Bio-based melanin precursor compound, bio-based melanin and preparation method and application of bio-based melanin precursor compound and bio-based melanin

Abstract

The invention belongs to the technical field of biological dyes, and discloses a bio-based melanin precursor compound, bio-based melanin as well as a preparation method and application of the bio-based melanin precursor compound and the bio-based melanin. The invention provides a bio-based melanin precursor compound 4-[5-(2, 2-diaminoethyl)-2, 3-dihydroxyphenyl]-1H-indole-5, 6-diphenol, and a preparation method of the bio-based melanin precursor compound. The bio-based melanin precursor compound is stable in chemical property and easy to store. And the catalyst can be used as a raw material to efficiently synthesize bio-based melanin through a catalytic oxidation reaction. The process for preparing the bio-based melanin is simple, mild, high in yield and suitable for large-scale industrial production. The bio-based melanin prepared by the invention has good application performance during dyeing, does not generate harmful substances, and is safe and environment-friendly.

Description

Technical Field

[0001] This invention relates to the field of bio-dyes technology, specifically to a bio-based melanin precursor compound, a bio-based melanin, its preparation method, and its applications. Background Technology

[0002] Melanin is a class of natural biomolecules widely found in the biological world, including human skin, hair, eyes, bird feathers, insect epidermis, and microorganisms. Its complex structure typically consists of amorphous polymers composed of structural units such as indole and polyphenols. Melanin not only determines the color of organisms but also possesses a variety of remarkable biological functions and physicochemical properties, including: photoprotection: highly efficient absorption of ultraviolet (UV) radiation, scavenging of free radicals, and prevention of radiation damage; antioxidant properties: strong metal ion chelating ability and free radical scavenging ability; electrical conductivity and semiconductor properties: some forms of melanin (such as eumelanin) exhibit good biocompatible electrical conductivity; and adsorption properties: good adsorption of heavy metal ions and organic pollutants. Based on these unique properties, melanin shows great application potential in cosmetics (sunscreen, skincare products), biomedicine (drug delivery, imaging agents, antioxidants), materials science (conductive materials, biosensors), and environmental remediation (adsorbents).

[0003] Currently, traditional methods for obtaining melanin mainly include natural extraction and chemical synthesis. However, these methods have significant limitations, restricting the large-scale production and high-end applications of melanin. Chinese invention patent CN113559017 A discloses a hair dye based on the copolymerization of 5,6-dihydroxyindole and 6-hydroxyindole. However, 6-hydroxyindole lacks a catechol structure and cannot undergo phenol-quinone isomerization, making it difficult to form a dark-colored deposit. While 5,6-dihydroxyindole can effectively deposit on the hair surface, as a melanin precursor, it is chemically reactive and easily oxidized. The raw material needs to be stored under nitrogen-filled conditions at -20°C, making it unsuitable for large-scale production and storage, resulting in a very short product shelf life. Furthermore, most traditional black dyes are amines, primarily azo dyes and sulfur dyes. Some azo and sulfur dyes may release carcinogenic aromatic amines, such as p-phenylenediamine, during human metabolism. These chemical components have significant limitations, potentially causing allergic reactions, irritation, and even being associated with an increased risk of cancer.

[0004] In contrast, bio-based melanin has garnered attention due to its natural, non-toxic, and environmentally friendly properties. The application of natural melanin as a dye, particularly in hair dyeing and coloring, demonstrates enormous potential. Natural melanin possesses significant antioxidant capabilities, scavenging free radicals, delaying cell aging, and reducing the damage of oxidative stress to the body.

[0005] Therefore, there is an urgent need to achieve healthier, more environmentally friendly, and sustainable dyeing solutions by combining synthesis, biotechnology, and natural dyes. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a bio-based melanin precursor compound, a bio-based melanin, a preparation method thereon, and its application.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a bio-based melanin precursor compound, said compound being 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diol, with the molecular formula C1. 16 H 17 O4N3, its chemical structure is shown in Formula I: Formula I.

[0008] Secondly, the present invention provides a bio-based melanin, the chemical structural formula of which is shown in Formula II: Formula II.

[0009] Thirdly, the present invention provides an Escherichia coli that produces the bio-based melanin precursor compound, wherein expression plasmids of carboxylic acid reductase SrCAR and ω-transaminase ATA-W12 are introduced into engineered Escherichia coli strain HG-MEL05-1 to obtain an Escherichia coli that produces the bio-based melanin precursor compound. The engineered E. coli strain HG-MEL05-1 uses E. coli HG-MEL05 as the chassis strain. Key enzyme gene sites of the three branching metabolic pathways feaB, pheA, and tyrR in the E. coli genome are knocked out. At the same time, the tyrosinase encoding gene melA is integrated and inserted into the gene site, increasing the copy number of the melA gene while blocking the flow of the branching metabolic pathway. Molecular chaperone protein expression plasmids expressing dnaK, dnaJ, and grpE are introduced.

[0010] As a preferred embodiment of the Escherichia coli described in this invention, the nucleotide sequence of the carboxylic acid reductase SrCAR is shown in SEQ ID NO: 1; and the nucleotide sequence of the ω-transaminase ATA-W12 is shown in SEQ ID NO: 2.

[0011] Preferably, the carboxylic acid reductase SrCAR is derived from Segniidae bacteria, and the ω-transaminase ATA-W12 is derived from cotton field soil metagenomics.

[0012] Fourthly, the present invention provides a method for preparing the bio-based melanin precursor compound, wherein the *E. coli* that produces the bio-based melanin precursor compound is fermented and cultured; the supernatant is collected, purified by column chromatography, eluted with gradient, and dried to obtain the bio-based melanin precursor compound, namely 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diol.

[0013] Fifthly, the present invention provides a method for preparing the bio-based melanin, wherein the bio-based melanin precursor compound is synthesized by catalytic oxidation.

[0014] The reaction synthesis pathway is as follows: .

[0015] In a preferred embodiment of the preparation method described in this invention, the catalytic oxidation includes an oxidation catalyst and an oxygen-containing environment.

[0016] As a further preferred embodiment of the preparation method described in this invention, the oxidation catalyst is at least one selected from cobalt acetate, zinc acetate, and iron acetate.

[0017] Preferably, the oxidation catalyst is cobalt acetate and / or iron acetate.

[0018] As a further preferred embodiment of the preparation method described in this invention, the oxygen-containing environment is at least one of air, oxygen, a mixture of oxygen and other gases, water, and hydrogen peroxide; the other gases are at least one of nitrogen, carbon dioxide, and argon.

[0019] As a preferred embodiment of the preparation method described in this invention, the reaction is carried out under neutral or alkaline conditions (pH < 13).

[0020] As a further preferred embodiment of the preparation method described in this invention, the alkaline conditions are adjusted using an alkaline compound; the alkaline compound is at least one selected from potassium carbonate, sodium carbonate, sodium hydroxide, potassium hydroxide, and sodium bicarbonate.

[0021] In a preferred embodiment of the preparation method described in this invention, the reaction temperature is 20℃-60℃.

[0022] Preferably, the reaction temperature is any one or a combination of 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, and 60°C.

[0023] In a preferred embodiment of the preparation method described in this invention, the reaction is carried out in an organic solvent or an aqueous phase.

[0024] Preferably, the organic solvent is DMF and / or DMSO.

[0025] In a preferred embodiment of the preparation method described in this invention, the reaction product is purified by precipitation, centrifugation, filtration, pressure filtration, and concentration.

[0026] In a sixth aspect, the present invention applies the bio-based melanin precursor compound, the Escherichia coli that produces the bio-based melanin precursor compound, and the bio-based melanin precursor compound obtained by the preparation method to the preparation of bio-based melanin.

[0027] In a seventh aspect, the present invention applies the bio-based melanin and the bio-based melanin obtained by the preparation method in dyes.

[0028] In a preferred embodiment of the application described in this invention, the dye is a fabric dye.

[0029] As a further preferred embodiment of the application described in this invention, the fabric includes at least one of cotton, linen, wool, mulberry silk, regenerated fiber, and chemical fiber.

[0030] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. This invention is the first to prepare and discover the bio-based melanin precursor compound 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol.

[0031] 2. The bio-based melanin precursor compound 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol of the present invention is chemically stable and easy to store. Furthermore, it can be used as a raw material for the efficient synthesis of bio-based melanin.

[0032] 3. This invention uses the bio-based melanin precursor compound 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diol to prepare bio-based melanin. The process is simple, mild, highly controllable, has a large throughput, high yield, and is easy to operate, making it suitable for large-scale industrial production.

[0033] 4. The bio-based melanin prepared by this invention has good performance in dyeing, does not produce harmful substances, and is safe and environmentally friendly. Attached Figure Description

[0034] Figure 1 The biosynthetic metabolic pathway of 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diol is shown.

[0035] Figure 2The image shows the high-performance liquid chromatography (HPLC) spectrum of the fermentation broth of 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol. In the image, A is the HPLC spectrum of the fermentation broth; B is the UV absorption spectrum of melanin; and C is the UV absorption spectrum of 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol.

[0036] Figure 3 The figure shows the high performance liquid chromatography (HPLC) spectrum of pure 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol; in the figure, A is the HPLC spectrum of the pure product; B is the UV absorption spectrum of pure 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol.

[0037] Figure 4 Cationic mass spectrometry of pure 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol.

[0038] Figure 5 Anion mass spectrometry of pure 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol.

[0039] Figure 6 The 1H NMR spectrum of pure 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol.

[0040] Figure 7 The carbon NMR spectrum of pure 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol.

[0041] Figure 8 HSQC NMR of pure 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol.

[0042] Figure 9 HMBC NMR of pure 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol.

[0043] Figure 10 The image shows the appearance of the 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol sample during a stability test.

[0044] Figure 11 This is the UV absorption spectrum of the oxidized substance.

[0045] Figure 12The UV absorption spectrum of a standard sample of eumelanin.

[0046] Figure 13 This is the infrared absorption spectrum of the oxidized substance.

[0047] Figure 14 This is the UV spectrum of bio-based melanin.

[0048] Figure 15 The IR spectrum of bio-based melanin.

[0049] Figure 16 This is a staining diagram of bio-based melanin. Detailed Implementation

[0050] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below with reference to specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0051] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0052] The culture medium components involved in the examples are as follows: LB (Luria-Bertani) liquid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, sterilized at 121℃ for 20 min.

[0053] LB (Luria-Bertani) solid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 15 g / L agar powder. Sterilize at 121°C for 20 min. Cool the solid medium to about 50°C, add the required antibiotics, pour the plate, and let it solidify. Then, place it at 4°C for later use.

[0054] ZYM fermentation medium: 96mL ZY medium + 2mL 50×M salts + 2mL 50×5052 + 200μL 1mol / L magnesium sulfate + 100μL trace elements, 20g / L glucose.

[0055] ZY medium: 10 g / L peptone, 5 g / L yeast extract, sterilized at 121℃ for 20 min before use.

[0056] 50×M salts: 1.25 mol / L Na2HPO4, 1.25 mol / L KH2PO4, 2.5 mol / L NH4Cl and 0.25 mol / L Na2SO4; 50×5052: 250 g / L glycerol, 25 g / L glucose; 1 mol / L MgSO4; Trace elements: 50 mmol / L FeCl3, 20 mmol / L CaCl2, 10 mmol / L MnCl2, 10 mmol / L ZnSO4, and 2 mmol / L each of CoCl2, NiCl2, Na2Mo4, Na2SeO3 and H3BO3.

[0057] The PCR reaction system and amplification conditions involved in the examples are as follows: PCR reaction system: 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 10-50 ng of template DNA, 25 μL of 2×Primer Star Mix, and ddH2O added to 50 μL; Amplification conditions: 98℃ for 5 min; 30 cycles (98℃ for 10 s, 50℃ for 10 s, 72℃ for 30 s), followed by extension at 72℃ for 10 min.

[0058] The gene sequence encoding carboxylic acid reductase SrCAR in the example (SEQ ID NO: 1) is: atgactcagtcgcacactca aggtccgcaa gcgtctgcgg cgcacagccg tctcgcccgt cgcgcggcgg agcttctcgcgacggacccg caggccgccg cgaccctccc cgacccggag gtcgtgcggc aggcgacgcg tccagggctgcggctcgcgg agcgggtcga cgcgatcctc agcggctacg ccgaccgccc ggctctcggg cagcgctcttttcagaccgt caaagatccc atcaccggac gctcctcggt cgagttgctc cccacgttcg acaccatcacctaccgcgagctgcgagagc gcgccacagc gatcgcaagc gacctggcgc atcacccgca ggccccggccaagcccggag atttcctcgc gagcatcggc ttcatcagcg tcgattacgt cgccatcgacatcgccggggtcttcgccgg gctcaccgcc gtcccgctcc agaccggcgc gacactcgcg acgttgacgg cgatcaccgcagagaccgcg ccaaccctgt tcgcggcgag catcgagcac ctgccgaccg ccgtggacgc cgttctcgccacgccctcag tgcgccggtt gctcgtcttcgactaccgcg ccgggtcgga cgaggaccgc gaggcggtcgaggcggccaa gcggaaaatc gccgacgcgg gcagctcggt gctcgtggac gttttggacg aggtgatcgcacgcgggaaa tcggcgccga aggcgccgct gccccccgcc accgacgcgg gcgacgactc gctgtccttgctcatctaca cctccggctc caccgggacg cccaaggggg cgatgtaccc ggagcgcaac gtcgcgcacttctggggcgg cgtctgggcc gccgcgttcg acgaggacgccgccccgccc gtcccagcga tcaacatcacgttcctgccg ctcagccacg tcgccagcag actttcgctc atgccgaccc tcgcccgggg cggcctcatgcacttcgtcg cgaagagcga cctgtccacc ctcttcgagg acttgaaact cgctcgtccg acgaacctgttcctggtgcc cagagtggtc gagatgctgt accagcacta ccagagcgaa ttagaccgca ggggagtgcaggacggcacc cgcgaagccg aagcggtgaa ggacgacctg cgcacggggc tcctcggcgg ccggatcctcactgcgggct tcggctcggc gccgctgtcc gccgagctgg ctggcttcat cgaatccctgctgcagatccacctggtgga cggctacggg tccaccgagg cggggccggt gtggcgcgac ggctacctcg tcaaaccgccggtgaccgac tacaagctca tcgacgtgcc cgagctcggg tacttctcca ccgactcccc gcatccccggggcgagctgg ccatcaagac gcagaccatc ctccccggct attacaagcg ccccgagacg accgcggaagtcttcgacga ggacggcttc tacctcaccg gggacgtggt cgcgcagatc gggccggaac agttcgcgtacgtcgaccgg cgcaagaacg tcctcaagct ctcccagggc gagttcgtga ccctcgcgaa gctcgaggccgcgtacagct ccagcccgct ggtgcgacag ctcttcgtct acggctccag cgaacgctcg tacttgctcgccgtgatcgt gcccaccccg gacgccctga agaagttcgg cgtcggcgag gcggcgaaag ccgcgctcggggagtctctg cagaagatcg ctcgcgacga gggcctgcaa tcctacgaggtgccgcgcga cttcatcatcgaaacggatc cgttcacggt cgagaacggc ctgctctccg acgcccgcaa gtcgttgcgc ccgaagctcaaggagcatta cggcgaacgg ctcgaagcga tgtacaaaga gctcgcggac ggtcaggcga acgagctgcgcgacatccgc agaggcgtgc aacaacgcccg gacgctcgaa accgtgcggc gcgccgcggc cgcgatgctgggcggagcg ccgcggaaat caagccggac gcccatttca ccgacctcgg cgggactcg ctctccgcgctgacgttctc gaacttcctg cacgacctct tcgaagtcga tgtgcccgtc ggggtgatcg tgagcgccgcgaacacattg ggctccgtgg ccgagcacat cgacgcgcag ctgggg gccgtgcccg gccgacgttcgcgaccgtgc acggcaaagg ctccaccacg atcaaggcca gcgatctgac cttggacaag ttcatcgacgagcagaccct cgaggccgc aagcacttgc ccaagcccgc cgacccgccg cgcaccgtgc tgctcaccggcgcgaacggc tggctcggcc ggttcctcgc ccttgaatgg ctcgaaaggc tcgcccccgc cggcggcaagctcatcacga tcgtgcgcggc caaggacgcg gcacaggcaa aggctcggct cgacgccgc tacgagagcggcgacccgaa gctcgccggt cattaccagg atttggccgc gacgacgct gaagtgctcg cgggcgatttcagcgagccg cgtctcgggc tggacgaggc gacctggaac cggctggccg acgaggtgga cttcatctcgcaccccggcg ctctggtcaa ccatgtcctg ccgtacaacc agctgttcgg gccgaacgtggccggtgtggccgagatcat caagctcgcg atcaccacac ggatcaagcc cgtcacgtac ctgtccacag tcgccgtcgcggcgggcgtc gagccgtcgg ccttagacga ggacggcgac atccggacgg tgagcgctga gcgctcggtcgacgagggct acgccaacgg gtacgggaac agcaaatggg gcggcgaggt gctgctgcgc gaagcgcacgatcgcacggg actgccggtt cgggtgttcc gctcggacat gatcctcgcg catcagaaat acaccggacaagtgaacgcg accgaccagt tcacccggct cgtccagagc cttttggcaa ccgggctcgc accgaagtccttctacgagc tcgacgccca gggcaaccgg cagcgggccc actacgacgg gatacccgtg gacttcaccgccgagtcgat caccacgctc ggcggcgacg gtttggaagg ctaccgcagc tacaacgtgt tcaacccgcatcgcgacggc gtcggtttgg acgagttcgt cgactggctc atcgaagccg gacacccgat cacacggatcgacgactacg accagtggct ctcgcgcttc gagacctcgt tgcgcggcct gcccgaatcc aagcgccaagcctccgtgct cccgttgctg cacgccttcg cccggccagg gcccgccgtg gacggctcgc ctttccggaacacggtgttc cgcaccgacg tgcagaaggc gaagatcggc gcggaacacg acatccccca cctgggcaaagcgctcgtgc tcaagtacgc cgacgacatc aagcagctcg gtctgctctg a。

[0059] The gene sequence (SEQ ID NO: 2) encoding ω-transaminase ATA-W12 in the embodiment is as follows: atgaccgcccccctccgcaa ccacgacatc gccgagctca agcgcctgga cctggcccac cacctgccgg cccaggccgatcacaaggtc atcgccgagc agggcggaag ccggatcatc acccgcgccg agggcgtcta catccatgacggcgagggcc atcagatcct cgacggcatg gccgggctgt ggtgcgtgaa cgtcggctac ggtcgcgaggaactggccaa ggccgcctac gaccagatgc tggagctgcc ctactacaat acgttcttca agaccgcgacgccgccgccg atcgagctgg cggccaagat cgcgcagaag atgggcgggc atctttccca cgtcttctacaattcgtcgg ggtcggaggc gaacgacacg gtcttccgcc tggtgcgcca cttttggaag ttgaagggggagccaagccg cacggtcttc atcagccgct ggaacgccta tcacggctcg acggtggcgg gcgtcagcctgggcggcatg aagcacatgc acaagcaggg cgacctgccg atcgccggcg tcgagcatgt gatgcagccctaccagttcg gcgacggctt cggcgaggat ccggccgcct tccgcgaccg ggcggtgcag gccatcgaggacaagatcct ggaagtcggg cccgagaacg tcgcggcctt catcggcgag ccggtgcagg gcgcgggcggggtgatcatc ccgccggacg gctattggcc ggcggtcgag gccctgtgcc gcaagtacgg catcctgctggtctgcgacg aggtgatctg cggctttggg cggctgggcc agtggttcgg ccaccagcac tatggcatcaagcccgacct gatcgccatg gccaagggcctgtcgtccgg ctatctgccg atcagcgccg tgggcgtggccgaccacatc gtcgccgagc tgcgcgagaa gggcggcgac ttcatccacg gctttacgta ctcgggccacccgacggcgg cggccgtggc gctgaagaac atcgagatca tggagcgcga gggcctggtc gagcgcacccgcgacgagac cggcccctat ctggcgcagg ccctggccag cctcaacgac cacccgctgg tgggtgaagttcgctcgctg ggcctgatcg gcgcggtcga gatcgtgcgc gagaagggga ccaaccaccg cttcctcgacaaggagggcg aggccgggcc gatcgtgcgc gacctgtgca tcaagaacgg cctgatggtt cgcgccatccgcgacagcat cgtctgctgc ccgccgctga tcatcaccaa ggcgcagatc gacgagctgg tcggcatcatccgaaagtcg ctcgacgaag ccgagccggt gctgcgggcg ctgaagccta aggagggcga ggactga.

[0060] The primer sequences involved in the examples are as follows: SrCARF: 5'CCGGAATTCATGACTCAGTCGCACACTCAAG 3'; SrCARR: 5'CCCAAGCTTTCAGAGCAGACCGAGCTGC 3'; ATA-W12F: 5'CCGGAATTCATGACCGCCCCCCTCCGCA 3'; ATA-W12R: 5'CCCAAGCTTTCAGTCCTCGCCCTCCTTA 3'.

[0061] The method for preparing competent E. coli cells in this embodiment is as follows: (1) Pick a single Escherichia coli DH5α colony from the plate and put it into 5 mL of LB liquid medium. Incubate overnight at 37°C and 220 rpm for 16 h. (2) Transfer 1 / 100 to 50 mL of liquid LB medium and continue culturing at 37°C and 220 rpm until OD. 600 =0.6-0.8; (3) Transfer to a 50mL centrifuge tube, incubate on ice for 15min, centrifuge at 4000rpm and 4℃ for 10min and discard the supernatant; (4) Add 5 mL of 0.1 M CaCl2 to resuspend the bacterial cells, place on ice for 30 min; centrifuge at 4000 rpm and 4℃ for 10 min and remove the supernatant; (5) Add 5 mL of 0.1 M CaCl2 glycerol solution to resuspend the bacterial cells to obtain competent Escherichia coli cells. Dispense 100 μL / part and use immediately or store at -80℃.

[0062] The transformation method for E. coli in the example is as follows: Take 10 μL of the recombinant product and add it to 100 μL of competent E. coli cells. Gently mix and incubate on ice for 30 min. Heat shock in a 42°C water bath for 60 s, then quickly transfer to ice and incubate for 2 min. Add 900 μL of LB medium and revive at 37°C and 220 rpm for 60 min. Centrifuge at 4500 rpm for 2 min, remove about 900 μL of supernatant, resuspend the cells in the remaining medium, and spread on plates with the corresponding antibiotics.

[0063] Example 1: Construction of engineered bacteria (1) Preparation of pCDFDuet-SrCAR plasmid The carboxylic acid reductase gene SrCAR was constructed by ligating the optional plasmid pCDFDuet-1 (Sm resistance). The binding site between the SrCAR gene and the pCDFDuet-1 (Sm resistance) plasmid is... EcoR I and Hind III.

[0064] Using *Segniella* as a template, the SrCAR amplified fragment of the carboxylic acid reductase gene was obtained by PCR amplification using primers SrCARF / SrCARR containing restriction enzyme sites. The SrCAR amplified fragment and plasmid pCDFDuet-1 (Sm resistant) were then separately... EcoR I and Hind After digestion with enzyme III, the cells were ligated; the ligation product was transfected into competent E. coli cells, plated on resistant plates, and cultured overnight; positive strains were verified by PCR; positive single colonies were picked, cultured overnight, and the recombinant plasmid pCDFDuet-SrCAR was extracted.

[0065] (2) Preparation of pET-42a-ata-w12 plasmid The recombinant plasmid containing the ω-transaminase gene ata-w12 was constructed by ligating the ω-transaminase gene ata-w12 with the optional plasmid pET-42a (Kan resistance). The binding site between the ω-transaminase gene ata-w12 and plasmid pET-42a is... EcoR I and Hind III.

[0066] Using soil metagenomics as a template, the ω-transaminase gene was obtained by PCR amplification using primers ata-w12F / ata-w12R containing restriction enzyme sites. ata-w12 Amplified fragment; ω-transaminase gene ata-w12 The amplified fragment and plasmid pET-42a (Kan resistant) were respectively used EcoR I and Hind After digestion with enzyme III, the cells were ligated; the ligation product was transfected into competent E. coli cells, plated on resistant plates, and cultured overnight; positive strains were verified by PCR; positive single colonies were picked, cultured overnight, and the recombinant plasmid pET-42a-ata-w12 was extracted.

[0067] (3) Preparation of engineered bacteria I The pCDFDuet-SrCAR and pET-42a-ata-w12 plasmids were transformed into engineered bacteria HG-MEL05-1 using electroporation. The target strain was obtained by colony PCR screening, and engineered bacteria I was named HG-1.

[0068] The engineered bacterium HG-MEL05-1 is the recombinant Escherichia coli HG-MEL05-1 disclosed in Chinese invention patent CN 118909899 A.

[0069] Example 2: Fermentation culture of engineered bacteria The recombinant Escherichia coli HG-1 obtained in Example 1 was inoculated into test tubes containing LB liquid medium with antibiotics and cultured with shaking. Then, 1% of the inoculation volume of the fermentation medium was transferred to an Erlenmeyer flask containing fermentation medium, and kanamycin was added to a final concentration of 50 μg / mL. The culture conditions were: temperature 35°C, rotation speed 200 rpm, time 8 h, until the OD of the bacterial culture was reached. 600 =3.5, to obtain the activated bacterial solution; 2.5 L of basal fermentation medium was prepared and placed in a 5 L fermenter for autoclaving. After sterilization, the basal fermentation medium was cooled to 25 °C, and its pH was adjusted to 7.0. IPTG was added to the fermenter to a final concentration of 0.2 mM / L. The resulting seed culture was transferred to the fermenter via flame inoculation and fermentation began. The fermentation temperature was maintained at approximately 25 °C throughout the process. The initial aeration ratio was 0.8 vvm, the initial rotation speed was 200 rpm, and the dissolved oxygen rotation speed was set to 35%. When the rotation speed reached 900 rpm, the dissolved oxygen rotation speed was decoupled, and the dissolved oxygen was maintained at 35% by increasing the aeration ratio (0.8-1.5 vvm). The pH was maintained at 7.0 throughout the fermentation process. The culture was discharged after 16 hours. The synthetic pathway of the product 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diol is shown in the figure below. Figure 1 As shown.

[0070] The high-performance liquid chromatography (HPLC) method for detecting the product is as follows: Chromatographic conditions: Mobile phase: gradient elution of methanol and pure water, as shown in Table 1. Table 1 Elution gradient Wavelength 600 nm, flow rate 1.0 mL / min, sample solution: DMSO, injection volume: 10 μL, column temperature 35℃, run time 20 min. Column: Galasil EF C18M 4.6 mmid × 250 mm L (SN B06211801).

[0071] 100 mL of fermentation broth was centrifuged to obtain the supernatant, which was then purified by ODS-C18 column chromatography using a gradient elution of pure water and 20% methanol. The fractions were collected, concentrated, and evaporated to dryness to obtain the pure product. The liquid phase diagram of the fermentation broth is shown below. Figure 2 As shown, the liquid chromatography diagram of the pure product is as follows: Figure 3 As shown.

[0072] The pure sample was sent for proton NMR, carbon NMR, LCMS, HMBC, and HSQC to determine its structure, such as... Figure 4-9 As shown.

[0073] 1H NMR (600 MHz, DMSO-d6) δ 7.09 (s, 1H), 6.91 (d, 1H), 6.88 (d, 1H), 6.63 (s, 1H), 6.43 (s, 1H), 3.98 (t, 1H), 2.96 (m, 2H).

[0074] 13C NMR (151 MHz, DMSO) δ 171.94, 164.77, 154.92, 149.64, 146.16, 145.91, 133.84, 125.31, 122.21, 117.26, 116.46, 115.92, 114.87, 111.76, 56.37, 30.07. The molecular weight was determined to be 315 based on cation mode PCR and anion mode PCR results of 316 and 314.

[0075] Analysis confirmed that the fermentation product was 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diol, with the molecular formula C2. 16 H 17 O4N3, its chemical structure is shown in Formula I: ——Formula I; The yield of 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diol in the lower tank was 1.42 g / L.

[0076] Example 3: Determination of the oxidative stability of 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diol Take about 0.1g of 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diol sample, place it in a glass bottle and leave it in an open room, and record the changes in appearance.

[0077] like Figure 10 As shown, the initial sample of 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol was yellow when placed in an open chamber. It remained yellow for 7 days, turned yellowish-black after 14 days, and turned completely black after 28 days.

[0078] UV spectrum of the oxidized substance as follows Figure 11 As shown, the UV spectrum of the melanin standard is as follows: Figure 12 As shown.

[0079] Infrared spectra of oxidized substances, such as Figure 13 As shown, the infrared spectrum in the 3400-3200 cm⁻¹ range... -1 The presence of absorption peaks indicates that the pigment contains OH and NH structures attached to a benzene ring; the absorption peaks are located at 1631.25-1402.74 cm⁻¹. -1 The absorption peaks indicate that the pigment contains a large number of benzene ring structures; 1252 cm⁻¹ -1 2919.91 cm -1The absorption peaks at these two locations are due to the asymmetric stretching vibration of CH2; 1003.43 cm⁻¹ -1 The absorption peaks that appear are the CO structures of phenols or carboxyl groups.

[0080] UV and infrared spectra of the black substance after 28 days of storage, compared with those of melanin standards (or eumelanin, as previously reported). Figure 1 To.

[0081] Example 4: Preparation of Bio-based Melanin The preparation route for this bio-based melanin is as follows: Condition A is a catalytic oxidation system; the catalytic oxidation system includes an oxidation catalyst and an oxygen-containing environment; the oxygen-containing environment includes one of air, oxygen, a mixture of oxygen and other gases, water, and hydrogen peroxide; the other gases in the mixture of oxygen and other gases include one of nitrogen and carbon dioxide. The oxidation catalyst includes one of cobalt acetate, zinc acetate, and iron acetate; the oxidation catalyst is selected from cobalt acetate or iron acetate. In this reaction route, the reaction process can be carried out at neutral and alkaline pH < 13; the alkaline pH of the reaction process can be adjusted using one or more of potassium carbonate, sodium carbonate, sodium hydroxide, potassium hydroxide, and sodium bicarbonate. The reaction temperature is between 20℃ and 60℃; preferably, the reaction temperature is between 25℃ and 50℃. The reaction can be carried out in an organic solvent or in an aqueous phase; the organic solvent is selected from DMF and DMSO.

[0082] Example 5: Preparation of Bio-based Melanin 31.5 g of the pure 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol from Example 2 was weighed and added to a 500 mL three-necked round-bottom flask. 200 mL of water was added, and the pH was adjusted to 11 with 20% sodium hydroxide solution. The flask was left open to air and stirred at 50°C for 2 hours. After filtration to remove water, the filter cake was washed with 200 mL of deionized water. The solid was dried to obtain 23.7 g of the target product, bio-based melanin, with a yield of 81.4%.

[0083] The structure of the target product, bio-based melanin, was determined by the Analysis and Testing Center of Nanjing Normal University.

[0084] The UV spectrum of the target product, bio-based melanin, is as follows: Figure 14 As shown, the IR spectrum of bio-based melanin is as follows: Figure 15 As shown.

[0085] Example 6: Preparation of Bio-based Melanin 31.5 g of the pure 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol from Example 2 was weighed and added to a 500 mL three-necked round-bottom flask. 200 mL of DMF was added, and the pH was adjusted to 12 with 20% potassium hydroxide solution. 1 g of cobalt acetate was added, and the reaction mixture was bubbled with an air bag. After stirring at 60°C for 1 h, the mixture was filtered to remove water, and the filter cake was washed with 200 mL of deionized water. The solid was dried to obtain 26.84 g of the target product, bio-based melanin, with a yield of 92.2%.

[0086] Example 7: Preparation of Bio-based Melanin 31.5 g of the pure 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol from Example 2 was weighed and added to a 500 mL three-necked round-bottom flask. 200 mL of water was added, and the pH was adjusted to 10 with 20% sodium carbonate solution. 1 g of ferric acetate was added, and the reaction mixture was bubbled with an air bag. After stirring at 40°C for 1 h, the mixture was filtered to remove water, and the filter cake was washed with 200 mL of deionized water. The solid was dried to obtain 22.36 g of the target product, bio-based melanin, with a yield of 76.8%.

[0087] Example 8: Preparation of Bio-based Melanin 31.5 g of the pure 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol from Example 2 was weighed and added to a 500 mL three-necked round-bottom flask. 200 mL of water was added, and the pH was adjusted to 9 with 20% sodium bicarbonate solution. The flask was left uncovered and exposed to air. After stirring at 25°C for 2 hours, the mixture was filtered to remove water. The filter cake was washed with 200 mL of deionized water. The solid was dried to obtain 20.73 g of the target product, bio-based melanin, with a yield of 71.2%.

[0088] Example 9: Preparation of Bio-based Melanin 31.5 g of the pure 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol from Example 2 was weighed and added to a 500 mL three-necked round-bottom flask. 200 mL of DMSO was added, and air was bubbled into the reaction mixture under neutral conditions. After stirring at 20°C for 2 h, 500 mL of water was added, causing a solid to precipitate. The solid was filtered, and the water was removed. The filter cake was washed with 200 mL of deionized water. The solid was dried to obtain 19.71 g of the target product, bio-based melanin, with a yield of 67.7%.

[0089] Example 10: Preparation of Bio-based Melanin 31.5 g of the pure 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diphenol from Example 2 was weighed and added to a 500 mL three-necked round-bottom flask. 200 mL of hydrogen peroxide was added, and the pH was adjusted to 11 with 20% sodium hydroxide solution. The flask was left uncovered and exposed to air. After stirring at 50°C for 2 hours, the mixture was filtered to remove water. The filter cake was washed with 200 mL of deionized water. The solid was dried to obtain 24.37 g of the target product, bio-based melanin, with a yield of 83.7%.

[0090] Example 11: Staining of bio-based melanin The bio-based melanin synthesized in Example 5 was used to dye cotton fabric. The dyeing process was based on the instructions in "Dyeing and Finishing Technology (Dyeing Volume)" (Shen Zhiping, China Textile Press). The bio-based melanin was dispersed in an alkaline solution for dyeing, fixing, and drying. The dyeing effect of the melanin was tested, and the dyed cotton fabric exhibited the following properties: Figure 16 As shown.

[0091] Comparative Example 1: The pH in Example 5 was adjusted to 6, while other conditions remained unchanged, to obtain 9.11g of the target product, bio-based melanin, with a yield of 31.3%.

[0092] Comparative Example 2: In Example 5, the air was replaced with pure nitrogen, and other conditions remained unchanged. No obvious black solid was produced.

[0093] Comparative Example 3: In Example 5, air was replaced with carbon dioxide, while other conditions remained unchanged, and no obvious black solid was produced.

[0094] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A bio-based melanin precursor compound, characterized in that, The compound is 4-[5-(2,2-diaminoethyl)-2,3-dihydroxyphenyl]-1H-indole-5,6-diol, which has a molecular formula of C 16 H 17 O4N3, and has a chemical structure as shown in formula I: Formula I.

2. A biobased melanin, characterized in that, The chemical structure is shown as formula II: Formula II.

3. An E. coli producing the bio-based melanin precursor compound according to claim 1, characterized in that, The expression plasmids of carboxylate reductase SrCAR and ω-transaminase ATA-W12 are introduced into the E. coli engineering bacteria HG-MEL05-1 to obtain the E. coli producing the biological-based melanin precursor compound; The E. coli engineering bacteria HG-MEL05-1 is an engineering bacteria constructed by integrating the tyrosinase encoding gene melA into the genome of E. coli HG-MEL05 at three sites of feaB, pheA and tyrR, and introducing the expression plasmid of molecular chaperone proteins expressing dnaK, dnaJ and grpE; The nucleotide sequence of the carboxylate reductase SrCAR is shown as SEQ ID NO: 1; and the nucleotide sequence of the ω-transaminase ATA-W12 is shown as SEQ ID NO:

2.

4. A method of preparing the bio-based melanin precursor compound of claim 1, characterized by, The E. coli of claim 3 is fermented and cultured; the supernatant is collected, purified by column chromatography, eluted by gradient, dried to obtain the biological-based melanin precursor compound.

5. A method of preparing the bio-based melanin according to claim 2, characterized by, The biological-based melanin is synthesized by catalytic oxidation of the biological-based melanin precursor compound of claim 1.

6. The production method according to claim 5, wherein The catalytic oxidation comprises an oxidation catalyst and an oxygen-containing environment; And / or, the oxidation catalyst is at least one of cobalt acetate, zinc acetate and iron acetate; And / or, the oxygen-containing environment is at least one of air, oxygen, a mixed gas of oxygen and other gas, water and hydrogen peroxide; the other gas is at least one of nitrogen, carbon dioxide and argon.

7. The preparation method according to claim 5, characterized in that, The reaction is carried out under neutral or alkaline conditions; And / or, the alkaline conditions are adjusted by using an alkaline compound; the alkaline compound is at least one of potassium carbonate, sodium carbonate, sodium hydroxide, potassium hydroxide and sodium bicarbonate And / or, the temperature of the reaction is 20-60℃.

8. Use of the biological-based melanin precursor compound of claim 1, the E. coli of claim 3 and the biological-based melanin precursor compound prepared by the preparation method of claim 4 in preparing a biological-based melanin.

9. Use of the biological-based melanin of claim 2 and the biological-based melanin prepared by the preparation method of any one of claims 5-7 in dyes.

10. Use according to claim 9, characterized in that, The dye is a fabric dye; and the fabric comprises at least one of cotton, hemp, wool, mulberry silk, regenerated fiber and chemical fiber.

Images