Preparation method for constructing fish homozygous mutant based on gynogenesis gene editing

Abstract

The invention belongs to the technical field of fish genetic breeding and genetic engineering, and particularly relates to a rapid preparation method of a gene editing fish homozygous mutant based on a gynogenesis technology. According to the method, F0 or F1 generation female marine fishes such as paralichthys olivaceus obtained through gene editing operation serve as female parents, mature ova of the female marine fishes are collected, and the ova are activated through sperms subjected to genetic material inactivation treatment; then, chromosome doubling is induced in a cleavage inhibition mode, and the mitotic gynogenesis diploid is obtained. And further screening the filial generation obtained by the steps to obtain the mutant with homozygous genotype. The method is simple and convenient to operate, the period of obtaining the homozygous mutant can be remarkably shortened, the breeding efficiency is improved, and the method has a good application prospect.

Description

Technical Field

[0001] This invention belongs to the field of fish genetics and breeding and genetic engineering technology, specifically relating to a method for preparing homozygous mutants of fish based on gynogenetic gene editing. Background Technology

[0002] Genome editing technology is a new technique in modern biobreeding. It uses specific nucleases to modify target genes at specific sites, thereby altering or inactivating gene function to achieve desired traits. Compared to traditional breeding techniques, it offers advantages such as shorter trait selection cycles and targeting of specific genes. This technology has evolved through three generations: zinc finger nucleases (ZFNs) in 1996, transcription activator-like effector nucleases (TALENs) in 2010, and the CRISPR / Cas9 system in 2012. The CRISPR / Cas9 system, relying on the mechanism of sgRNA-guided Cas9 protein cleaving DNA, is simple to operate, highly efficient, and low-cost. It has rapidly become a core tool for functional gene analysis and new variety creation in model fish and freshwater economic fish, and has been successfully applied in important breeding practices to obtain fish with no intermuscular spines and rapid growth.

[0003] Stable edits with specific traits originate from homozygotes. Obtaining homozygous edits requires acquiring male and female individuals with the same mutation, followed by crossbreeding to obtain homozygous edits. Therefore, the conventional process for obtaining homozygous edits involves first obtaining the F0 generation of edits carrying the mutation. The F0 generation is then crossed with the wild type to obtain the F1 generation. Male and female individuals from the F1 generation with the same mutation type are then crossed to obtain the homozygous F2 generation, theoretically accounting for 25%. However, due to the long reproductive cycles of some organisms, especially marine fish (females reach sexual maturity in 3-5 years, such as turbot with a minimum reproductive cycle of 3 years), obtaining homozygous individuals through conventional crossbreeding methods requires at least two generations, or more than 6 years. Sometimes, the obtained F1 generation may consist of only females. In such cases, the F1 generation needs to be crossed with the wild type again to obtain the F2 generation, and then male and female individuals with the same mutation type are crossed to obtain the homozygous F3 generation. In addition, the need to maintain a large population for each generation to cope with the genetic uncertainty of F0 generation chimeras leads to a significant increase in breeding space, feed and labor costs.

[0004] In fish genetic breeding, the key to shortening the breeding cycle and stabilizing desirable traits is the rapid acquisition of homozygous mutants. Gynogenesis technology is one of the effective methods to shorten the cycle of obtaining homozygous mutants. Existing strategies aim to obtain homozygous mutants in a one-step process: first, obtain unfertilized eggs, perform sham fertilization, and then inject or directly inject gene editing. Subsequently, use genetically inactivated sperm to activate the eggs and induce gynogenesis, hoping to directly obtain homozygous mutants in the F0 generation. However, the oocytes in the above process are not yet fully mature, microinjection can easily damage the embryo, resulting in low embryo survival rates. Furthermore, during the development of diploid embryos obtained through gynogenesis, the injected gene-editing mixture remains and can still perform cleavage, and the target gene can still be cleaved. Consequently, the genes in the resulting individuals will be predominantly chimeric, making it difficult to obtain stable and high-proportion homozygous mutants.

[0005] Therefore, there is an urgent need in this field for a new technical solution that can overcome the high mortality and high chimerism rates of existing one-step methods and injection of unfertilized eggs / pseudo-fertilization, and substantially shorten the cycle for obtaining homozygotes. Summary of the Invention

[0006] This invention provides a method for preparing homozygous mutants of fish based on gynogenetic gene editing.

[0007] To achieve the above objectives, the technical solution provided by the invention is as follows: A method for preparing homozygous mutants of fish based on gynogenetic gene editing. (a) Obtain F0 or F1 generation female turbot that have undergone gene editing, and collect oocytes after maturation. (b) The eggs of the F0 or F1 generation turbot mentioned above are fertilized with sperm whose genetic material has been deactivated; (c) The fertilized eggs described in step (b) are treated by physical means to inhibit cleavage and induce the development of mitotic gynogenetic diploids; (d) A homozygous mutant can be obtained from the diploid fish fry that undergo mitotic gynogenesis obtained in step (c); The homozygous mutant is able to appear stably in the offspring.

[0008] The F0 or F1 generation refers to female fish carrying gene mutations obtained by using the CRISPR / Cas9 system to target and edit specific functional genes.

[0009] The female marine fish of the F0 or F1 generation, such as turbot, in step (a) must meet the following conditions: (1) the mutation of the target gene in its gonads is confirmed by genotyping and can produce eggs containing the target gene mutation. (2) The proportion of eggs produced containing the target mutant gene is ≥10%.

[0010] In step a), the F0 generation consists of female turbot with the sox9a gene (SRY-box containing gene 9a) knocked out, and the F1 generation consists of female turbot with the gsdf gene (Gonadal Soma-Derived Factor) knocked out.

[0011] Eggs from F0 or F1 generation turbot containing the target gene mutation are fertilized with sperm whose genetic material is inactivated to obtain gynogenic haploids. Chromosome duplication is achieved by inhibiting egg cleavage to obtain mitotic gynogenic diploids.

[0012] The method for inhibiting egg cleavage is to treat the gynogenetic haploid with a hydrostatic pressure of 65 MPa for 6 minutes 10 minutes before egg cleavage, followed by incubation in seawater at 14-16°C until hatching, i.e., gynogenetic diploid.

[0013] To go further, (1) Obtain female turbot of generation F0 or F1 after gene editing, and collect eggs after ripening. (2) Perform mutation analysis on the oocytes to ensure that the proportion of oocytes containing the target mutated gene is ≥10%; (3) Collect sperm from wild-type turbot and inactivate the genetic material by ultraviolet irradiation.

[0014] (4) Fertilize the eggs selected in step (2) with sperm whose genetic material has been inactivated, and the gynogenetic cells develop into haploids; (5) The fertilized egg described in step (4) is treated by physical induction to achieve mitotic gynogenesis with chromosome doubling; (6) Continue to cultivate the embryos obtained in step (5); (7) Select homozygous mutants from the larvae obtained in step (6).

[0015] A method for obtaining gynogenetic gene editing to construct homozygous mutants of fish, and obtaining homozygous mutants of fish according to the method.

[0016] Compared with the prior art, the beneficial effects of the present invention are: (1) This invention is the first to perform gynogenesis in gene-edited flounder, allowing homozygous mutants to be obtained through one generation of breeding. Specifically, F0 / F1 generation homozygotes are obtained through gynogenesis. The conventional method is to cross F0 generation with wild type to produce heterozygous F1 generation, and then self-pollinate F1 generation to produce homozygous F2 generation. Sometimes, F1 generation only has females, so it is necessary to self-pollinate after obtaining F2 generation to produce homozygous F3 generation. This method can also be used to prepare gene-edited homozygotes in various marine fish species, including but not limited to turbot, flounder, red sea bream, and sea bass.

[0017] (2) The method for preparing homozygous mutants provided by the present invention shortens the time by at least one generation compared with the traditional hybridization method, and by 24 to 36 months in flatfish.

[0018] (3) The method for preparing homozygous mutants provided by the present invention is also applicable to other spawning marine aquatic organisms. Attached Figure Description

[0019] Figure 1 Sanger sequencing peaks of PCR products from microinjected fertilized egg mixtures; where a' is the genome sequencing map of wild-type sox9a sample; and a' is the genome sequencing map of post-injection sox9a sample. Figure 2 For F0 generation, the carrier sox9a Sequencing peak diagrams of mutant oocytes, where a' is the sequencing map of F0 oocytes and a' is the sequencing map of control fertilized oocytes. Figure 3 Photos of newly hatched larvae in gynogenetic diploid, normal diploid, and haploid forms; where 2n: diploid; n: haploid; G2n gynogenetic diploid. Figure 4 for sox9a Comparison of homozygous mutant and wild-type sequences; where WT represents the wild-type; 8 represents the 8th gynogenetic newborn larva. Note: Red text indicates gRNA sites. Figure 5 For carrying gsdf Mutation type of the F1 female fish; Note: Red text indicates gRNA sites.

[0020] Figure 6 Photos of newly hatched larvae in gynogenetic diploid, normal diploid, and haploid forms; where 2n: diploid; n: haploid; G2n gynogenetic diploid. Figure 7 for gsdf Comparison of homozygous mutant sequences with wild-type sequences; where WT represents the wild-type; #5 and 8 represent gynogenetic newly hatched larvae. Note: Red text indicates gRNA sites. Detailed Implementation

[0021] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it. Furthermore, it should be noted that, for ease of description, the accompanying drawings show only the parts relevant to the present invention and not all experimental results.

[0022] This invention uses F0 or F1 generation female marine fish, such as turbot, obtained through gene editing, as the maternal parent. Mature eggs are collected, and the eggs are activated using sperm treated with genetically inactivated sperm. Subsequently, chromosome doubling is induced by inhibiting cleavage, resulting in mitotic gynogenetic diploids. Further cultivation of the offspring obtained through these steps yields homozygous mutants. This method is simple to operate, significantly shortens the cycle for obtaining homozygous mutants, improves breeding efficiency, and has promising application prospects.

[0023] Example 1. This example provides a method for preparing homozygous F1 generation flounder based on gene-edited F0 generation female turbot, including the following steps: 1. Screening of F0 generation female turbot with targeted knockout of the sox9a gene S1. Target Screening The design principles and synthesis methods for Cas9 target sites are as follows: The Cas9 target site contains 20 bases, with the 5' end being GG or GN (Note: the choice of GG at the 5' end is not a requirement of the Cas9 target site itself, but rather that the in vitro transcription vector used for gRNA (guide RNA) employs the T7 promoter, which requires the first two bases of the transcription start site to be GG or GN (N can be any base)); the three bases immediately adjacent to the 3' end of the target site constitute the PAM region, which is required to have the sequence NGG (N can be any base).

[0024] Target sites should ideally be located within the first two-thirds of the CDS region of a gene coding region and / or within important structural domains, and after the ATG, but not in the last exon; avoid sequences containing SNPs; and ideally, disrupt important structural domains and / or all transcripts. Also, consider avoiding the presence of additional start codons with the same in-frame downstream of the first start codon. The 5'-UTR and 3'-UTR should generally be avoided.

[0025] The selected exon-containing sequences (400-800bp) were amplified by PCR to verify the reliability of the sequences and the location of SNPs, and designed using (http: / / zifit.partners.org / ZiFiT / or (http: / / www.e-crisp.org / E-CRISP / index.htmL).

[0026] The designed target sequence was blasted on the NCBI website to determine the uniqueness of the target in the turbot genome.

[0027] After screening, four target knockout sites for the sox9a gene were identified. gRNA sequences were designed targeting these knockout sites, namely GGTGTTCTCGGTGTCCGAGC. CGG GGAGGTGGTTGTCGGACGGA CGG CCCCGTGTGCATCAGAGATG CGG ,ACAAGCTGCACGGAGGAAGC TGG .

[0028] The underlined areas in the above sequence represent the PAM region. S2. Microinjection and mutation detection Cas 9 mRNA (250 ng / μL) and gRNAs (400 ng / μL) were mixed and injected into 1-2 cell stage turbot cells, with some uninjected embryos from the same batch serving as controls. Genomic DNA was extracted from the injected turbot eggs that developed to the embryonic stage. PCR was performed using Sox9a identification primers to obtain the corresponding gene DNA fragments. After agarose gel electrophoresis and PCR product detection, sequencing analysis was used to determine if mutations were present. Figure 1 The identification primers for sox9a are the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2; the sequencing primer for sox9a is SEQ ID NO.1.

[0029] S3. F0 generation female fish obtained Based on the above, turbot eggs injected with large quantities of commercially available Cas9 mRNA or protein and sox9a-related gRNAs (a mixture of four gRNA sequences in equal mass) were hatched and cultured until sexual maturity. Unfertilized eggs were excised, and DNA was extracted. PCR was performed using sox9a identification primers. Agarose gel electrophoresis was used to confirm the amplified target fragment, and sequencing analysis was then performed to determine if the eggs contained a mutant. If a mutant was present, PIT was injected into the dorsal muscle of the corresponding fish for labeling. Figure 2 .

[0030] The identification primers for sox9a are the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2; the sequencing primer for sox9a is SEQ ID NO.1.

[0031] 2. Gynogenesis The F0 generation female fish with the above mutation were cultured to sexual maturity using conventional methods, and the unfertilized eggs were squeezed out and stored in the dark.

[0032] Semen was extracted from non-mutated wild-type male fish and diluted with Ringer's semen diluent at 0-1℃ at a ratio of 1:49 (v / v). The diluted semen was then divided into three equal portions. One sample was directly inseminated with the unfertilized eggs obtained above at a ratio of 1:100 (v / v), and incubated in seawater at 14~16℃ as a diploid control group; The other two samples were inactivated by ultraviolet light. The two inactivated sperm samples were artificially inseminated with the unfertilized eggs obtained above at a ratio of 1:100 (v / v) and incubated in seawater at 15°C. One sample of fertilized eggs was directly incubated as a control group for gynogenetic haploid development. Another fertilized egg was treated with hydrostatic pressure of 65 MPa for 6 minutes 10 minutes before cleavage, and then incubated in seawater at 14-16°C until hatching, i.e., gynogenesis into a diploid.

[0033] Morphological analysis of the newly hatched larvae from each group revealed that the gynogenetic haploid control group exhibited obvious haploid syndrome, while the embryos and larvae from the diploid control group and the gynogenetic diploid group showed normal morphology. Therefore, it was determined that sperm inactivation was complete, resulting in 100% gynogenetic diploids. Figure 3 .

[0034] 3. Analysis of newly hatched larvae Newly hatched larvae were collected and fixed with 70% ethanol. DNA was extracted using a marine animal tissue DNA extraction kit. PCR was performed using the sox9a identification primer to obtain the corresponding gene DNA fragment. Electrophoresis confirmed the amplified target fragment, and sequencing analysis was then performed to determine whether the peak pattern was a mixed peak or a single peak. The sequence of the single peak pattern was compared with the wild-type sequence to analyze whether it was a mutant. Figure 4 .Depend on Figure 4 visible, sox9a Comparison of homozygous mutant sequence with wild-type (WT) sequence. 8 is the 8th gynogenetic newly hatched larvae, which is missing 102 bases compared to the wild-type sequence. The specific proportion varies depending on the gene, and the proportion obtained in this experiment is 50%.

[0035] Example 2. This example provides a method for preparing homozygous F2 generation turbot based on gene-edited F1 generation female turbot, including the following steps: 1. Screening of F1 generation female turbot with targeted knockout of the gsdf gene Female turbot carrying the gsdf (Gonadal Soma-Derived Factor) mutation were constructed using conventional gene editing methods. Eggs from F0 generation female turbot carrying the gsdf mutant, already identified, were mixed with wild-type sperm and hatched to cultivate the F1 generation. After reaching sexual maturity, DNA was extracted from the tail fin. PCR was performed using gsdf identification primers to obtain the corresponding gene DNA fragment. Electrophoresis confirmed the amplified target fragment, which was purified, ligated into a TOPO vector, and transformed onto LB agar plates (containing 100 μg / mL ampicillin). The plates were incubated overnight at 37°C. Three single clones were then randomly selected for sequencing. The sequencing results were compared with wild-type sequences to determine the gene mutation type. PIT was injected into the fish for labeling. Figure 5 .

[0036] Among them, by Figure 5 Visible carrying gsdf The mutant contains an addition of one base.

[0037] The identification primers for the above gsdf are the nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4; the sequencing primer is M13F.

[0038] 2. Gynogenesis Selected F1 generation female fish with mutations were raised to sexual maturity, and unfertilized eggs were collected by squeezing their abdomens and stored in the dark.

[0039] Semen was extracted from non-mutated wild-type male fish and diluted with Ringer's semen diluent at 0-1℃ at a ratio of 1:49. The diluted semen was then divided into three equal portions. One sample was directly inseminated with the unfertilized eggs obtained above at a ratio of 1:100, and incubated in seawater at 14-16℃ as a diploid control group; The other two samples were inactivated by ultraviolet light. The two inactivated sperm samples were artificially inseminated with the unfertilized eggs obtained above at a ratio of 1:100 and incubated in seawater at 15°C. One sample of fertilized eggs was directly incubated as a control group for gynogenetic haploid development. Another fertilized egg was treated with hydrostatic pressure of 65 MPa for 6 minutes 10 minutes before cleavage, and then incubated in seawater at 14-16°C until hatching, i.e., gynogenesis into a diploid.

[0040] Morphological analysis of the newly hatched larvae from each group revealed that the gynogenetic haploid control group exhibited significant haploid syndrome, while the embryos and larvae from the diploid control group and the gynogenetic diploid group showed normal morphology. This indicates that sperm inactivation was complete, resulting in 100% gynogenetic diploid embryos. Figure 6 .

[0041] 3. Analysis of newly hatched larvae Newly hatched fry were collected, fixed with 70% ethanol, and DNA was extracted using a marine animal tissue DNA extraction kit. PCR was performed using GSDF primers to obtain the corresponding gene DNA fragment. Electrophoresis confirmed the amplified target fragment, followed by sequencing analysis to determine whether the peak pattern was a mixed peak or a single peak. The sequence of the single peak pattern was compared with the wild-type sequence to analyze whether it was a mutant and its type. Figure 7 , gsdf Comparison of homozygous mutant sequences with wild-type (WT) sequences: 5 and 8 represent the 5th and 8th female nuclei, newly hatched larvae, with one additional base, just like the mother. The specific proportion varies depending on the gene; the proportion obtained in this experiment was 18.2%.

[0042] SEQ ID NO.1: CTCACAGACTGTCACTGCAG SEQ ID NO.2: CAGGTGGTGCGTTTCGTCAG SEQ ID NO.3:TCTCCAGCCTCTGACCAGAC SEQ ID NO.4: CTACAATATAAAGACACTGC M13F:TGTAAAACGACGGCCAGT

Claims

1. A method for preparing fish homozygous mutant based on gynogenesis and gene editing, characterized in that: (a) obtaining F0 or F1 female Paralichthys olivaceus subjected to gene editing operation, and collecting ova after maturation; (b) fertilizing the ova of the F0 or F1 Paralichthys olivaceus with sperm with inactivated genetic material; (c) inhibiting cleavage of the fertilized eggs in step (b) by physical means to induce mitotic gynogenesis diploid; (d) obtaining genotypically homozygous mutant from the mitotic gynogenesis diploid fry obtained in step (c); wherein the homozygous mutant can stably appear in offspring. The F0 or F1 female Paralichthys olivaceus carrying gene mutation is obtained by targeting and editing specific functional genes using CRISPR / Cas9 system. 3.The method for preparing fish homozygous mutant based on gynogenesis and gene editing according to claim 2, characterized in that: the F0 or F1 female marine fish such as Paralichthys olivaceus in step (a) meets the following conditions: (1) the ova produced by the fish contain target gene mutation, which is confirmed by genotypic sequencing detection; (2) the proportion of ova containing target mutation gene is ≥10%. The F0 female Paralichthys olivaceus in step (a) is a female Paralichthys olivaceus with targeted knockout of sox9a gene, and the F1 female Paralichthys olivaceus is a female Paralichthys olivaceus with targeted knockout of gsdf gene. The ova of the F0 or F1 female Paralichthys olivaceus containing target gene mutation are fertilized with sperm with inactivated genetic material to obtain gynogenesis haploid, and chromosome set doubling is performed by inhibiting cleavage to obtain mitotic gynogenesis diploid. The method for inhibiting cleavage is to treat the gynogenesis haploid with hydrostatic pressure of 65 MPa for 6 minutes at 10 minutes before cleavage, and then incubate in seawater at 14-16℃ until hatching, i.e. mitotic gynogenesis diploid.

2. The method for preparing a gynogenetic genetically edited fish homozygous mutant according to claim 1, characterized in that: The fish homozygous mutant is obtained by the method according to claim 1. ​ ​ ​ 4. The method for preparing a gynogenetic genetically edited fish homozygous mutant according to claim 3, characterized in that: ​ 5. The method for preparing a gynogenetic genetically edited fish homozygous mutant according to any one of claims 1-4, characterized in that: ​ 6. The method for preparing a gynogenetic genetically edited fish homozygous mutant according to claim 5, characterized in that: ​ 7. A gynogenetic, genetically edited, founder fish homozygous mutant obtained by the method of claim 1, wherein: ​

Images