again; Step g: Add sterile, nuclease-free water, let stand at room temperature, centrifuge to obtain free nucleic acids.

6. The use of the nucleic acid extraction reagent combination as described in claim 1 or 2 or the blood nucleic acid extraction kit as described in claim 3 or 4 in the preparation of prostate cancer diagnostic products.

7. The application according to claim 6, characterized in that, Prostate cancer can be diagnosed by detecting the expression levels of the TIMP1, TMEM176B, and ITGB5 genes in the blood.

8. The application according to claim 7, characterized in that, The expression levels of TIMP1, TMEM176B, and ITGB5 genes in blood were detected using multiplex fluorescent PCR.

9. The application according to claim 8, characterized in that, The PCR amplification primers and fluorescent probes for TIMP1, TMEM176B, and ITGB5 are shown below: TIMP1 positive primer: TCCCAGATAGCCTGAATCCT; TIMP1 antisense primer: TGCTGGGTGGTAACTCTTTATT; TIMP1 fluorescent probe: FAM-CTGTTCCCACTCCCATCTTTCTTCCG-DBQ1; TMEM176B positive primer: TGCGTGAATAGCTTCATCTG; TMEM176B antisense primer: CATTGGTTCTCTCTTGACTTCGCC; TMEM176B fluorescent probe: VIC-CATCGACACTGTGTGTGATCGCTCAGAC-DBQ1; ITGB5 positive primer: CGCTATGAAATGGCTTCAAATCCA; ITGB5 antisense primer: GGAGAAGGAAACATCAGTCCACA; ITGB5 fluorescent probe: Texas Red-ATCTCCACGCACACTGTGGACTTCACCTTC-DBQ2.

10. The application according to any one of claims 7 to 9, characterized in that, Prostate cancer is diagnosed using a risk prediction model. This model calculates the ΔCt values ​​of the TIMP1, TMEM176B, ITGB5, and internal reference genes based on their expression levels in the sample. These values ​​are then substituted into the model to calculate a risk score, and the result is judged according to a cutoff value. If the calculated value is higher than the cutoff value, the diagnosis is positive, indicating prostate cancer; if it is lower than the cutoff value, the diagnosis is negative, indicating it is not prostate cancer. The formula for the risk prediction model is: Score = -5.131*ΔCt(TIMP1)+0.034*ΔCt(TMEM176B)+1.999*ΔCt(ITGB5)-4.471, with -0.545 as the critical value.

Images