Kit for catalyzing Friedel-Crafts acylation reaction by enzyme method, application and preparation method

By using the thiolytic enzyme complex MucABC to catalyze Friedel-Crafts acylation reactions, the problems of environmental pollution and poor selectivity of traditional catalysts have been solved, achieving efficient C-acylation modification of lactam compounds and improving the green sustainability of chemical and pharmaceutical synthesis.

CN121428034APending Publication Date: 2026-01-30SHENZHEN BAY LAB
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511427245.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-09-29
Filing Date
2025-09-30
Publication Date
2026-01-30

Smart Images

  • Figure CN121428034A_ABST
    Figure CN121428034A_ABST
Patent Text Reader

Abstract

The invention discloses a kit for catalyzing Friedel-Crafts acylation reaction through an enzyme method, application and a preparation method. The kit for catalyzing the Friedel-Crafts acylation reaction by the enzyme method comprises 1) a Friedel-Crafts acylation reaction buffer solution and 2) a thiolase complex MucABC or a functional fragment and a variant thereof. The kit for catalyzing the Friedel-Crafts acylation reaction does not depend on coenzyme A compounds as acyl donors, and can realize regional specific C-acylation modification on various lactam compounds by taking acyl phenyl esters with different chain lengths as the acyl donors under mild conditions; a novel green and efficient biological catalysis tool is provided for Friedel-Crafts acylation reaction, and the method has important value and significance for drug synthesis and chemical production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of Friedel-Crafts acylation reaction technology, and in particular to a kit, application and preparation method for an enzymatically catalyzed Friedel-Crafts acylation reaction. Background Technology

[0002] The Friedel-Crafts reaction is one of the most important reactions in organic chemistry, widely used in fine chemicals, pesticides, dyes, and petrochemicals. Traditional Friedel-Crafts reactions primarily use homogeneous acid catalysts, such as sulfuric acid, hydrofluoric acid, and aluminum chloride. These catalysts have many problems: they cannot be recycled, have poor selectivity, produce many byproducts, corrode equipment, and generate large amounts of wastewater and waste during production, causing environmental pollution and resource waste. Although researchers have developed various solid acid catalysts or heterogeneous catalysts for Friedel-Crafts reactions, their applicability remains limited. Biocatalysis, as a green catalytic strategy, has advantages such as high efficiency, specificity, and environmental friendliness. Enzymes, as biocatalysts, not only possess advantages such as chemical regio and stereoselectivity but can also efficiently catalyze reactions under mild conditions, reducing byproduct formation and environmental pollution.

[0003] Friedel-Crafts reactions include two types: Friedel-Crafts alkylation and Friedel-Crafts acylation. Enzymes capable of catalyzing Friedel-Crafts alkylation are relatively common in nature, such as isopentenyltransferases and methyltransferases. However, compared to Friedel-Crafts alkylation, enzymes capable of catalyzing Friedel-Crafts acylation are currently scarce. Although acyltransferases are widely distributed in organisms and participate in important intracellular metabolic activities, such as the synthesis of fatty acids, phospholipids, and polyketides, most reported acyltransferase-catalyzed acylation reactions typically occur at the O- or N-position, and enzymes capable of catalyzing C-acylation are rare. Thiolases mediate Claisen condensation or thiolysis through thioester chemistry and are functionally classified as C-acyltransferases. However, acyltransferases, represented by thiotransferases, typically rely on acyl carrier proteins (ACPs) or coenzyme A-activated substrates as their acyl donor source. These substrates are unstable and extremely expensive, which greatly limits the application prospects of thiotransferases as biocatalysts.

[0004] Furthermore, acetylation, as a common method for drug structure optimization, can enhance the stability, bioactivity, and pharmacokinetic properties of active small molecules. Since natural products typically have hydroxyl or amino groups in their structure, site-specific C-acylation modification via chemical means is extremely difficult, while acyltransferases offer significant advantages in site selectivity. To date, only one enzyme catalyst has been reported for Friedel-Crafts acylation reactions: PpATase from *Pseudomonas* sp. bacteria, but its substrate specificity is limited to aromatic compounds. The recently reported SmzB, while capable of catalyzing Friedel-Crafts acylation reactions using 5-aminoimidazole-1-riboside as a substrate, relies on an acyl donor source derived from a fatty acid chain activated by an acyl carrier protein, making it unsuitable as a biocatalyst for chemical applications.

[0005] Therefore, the development of new Friedel-Crafts acyltransferases with broader substrate applicability is of great significance and value to the pharmaceutical and chemical industries. Summary of the Invention

[0006] The purpose of this application is to provide a new kit for enzymatically catalyzing Friedel-Crafts acylation reactions, the application of the thiolytic enzyme complex MucABC, and a method for preparing the thiolytic enzyme complex MucABC.

[0007] To achieve the above objectives, this application adopts the following technical solution:

[0008] One aspect of this application discloses a kit for catalyzing Friedel-Crafts acylation reactions, comprising 1) a Friedel-Crafts acylation reaction buffer and 2) a thiolytic enzyme complex MucABC or a functional fragment or variant thereof.

[0009] It should be noted that this application is the first to discover that the thiolytic enzyme complex MucABC can be used to catalyze Friedel-Crafts acylation reactions. Based on this new research finding, this application creatively proposes a novel kit for catalyzing Friedel-Crafts acylation reactions. It is understood that in the kit of this application, the reaction buffer components and the thiolytic enzyme complex MucABC can be pre-mixed together according to the reaction ratio as needed, or they can be packaged separately and mixed in proportion as required during use; as for the form of both, they can be liquid or solid powder, without specific limitations.

[0010] It should also be noted that the thiolytic enzyme complex MucABC is used to catalyze Friedel-Crafts acylation reactions, and the key component is the functional fragment of this enzyme complex. Therefore, based on the inventive concept of this application, the functional fragment of the thiolytic enzyme complex MucABC can also be directly used as a catalyst. It is understood that, without changing the functional fragment, the thiolytic enzyme complex MucABC of this application can also exist in various truncated or mutant forms with the same or similar functions, and these can also be applied to this application.

[0011] In one implementation of this application, the subunits of the thiolytic enzyme complex MucABC include 3-hydroxy-3-methylglutaryl-CoA synthase, acetyl-CoA acetyltransferase, and DUF35. In another implementation of this application, in addition to the aforementioned three subunits, the thiolytic enzyme complex MucABC may selectively further include sequences that do not affect catalytic function, such as tag proteins and linkers. Tag proteins can be proteins used to bind to protein purification fillers, or proteins that simultaneously enhance protein solubility, specifically including but not limited to His6, GAT, MBP, FLAG, HA, Myc, etc. The type of linker is not limited and can be rigid linkers, flexible linkers, shearable linkers, etc. Linkers can be used to prevent protein folding, affecting peptide function, or to improve protein solubility, or to enhance the target protein's resistance to protease hydrolysis, or to protect the functional activity of the protein domains at both ends. Linkers may specifically include at least one glycine, or at least one GS combination, etc.

[0012] In one implementation of this application, the subunit of the thiolytic enzyme complex MucABC is composed of 3-hydroxy-3-methylglutaryl-CoA synthase, acetyl-CoA acetyltransferase, and DUF35, thereby achieving catalytic function.

[0013] It should be noted that 3-hydroxy-3-methylglutaryl-CoA synthase, acetyl-CoA acetyltransferase, and DUF35 are the MucA, MucB, and MucC subunits of the thiolytic enzyme complex MucABC of this application. In one implementation of this application, the subunits of the thiolytic enzyme complex MucABC are derived from *Streptococcus simius*. Other bacteria also have similar sequences. As long as the sequence is the same as or similar to the thiolytic enzyme complex MucABC or its functional fragment of this application, they have the same or similar functions. For example, a multi-enzyme complex composed of 3-hydroxy-3-methylglutaryl-CoA synthase, acetyl-CoA acetyltransferase, and DUF35 may not be named MucABC; however, regardless of its name, as long as the sequence is the same as or similar to the thiolytic enzyme complex MucABC or its functional fragment of this application, it has the same or similar function in catalyzing Friedel-Crafts acylation reactions.

[0014] In one implementation of this application, the pH of the buffer solution is 6 to 8.

[0015] In one implementation of this application, the Friedel-Crafts acylation reaction buffer is at least one of potassium phosphate buffer, Tris-HCl, and HEPES buffer. For example, 50 mM potassium phosphate buffer at pH 7.0.

[0016] Another aspect of this application discloses the use of the thiolytic enzyme complex MucABC or its functional fragments and variants in catalyzing Friedel-Crafts acylation reactions.

[0017] It should be noted that the key to this application lies in the discovery of a novel use for the thiolytic enzyme complex MucABC, namely, its ability to catalyze Friedel-Crafts acylation reactions. Based on this discovery, this application has developed corresponding compositions for catalyzing Friedel-Crafts acylation reactions, as well as novel methods for catalyzing Friedel-Crafts acylation reactions. It is understood that, as explained above, the thiolytic enzyme complex MucABC or its truncated or mutant forms with similar or identical functions can also be used to catalyze Friedel-Crafts acylation reactions.

[0018] In one implementation of this application, the Friedel-Crafts acylation reaction includes using the thiolytic enzyme complex MucABC to catalyze the C-acylation reaction of the acyl acceptor.

[0019] In one implementation of this application, the acyl receptor includes a lactam compound.

[0020] In one implementation of this application, the acyl acceptor includes a lactam compound with a pyrrolidine-2,4-dione backbone.

[0021] In one embodiment of this application, the lactam compound includes 1-acetyl-5-isobutylpyrrolidine-2,4-dione, 5-isobutyl-1-octanoylpyrrolidine-2,4-dione, 5-isobutyl-1-tetradecanoylpyrrolidine-2,4-dione, 5-isobutyl-1-stearoylpyrrolidine-2,4-dione, 5-isobutyl-1-(3-phenylpropionyl)pyrrolidine-2,4-dione, and (E)-1-(dec-2-enoyl) At least one of the following: 5-methylpyrrolidine-2,4-dione, (E)-1-(dec-2-enoyl)-5-isopropylpyrrolidine-2,4-dione, (E)-1-(dec-2-enoyl)-5-(4-hydroxybenzyl)pyrrolidine-2,4-dione, (E)-5-benzyl-1-(dec-2-enoyl)pyrrolidine-2,4-dione, and (E)-1-(dec-2-enoyl)-5-isobutylpyrrolidine-2,4-dione.

[0022] In one implementation of this application, the Friedel-Crafts acylation reaction further includes an acyl donor.

[0023] In one implementation of this application, the acyl donor includes at least one of acetyl-CoA, ethyl thioester, N-acetylimidazole, isopropyl acetate, and acylphenyl ester.

[0024] In one implementation of this application, the acylphenyl ester includes at least one of phenyl acetate, phenyl propionate, phenyl butyrate, phenyl 2-methoxyacetic acid, phenyl valerate, phenyl 2-ethoxyacetic acid, phenyl hexanoate, phenyl heptanoate, and phenyl octanoate.

[0025] Another aspect of this application discloses a method for improving the antibacterial activity of lactam compounds, comprising using the thiolytic enzyme complex MucABC to catalyze the C-acylation reaction of lactam compounds.

[0026] It should be noted that the key to this application lies in the discovery that the thiolytic enzyme complex MucABC can catalyze Friedel-Crafts acylation reactions. Based on this, this application further investigates and finds that acetylation modification catalyzed by MucABC can significantly enhance the antibacterial activity of lactam compounds. For example, C-acylation modification of (E)-1-(decano-2-enoyl)-5-isobutylpyrrolidine-2,4-dione (pre-reutericyclin A) significantly enhances its antibacterial activity, indicating that this enzyme has the potential to improve antibiotic potency through acylation modification. Therefore, this application creatively proposes a method for enhancing the antibacterial activity of lactam compounds.

[0027] In one embodiment of this application, the lactam compound is (E)-1-(dec-2-enoyl)-5-isobutylpyrrolidine-2,4-dione or a structural analog thereof.

[0028] It should be noted that this application found that the thiolytic enzyme complex MucABC catalyzes the C-acylation reaction of pre-reutericyclin A, thereby enhancing the antibacterial activity of pre-reutericyclin A. It is understood that, based on this, structural analogs with similar structures to pre-reutericyclin A can also undergo C-acylation reactions catalyzed by the thiolytic enzyme complex MucABC, thereby enhancing their antibacterial activity. Regarding the acetyl donor, please refer to the application of the thiolytic enzyme complex MucABC in catalyzing Friedel-Crafts acylation reactions in this application; it will not be elaborated here.

[0029] Another aspect of this application discloses an enzymatically catalyzed Friedel-Crafts acylation reaction method, comprising using the thiolytic enzyme complex MucABC as a catalyst to achieve C-acylation modification of acyl acceptors.

[0030] It should be noted that, compared with existing technologies, the Friedel-Crafts acylation method of this application can achieve regio-specific C-acylation modification of various lactam compounds under mild conditions, such as a buffer system of 18-42°C and pH 6-8, using acylphenyl esters of different chain lengths as acyl donors. This application provides a novel catalytic tool and scheme for Friedel-Crafts acylation reactions, which is of great significance for promoting the green and sustainable development of the chemical industry.

[0031] In one implementation of this application, the acyl acceptor includes lactam compounds, particularly lactam compounds containing a pyrrolidine-2,4-dione skeleton.

[0032] It should be noted that the method for catalytic Friedel-Crafts acylation reaction in this application is actually based on the novel use of the thiolytic enzyme complex MucABC in this application; therefore, the acetyl donor and lactam compounds in the method of this application can refer to the application of the thiolytic enzyme complex MucABC in catalytic Friedel-Crafts acylation reaction in this application, and will not be elaborated here.

[0033] Another aspect of this application discloses a method for preparing the thiolytic enzyme complex MucABC, comprising inducing host cells to express proteins to obtain the thiolytic enzyme complex MucABC of this application; wherein the host cells contain a nucleic acid sequence for expressing the thiolytic enzyme complex MucABC of this application.

[0034] It should be noted that the thiolytic enzyme complex MucABC is a multi-enzyme complex. In one implementation of this application, the preparation and purification of recombinant thiolytic enzyme complex MucABC protein were first achieved through "prokaryotic expression + chromatography purification", and the obtained recombinant thiolytic enzyme complex MucABC protein all have catalytic activity.

[0035] In one implementation of this application, the preparation method further includes purifying the protein after expression.

[0036] In one implementation of this application, purification includes at least one of precipitation, chromatography, electrophoresis, centrifugation, dialysis, ultrafiltration, two-liquid extraction, and high-performance liquid chromatography.

[0037] In one implementation of this application, the precipitation method includes at least one of salting-out precipitation, isoelectric point precipitation, and organic solvent precipitation.

[0038] In one implementation of this application, the chromatography method includes at least one of ion exchange chromatography, molecular sieve filtration chromatography, affinity chromatography, and hydrophobic chromatography.

[0039] In one implementation of this application, the electrophoresis method includes at least one of SDS-PAGE electrophoresis and isoelectric focusing electrophoresis.

[0040] In one implementation of this application, the host cell contains a recombinant expression vector, wherein the recombinant expression vector contains a nucleic acid sequence for expressing the thiolytic enzyme complex MucABC.

[0041] In one implementation of this application, the host includes at least one of a eukaryotic expression host and a prokaryotic expression host.

[0042] In one implementation of this application, the eukaryotic expression host includes at least one of yeast system, insect cell, mammalian cell, and plant cell.

[0043] In one implementation of this application, the prokaryotic expression host includes at least one of Escherichia coli, Bacillus subtilis, Lactobacillus, Streptomyces, and Agrobacterium.

[0044] In one implementation of this application, the nucleic acid sequence includes a mucABC sequence;

[0045] In one implementation of this application, the mucABC sequence consists of a mucA sequence expressing the MucA subunit, a mucB sequence expressing the MucB subunit, and a mucC sequence expressing the MucC subunit.

[0046] In one implementation of this application, the mucA sequence is the sequence shown in Seq ID No.1, the mucB sequence is the sequence shown in Seq ID No.2, and the mucC sequence is the sequence shown in Seq ID No.3.

[0047] In one implementation of this application, the recombinant expression vector includes at least one of a eukaryotic expression vector and a prokaryotic expression vector.

[0048] In one implementation of this application, the eukaryotic expression vector includes at least one of a yeast expression vector, an insect cell vector, and a mammalian cell vector.

[0049] In one implementation of this application, the prokaryotic expression vector includes at least one of the following: pET series vectors, pGEX series vectors, pBAD series vectors, pMAL series vectors, Duet series vectors, and ASKIBIO series vectors.

[0050] In one implementation of this application, the recombinant expression vector is pACYCDuet-1 or pASKIBA3plus.

[0051] In one implementation of this application, the promoter and affinity tag in the recombinant expression vector are designed as at least one of the following schemes:

[0052] 1) Using pACYCDuet-1 as the expression vector, the inserted sequence from the 5' end to the 3' end includes the promoter sequence, RBS sequence, affinity tag sequence, mucA sequence, RBS sequence, mucB sequence, RBS sequence, and mucC sequence in sequence;

[0053] 2) Using pACYCDuet-1 as the expression vector, the inserted sequence from the 5' end to the 3' end includes the promoter sequence, RBS sequence, mucA sequence, promoter sequence, RBS sequence, mucB sequence, affinity tag sequence, RBS sequence, and mucC sequence in sequence;

[0054] 3) Using pACYCDuet-1 as the expression vector, the inserted sequence from the 5' end to the 3' end includes the promoter sequence, RBS sequence, mucA sequence, RBS sequence, mucC sequence, promoter sequence, RBS sequence, mucB sequence, and affinity tag sequence in sequence;

[0055] 4) Using pACYCDuet-1 as the expression vector, the inserted sequence from the 5' end to the 3' end includes the promoter sequence, RBS sequence, mucA sequence, promoter sequence, RBS sequence, mucB sequence, RBS sequence, mucC sequence, and affinity tag sequence in sequence;

[0056] 5) Using pASKIBA3plus as the expression vector, the inserted sequence from the 5' end to the 3' end includes the promoter sequence, RBS sequence, mucA sequence, RBS sequence, mucB sequence, RBS sequence, mucC sequence, and affinity tag sequence in sequence.

[0057] In one implementation of this application, the affinity tag sequence includes at least one of His6, GAT, MBP, FLAG, HA, and Myc. For example, the His6 tag is preferred.

[0058] Due to the adoption of the above technical solutions, the beneficial effects of this application are as follows:

[0059] The kit for catalyzing Friedel-Crafts acylation reactions presented in this application does not rely on coenzyme A compounds as acyl donors. It can achieve regio-specific C-acylation modification of a variety of lactam compounds under mild conditions using acylphenyl esters of different chain lengths as acyl donors. This provides a new, green, and efficient biocatalytic tool for Friedel-Crafts acylation reactions, which has significant value and implications for drug synthesis and chemical production. Attached Figure Description

[0060] Figure 1 These are plasmid maps of MucABC recombinant proteins expressed using different construction methods in the embodiments of this application;

[0061] Figure 2These are SDS-PAGE electrophoresis results of recombinant MucABC proteins expressed by different construction methods in the embodiments of this application;

[0062] Figure 3 This is a graph showing the statistical results of the reactivity of MucABC recombinant protein expressed by different construction methods in the embodiments of this application;

[0063] Figure 4 This is the functional characterization result of MucABC in the embodiments of this application;

[0064] Figure 5 This is the reaction time optimization result of MucABC in the embodiments of this application;

[0065] Figure 6 These are the reaction buffer components and pH optimization results of MucABC in the embodiments of this application;

[0066] Figure 7 This is the result of the optimized reaction temperature of MucABC in the embodiments of this application;

[0067] Figure 8 These are the experimental results of the antibacterial activity of pre-reutericyclin A and its acetylated product reutericyclin A in the embodiments of this application;

[0068] Figure 9 and Figure 10 These are the substrate broadness test results of MucABC for lactam compounds in the embodiments of this application;

[0069] Figure 11 and Figure 12 The results of the MucABC test on the acyl donors with different aliphatic chain lengths in the embodiments of this application are as follows. Detailed Implementation

[0070] Existing PpATases from Pseudomonas sp. bacteria, while capable of catalyzing Friedel-Crafts acylation reactions, are limited to aromatic compounds as substrates. Therefore, developing novel acyltransferases applicable to a wider range of substrates is a key research focus and challenge in this field.

[0071] This study found that the thiolytic enzyme complex MucABC, derived from the muc gene cluster of *Streptococcus macacae*, can catalyze Friedel-Crafts acylation reactions, particularly achieving region-specific C-acylation modification of various lactam compounds under mild conditions using various acetyl donors or acylphenyl esters of different chain lengths. These lactam compounds mainly include those with a pyrrolidine-2,4-dione backbone. Acetyl donors include acetyl-CoA, phenyl acetate, ethyl thioester, N-acetylimidazole, and isopropyl acetate. Acylphenyl esters of different chain lengths include phenyl propionate, phenyl butyrate, phenyl 2-methoxyacetate, phenyl valerate, phenyl 2-ethoxyacetate, phenyl hexanoate, phenyl heptanoate, and phenyl octanoate.

[0072] In this application, MucABC is composed of 3-hydroxy-3-methylglutaryl-CoA synthase (MucA, accession no. WP_003080777.1), acetyl-CoA acetyltransferase (MucB, accession no. WP_003082100.1), and DUF35 (MucC, accession no. WP_002277496.1).

[0073] Based on the above research and findings, in some embodiments, this application has developed a novel kit for catalyzing Friedel-Crafts acylation reactions, comprising 1) a Friedel-Crafts acylation reaction buffer and 2) a thiolase complex MucABC or a functional fragment or variant thereof. Based on this, a novel method for catalyzing Friedel-Crafts acylation reactions has been further developed, comprising using the thiolase complex MucABC as a catalyst to achieve C-acylation modification of acyl acceptors. For example, adding 12 μM of acyltransferase MucABC to a 50 mM potassium phosphate buffer (pH 7.0) containing 1 mM lactam compound and 1.5 mM acylphenyl ester, and reacting at 30°C for 16 h. In this application, the thiolase complex MucABC can catalyze Friedel-Crafts acylation reactions; therefore, it is also referred to as acyltransferase MucABC.

[0074] Furthermore, this application has also developed several recombinant expression vectors containing the above-mentioned genes and expressing the above-mentioned thiolytic enzyme complex MucABC, as well as recombinant cells expressing the above-mentioned thiolytic enzyme complex MucABC.

[0075] In one implementation of this application, the method for producing the thiolytic enzyme complex MucABC includes inducing recombinant cell expression, followed by affinity chromatography purification to obtain the thiolytic enzyme complex MucABC. Therefore, the thiolytic enzyme complex MucABC of this application can be prepared through prokaryotic expression and affinity chromatography purification.

[0076] In some embodiments, this application also found that MucABC-catalyzed acetylation modification can significantly enhance the antibacterial activity of pre-reutericyclin A, indicating its potential to improve antibiotic potency through acylation modification.

[0077] In some embodiments, the MucABC in vitro enzyme activation reaction system of this application does not rely on coenzyme A compounds as acyl donors. It can achieve regio-specific C-acylation modification of various lactam compounds under mild conditions using acylphenyl esters of different chain lengths as acyl donors. This application not only provides a novel catalytic tool for Friedel-Crafts acylation reactions but also has significant implications for promoting the green and sustainable development of the chemical industry.

[0078] The present application will now be described in further detail with reference to specific embodiments and accompanying drawings. In the following embodiments, many details are described to facilitate a better understanding of the present application. However, those skilled in the art will readily recognize that some features may be omitted in different situations, or may be replaced by other devices, materials, or methods. In some cases, certain operations related to the present application are not shown or described in the specification to avoid obscuring the core parts of the application with excessive description. For those skilled in the art, detailed description of these related operations is not necessary; a complete understanding of the related operations can be obtained from the description in the specification and general technical knowledge in the art.

[0079] Example

[0080] The reagents involved in this example include: culture media, buffer solutions, etc.

[0081] LB solid medium (1L): 10g tryptone, 5g yeast extract, 10g sodium chloride, 17g agar powder.

[0082] LB liquid medium: 10g tryptone, 5g yeast extract, 10g sodium chloride, dissolved in deionized water and brought to a final volume of 1L.

[0083] MHB medium: 3g beef meal, 17.5g acid-hydrolyzed casein, 1.5g soluble starch, dissolved in deionized water and brought to a final volume of 1L.

[0084] Binding buffer: 50mM Tris-HCl, 500mM sodium chloride, 20mM imidazole, 10% glycerol, pH 8.0.

[0085] Elution buffer: 50mM Tris-HCl, 500mM sodium chloride, 500mM imidazole, 10% glycerol, pH 8.0.

[0086] Potassium phosphate buffer (50mM, pH 7.0): Weigh 4.672g K2HPO4 and 3.154g KH2PO4 and dissolve them in 1L of deionized water.

[0087] The chemical structures of the lactam compounds involved in this example are shown in Table 1. The synthesis of lactam compounds is described in reference (Synlett 2000, 8:1131-1132). Taking pre-reutericyclin A as an example, the specific synthesis method is as follows: trans-2-decenoic acid (275 mg, 1.62 mmol) was dissolved in 25 mL of dichloromethane, and L-leucine-tert-butyl ester (200 mg, 0.90 mmol) was added. The reaction mixture was stirred at 40 °C for 2 hours. Subsequently, the reaction mixture was washed successively with saturated sodium bicarbonate aqueous solution and saturated sodium chloride aqueous solution. After the organic phase was concentrated under reduced pressure, the resulting residue was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (2.5 mL) was added. The mixture was stirred at 25 °C for 2 hours to complete the ester cleavage reaction, generating N-acylated leucine. Subsequently, Meldrum's acid (183 mg, 1.27 mmol), 4-dimethylaminopyridine (DMAP, 390 mg, 3.19 mmol), and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDCI, 304 mg, 1.59 mmol) were added to a solution of dichloromethane (20 mL) containing N-acylated leucine (300 mg, 1.06 mmol). The resulting mixture was stirred at 25 °C for 3 hours and then filtered. The filtrate was washed with a saturated sodium bicarbonate aqueous solution. The organic phase was concentrated under reduced pressure and dissolved in ethyl acetate (10 mL), then refluxed at 85 °C for 1 hour. After solvent removal, the obtained solid was purified by preparative high-performance liquid chromatography (HPLC) using a Phenomenex Kinetex XB-C18 column (250 mm × 10 mm, 5 μm): isocratic elution [acetonitrile / water (75:25, v / v), containing 0.1% trifluoroacetic acid], flow rate 2.5 mL / min, and the final retention time t was obtained. R The target product, pre-reutericyclin A, was synthesized in 14.2 min. Other lactam compounds were synthesized using the same method.

[0088] Table 1. Lactam compounds used in this example.

[0089]

[0090]

[0091] The acylphenyl ester compounds involved in this example are shown in Table 2. P1 was purchased from Aladdin (catalog number P304243-5g); P4 was purchased from Accustandard (catalog number P-734N); and the synthesis of P2, P3, P5 to P8 is based on the method described in ACS Catal. 2020, 10:1094-1101. Taking phenyl butyrate as an example, the specific synthesis method is as follows: Under nitrogen protection, butyryl chloride (4.34 mmol, 1.2 mL) was added to a dichloromethane solution (6 mL) of phenol (3.6 mmol, 340 mg). Triethylamine (9.0 mmol, 1.2 mL) was then slowly added dropwise, and the reaction was stirred at 25 °C for 3 h. After the reaction was complete, the reaction mixture was washed with 20 mL of water and 20 mL of saturated brine. The crude product was purified by silica gel column chromatography (petroleum ether / ethyl acetate system) to obtain the corresponding acylphenyl ester compounds.

[0092] Table 2 shows the acylphenyl ester compounds used in this example.

[0093]

[0094]

[0095] Experiment 1: Expression, purification and functional identification of acyltransferase MucABC

[0096] I. Experimental Methods

[0097] Construction of MucABC expression plasmid: The mucABC sequences (MucA: accession no.WP_003080777.1, MucB: accession no.WP_003082100.1, MucC: accession no.WP_002277496.1) derived from Streptococcus macacae were codon optimized and plasmids constructed by Qingke Biotechnology Co., Ltd., and then transformed into Escherichia coli to induce protein expression.

[0098] Among them, the codon-optimized mucA sequence is the sequence shown in Seq ID No.1, the codon-optimized mucB sequence is the sequence shown in Seq ID No.2, and the codon-optimized mucC sequence is the sequence shown in Seq ID No.3.

[0099] Seq ID No.1:

[0100]

[0101] Seq ID No.2:

[0102]

[0103] Seq ID No. 3:

[0104] ATGTTCTCTAACGAACAAATCTCTAACCCGACTATCGAAAGCTCTCTGAAAGACTGGCGTGAACAGGGTGGTCTGACTCGTCTGGAAGGTAGCAAATGTCCGCATTGCGACGAACTGTTCTATCCGCGTCGTTTCGTTTGCCCGTACTGCTTCTGTCGTAGCCTGAAGACCTACAAGTTCTCTGGCATGGGTAAGATCAAGAACATCGAGATCAACTCCATCTC TCAGGTGGCTGTTATCGGTTACCGTGAAATCTCTCCGCGTTACCTGTCCGTGATCGAACTGGCTGAAGGTGTGGATGTTCTGGGTGAAATCATCGAATGCTCTGAAATCGAATCCATCCACAGCCTGATCGGCCGTGAAGTTATGTCTGTTGTTCGTAAACAGAGCCGTTCTGGCAACACCAGCTGGAAATACGGCTACAAATTCAAACTGAAAGAAGGTTAA.

[0105] like Figure 1 As shown, this example demonstrates the construction of recombinant plasmids using pACYCDuet-1 and pASKIBA3plus vectors, respectively. The effects of the His6 tag and T7 promoter at different positions in the pACYCDuet-1 vector on the expression of the recombinant plasmid were investigated. These are labeled as Construction 1, Construction 2, Construction 3, and Construction 4, respectively. The construction of the recombinant plasmid using pASKIBA3plus vector is labeled as Construction 5. Details are as follows:

[0106] 1) Using pACYCDuet-1 as the expression vector, the inserted sequence from the 5' end to the 3' end includes the promoter sequence, RBS sequence, His6 tag, mucA sequence, RBS sequence, mucB sequence, RBS sequence, and mucC sequence in sequence; labeled as construction 1.

[0107] 2) Using pACYCDuet-1 as the expression vector, the inserted sequence from the 5' end to the 3' end includes the promoter sequence, RBS sequence, mucA sequence, promoter sequence, RBS sequence, mucB sequence, His6 tag, RBS sequence, and mucC sequence in sequence; labeled as construction 2.

[0108] 3) Using pACYCDuet-1 as the expression vector, the inserted sequence from the 5' end to the 3' end includes the promoter sequence, RBS sequence, mucA sequence, RBS sequence, mucC sequence, promoter sequence, RBS sequence, mucB sequence, and His6 tag in sequence; this is marked as construction 3.

[0109] 4) Using pACYCDuet-1 as the expression vector, the inserted sequence from the 5' end to the 3' end includes the promoter sequence, RBS sequence, mucA sequence, promoter sequence, RBS sequence, mucB sequence, RBS sequence, mucC sequence, and His6 tag in sequence; this is marked as construction 4.

[0110] 5) Using pASKIBA3plus as the expression vector, the inserted sequence from the 5' end to the 3' end includes the promoter sequence, RBS sequence, mucA sequence, RBS sequence, mucB sequence, RBS sequence, mucC sequence, and His6 tag in sequence; labeled as construction 5.

[0111] Induced expression of MucABC: The expression plasmid was introduced into Escherichia coli BL21(DE3) competent cells (Kangti Biotechnology) via heat stimulation and plated on LB agar plates containing chloramphenicol (constructions 1-4) or ampicillin (construction 5), and cultured overnight at 37°C. Single colonies were selected and inoculated into shake tubes (containing 5 mL LB and chloramphenicol or ampicillin), and cultured on a shaker (220 rpm) at 37°C for 6 h. 5 mL of the seed culture was inoculated into 500 mL LB agar (containing chloramphenicol or ampicillin) and cultured on a shaker (220 rpm) at 37°C until OD (digestive growth) was reached. 600 ≈0.6. IPTG (isopropyl-β-d-thiogalactoside) was added to a final concentration of 0.2 mmol / L, and the mixture was incubated at 30°C and 140 rpm for 21 h. The fermentation broth was then centrifuged at 4°C and 8000 rpm for 15 min, and the cells were collected.

[0112] Purification of MucABC: 30 mL of binding buffer was added to the bacterial cell pellet to thoroughly suspend the cells. The cells were then lysed for 10 min using an ultrasonic cell disruptor (300 W, 3 s sonication, 6 s intervals) under ice-water bath conditions. The lysate was centrifuged at 10,000 rpm and 4°C for 30 min, and the supernatant was collected. Ni-NTAResin, pre-equilibrated with binding buffer, was added to the supernatant, and the mixture was magnetically stirred at 4°C for 1 h. After passing the supernatant through a column, the sample was washed with lysis buffer to remove contaminating proteins, followed by washing with Elution buffer to remove the target protein. The fraction was collected. The fraction was replaced with 50 mM potassium phosphate buffer (containing 10% glycerol, pH 7.0) using a PD-10 desalting column (Cytiva), and then concentrated by centrifugation using an Amicon Ultra-15 Ultracel-30K centrifuge tube to obtain the target protein. Transfer 20 μL of the eluted protein into a PCR tube, add 5 μL of 6× protein loading buffer, and boil at 95 °C for 5 min to denature and inactivate the protein. Then perform SDS-PAGE gel electrophoresis for detection.

[0113] MucABC recombinant proteins obtained by different construction methods were added to the reaction system with the same amount of enzyme. Under the same reaction conditions, namely, 100 μL of 50 mM potassium phosphate buffer solution (pH 7.0) was added with substrate pre-reutericyclin A (final concentration 1 mmol / L), phenyl acetate (final concentration 1.5 mmol / L), and 12 μM of MucABC recombinant protein, and the reaction was carried out at 30 °C for 2 h. The degree of substrate consumption in each reaction system was then measured by HPLC to compare their reactivity.

[0114] Functional characterization of MucABC: The catalytic reaction system consisted of 100 μL of 50 mM potassium phosphate buffer (pH 7.0), substrate pre-reutericyclin A: 1 mmol / L, acetyl-CoA (Merck, catalog number A2181) or non-natural acetyl donor phenyl acetate (Aladdin, catalog number P108579), ethyl thiocyanate (Maclean, catalog number E808921), N-acetylimidazole (Aladdin, catalog number A100252), isopropyl acetate (Aladdin, catalog number I108612): 1.5 mmol / L, and MucABC recombinant protein: 12 μM. The reaction system was incubated at 30 °C for 16 h, and then 100 μL of methanol was added to terminate the reaction. The reaction solution was centrifuged at 21,000 × g for 30 min and analyzed by HPLC. Detection method: The mobile phase consisted of water (containing 0.1% trifluoroacetic acid, v / v, phase A) and acetonitrile (containing 0.1% trifluoroacetic acid, v / v, phase B). The mobile phase gradient was: 0-5 min, 5%-60% B; 5-20 min, 60%-100% B; 20-35 min, 100% B; 35-40 min, 5% B, at a flow rate of 1 mL / min. Sample analysis and data acquisition were performed using an Agilent 1290 equipped with a Phenomenex Kinetex XB-C18 column (4.6 mm × 100 mm, 2.6 μm). Data were analyzed and processed using Agilent OpenLab CDS ChemStation Edition C.01.07. The reaction system was scaled up to 50 mL, containing 50 mM potassium phosphate buffer (pH 7.0), 1 mM pre-reutericyclin-A, 1.5 mM phenyl acetate, and 15 μM MucABC. After reacting at 30℃ for 16 h, the compound was extracted with ethyl acetate (containing 1% acetic acid, v / v). The crude extract was purified by semi-preparative liquid chromatography: a Phenomenex Kinetex XB-C18 column (250 mm × 10 mm, 5 μm) was used, with a mobile phase gradient of acetonitrile / water (95:5, v / v) containing 0.1% trifluoroacetic acid, at a flow rate of 2.5 mL / min. The pure compound (retention time 10.6 min) was obtained and its structure was determined to be reutericyclin A by spectroscopic analysis.

[0115] Optimization of MucABC reaction conditions: Pre-reutericyclin A (final concentration 1 mmol / L), phenyl acetate (final concentration 1.5 mmol / L), and 12 μM of MucABC recombinant protein were added to 100 μL of 50 mM potassium phosphate buffer (pH 7.0). The reaction was carried out at 30 °C for 10 min, 30 min, 60 min, 120 min, 240 min, and 480 min, respectively. The consumption of substrates during the reaction was detected by HPLC.

[0116] Pre-reutericyclin A (final concentration 1 mmol / L), phenyl acetate (final concentration 1.5 mmol / L), and 12 μM of MucABC recombinant protein were added to 100 μL of 50 mM potassium phosphate buffer (pH 7.0). The mixture was reacted at 4 °C, 18 °C, 25 °C, 30 °C, 37 °C, 42 °C, 50 °C, and 55 °C for 2 h, respectively. The consumption of substrates during the reaction was detected by HPLC.

[0117] Pre-reutericyclin A (final concentration 1 mmol / L), phenyl acetate (final concentration 1.5 mmol / L), and 12 μM of MucABC recombinant protein were added to 50 mM potassium phosphate buffer solutions with pH values ​​of 6.0, 6.5, 7.0, 7.5, and 8.0, respectively. The solutions were reacted at 30 °C for 2 h, and the consumption of substrates during the reaction was detected by HPLC.

[0118] The HPLC detection method included a mobile phase of water (containing 0.1% trifluoroacetic acid, v / v, phase A) and acetonitrile (containing 0.1% trifluoroacetic acid, v / v, phase B), with a mobile phase gradient of 5%-60% B for 0-5 min; 60%-100% B for 5-20 min; 100% B for 20-35 min; and 5% B for 35-40 min, at a flow rate of 1 mL / min. Sample analysis and data acquisition were performed using an Agilent 1290 with a Phenomenex Kinetex XB-C18 column (4.6 mm × 100 mm, 2.6 μm), and data were processed using Agilent OpenLab CDS ChemStation Edition C.01.07. Acetylated products were identified by quadrupole-time-of-flight high-resolution mass spectrometry (Q-TOF-HRMS). The parameters for the SCIEX TripleTOF 6600 mass spectrometer are set as follows: mass scan range m / z 50-1000; MS scan rate 1.25 s. -1 MS / MS scan rate 1.25s -1 The collision energy was fixed at 30 eV. Ion source parameters were as follows: gas temperature 500℃; curtain gas 35 psi; ion spray voltage 5500 V; ion source gas 1: 50 psi; ion source gas 2: 50 psi; anion mode. Data acquisition and analysis were performed using SCIEX OS software (version 2.0) from SCIEX Corporation.

[0119] II. Experimental Results

[0120] SDS-PAGE electrophoresis results are as follows: Figure 2 As shown in the figure, M represents the marker, S is the lane of the supernatant, and P is the corresponding protein lane. The statistical results of the reactivity of the MucABC recombinant protein are as follows: Figure 3 As shown. MucABC is a family of thiolytic enzymes complex, consisting of three subunits: MucA, MucB, and MucC linked non-covalently. Figures 1 to 3 As shown, different construction methods for expressing MucABC recombinant protein—including using different promoters, changing the number of promoters, selecting N-terminal or C-terminal His6 tags, and changing the number of His6 tags—all successfully expressed and purified MucABC recombinant protein, and all exhibited catalytic activity. Among these, the MucABC expressed by construction 2 had higher purity than that expressed by the other constructions, and the ratio of the three subunits MucA, MucB, and MucC was closer to 1:1:1, resulting in higher catalytic activity in in vitro enzyme activity assays.

[0121] The functional characterization results of MucABC are as follows: Figure 4 As shown, MucABC catalyzes the formation of reutericyclin A using pre-reutericyclin A as the substrate and acetyl-CoA as the donor. Mass spectrometry analysis revealed that the molecular ion peak of the product increased by 42 Da compared to the substrate, indicating that MucABC acetylated the substrate. Further analysis of the product confirmed that the acetyl group was substituted at the C-3 position of the pyrrolidine-2,4-dione skeleton.

[0122] The optimized reaction conditions for MucABC are as follows: Figures 5 to 7 As shown, Figure 5 To optimize results for time, Figure 6 The results of buffer component and pH optimization are as follows. Figure 7 Results of reaction temperature optimization. Figures 5 to 7 The results showed that MucABC operates under mild conditions, catalyzing Friedel-Crafts acylation reactions in a potassium phosphate buffer solution at pH 6.0–8.0 and at temperatures ranging from 18–42 °C. Unlike typical acyltransferases, MucABC can utilize various non-natural donors as acyl donor sources, including N-acetylimidazole, acetoisopropyl ester, ethyl thioester, and phenyl acetate, indicating that MucABC has potential for catalytic applications as an acyltransferase.

[0123] Experiment 2: MucABC-catalyzed acetylation modification can enhance the antibacterial activity of antibiotics.

[0124] I. Experimental Methods

[0125] Stock solutions of pre-reutericyclin A (6.4 mg / mL) and reutericyclin A (8 mg / mL) were prepared using DMSO. Ampicillin sodium salt dissolved in an aqueous solution of the same concentration was used as a positive control. The following indicator strains were used in the experiment: *Streptococcus salivarius* DA547, *Streptococcus oralis* DA1241, *Streptococcus gordonii* ATCC 10558, *Bacillus subtilis* 168, *Staphylococcus aureus* ATCC 29213, methicillin-resistant *Staphylococcus aureus* 544 and 103, and *Streptococcus pneumoniae* ATCC 49619.

[0126] For the determination of minimum inhibitory concentration (MIC), the compound was diluted two-half times with MHB broth and added to each well of a 96-well plate at a volume of 50 μL. The logarithmic growth phase bacterial culture was diluted with MHB to a final concentration of 1 × 10⁻⁶. 6 Add 50 μL of bacterial culture to each well to achieve a final inoculum concentration of 5 × 10⁻⁶ CFU / mL. 5 CFU / mL (validated effective range is 2×10⁻⁶) 5 CFU / mL up to 8×10 5 CFU / mL). *Streptococcus oralis* DA1241 and *Streptococcus Gordonii* ATCC 10558, due to poor growth in MHB, were cultured on BHI medium. Each plate included antibiotic-free medium as a negative control and untreated bacterial culture as a growth control. After incubating the 96-well plates at 37°C for 18 hours, absorbance was measured at 625 nm using a BioTek Epoch 2 microplate reader. The MIC value was defined as the lowest drug concentration (OD500) required to completely inhibit visible bacterial growth (compared to the negative control). 625 ≤0.02). All experiments were independently repeated three times.

[0127] II. Experimental Results

[0128] The results are as follows Figure 8As shown, pre-reutericyclin A exhibited negligible inhibitory activity against *Streptococcus oralis* DA1241, *Streptococcus salivarius* DA547, *Streptococcus pneumoniae* ATCC 49619, *Staphylococcus aureus* ATCC 29213, methicillin-resistant *Staphylococcus aureus* (MRSA) 103, and MRSA544. However, the acetylated product, reutericyclin A, demonstrated potent antibacterial activity against these strains, with minimum inhibitory concentrations (MICs) ranging from 0.5 to 4 μg / mL. Although pre-reutericyclin A showed some antibacterial activity against *Streptococcus Gordonii* ATCC 10558 (MIC = 32 μg / mL), the antibacterial activity of reutericyclin A was increased by 32-fold (MIC = 1 μg / mL). These results indicate that MucABC-catalyzed acetylation modification is the key modification conferring antibacterial efficacy to reutericyclin A.

[0129] Experiment 3: Acetylation modification of lactam compounds by MucABC

[0130] I. Experimental Methods

[0131] A series of lactam compounds with structures similar to pre-reutericyclin-A were synthesized in the laboratory (Table 1). The substrate breadth of MucABC was evaluated by testing its reactivity with substrate analogs. The conversion rate was calculated by detecting the change in peak area of ​​the substrate in the experimental and control groups by HPLC, i.e., conversion rate = (peak area of ​​substrate in control group - peak area of ​​substrate in experimental group) / peak area of ​​substrate in control group × 100%.

[0132] In vitro enzyme activity assay: Any of the lactam compounds listed in Table 1 (final concentration 1 mM), phenyl acetate (final concentration 1.5 mM), and the MucABC enzyme solution prepared in this example (12 μM) were added to 100 μL of 50 mM potassium phosphate buffer (pH 7.0). After incubating the reaction mixture at 30 °C for 16 h, 100 μL of methanol was added and the mixture was centrifuged at high speed (21,000 × g) for 30 min.

[0133] In vitro enzyme activity test control group: The reaction conditions were different from those of the experimental group, except that the system was filled with inactivated MucABC enzyme solution (12 μM).

[0134] HPLC detection conditions: The mobile phase was water (containing 0.1% trifluoroacetic acid, v / v, phase A) and acetonitrile (containing 0.1% trifluoroacetic acid, v / v, phase B). The mobile phase gradient was: 0-20 min, 5%-100% B; 20-35 min, 100% B; 35-40 min, 5% B. The flow rate was 1 mL / min. Sample analysis and data acquisition were performed using an Agilent 1290 equipped with a Phenomenex Kinetex XB-C18 column (4.6 mm × 100 mm, 2.6 μm). Data were analyzed and processed using Agilent OpenLab CDS ChemStation Edition C.01.07. Acetylated products were identified by quadrupole-time-of-flight high-resolution mass spectrometry (Q-TOF-HRMS). The parameters of the SCIEXTripleTOF 6600 mass spectrometer were set as follows: mass scan range m / z 50-1000; MS scan rate 1.25 s. -1 MS / MS scan rate 1.25s -1 The collision energy was fixed at 30 eV. Ion source parameters were as follows: gas temperature 500℃; curtain gas 35 psi; ion spray voltage 5500 V; ion source gas 1: 50 psi; ion source gas 2: 50 psi; anion mode. Data acquisition and analysis were performed using SCIEX OS software (version 2.0) from SCIEX Corporation.

[0135] II. Experimental Results

[0136] The results are as follows Figure 9 and 10 As shown, MucABC exhibits broad substrate applicability to lactam compounds with different structures. The natural substrate of MucABC, pre-reutericyclin A, has a C10 (containing a double bond) acyl side chain. When the acyl side chain length of the substrate is changed to C2 (S2), C8 (S3), C14 (S4), C18 (S5), or a non-fatty acid side chain (S6), the corresponding acetylation products can be detected. Similarly, when the amino acid branch of the substrate is changed from leucine to alanine (S7), valine (S8), tyrosine (S9), or phenylalanine (S10), the formation of acetylation products can also be detected, indicating that MucABC has a relatively broad substrate applicability as a catalytic tool.

[0137] Experiment 4: Broadness test of MucABC for acyl donors

[0138] I. Experimental Methods

[0139] In this example, a series of acylphenyl esters with different chain lengths were prepared as acyl donors for MucABC (Table 2) to test the donor breadth of MucABC. The conversion rate was calculated by the change in the peak area of ​​the substrate in the experimental group and the control group, i.e., conversion rate = (peak area of ​​substrate in control group - peak area of ​​substrate in experimental group) / peak area of ​​substrate in control group × 100%.

[0140] In vitro enzyme activity assay: Pre-reutericyclin-A (final concentration 1 mM) was added to 50 mM potassium phosphate buffer (pH 7.0) as an acyl acceptor, and any acyl phenyl ester listed in Table 2 (final concentration 1.5 mM) was added as an acyl donor. The prepared MucABC enzyme solution (12 μM) was also added, for a total reaction volume of 100 μL. After incubating the reaction mixture at 30 °C for 16 h, 100 μL of methanol was added, and the mixture was centrifuged at high speed (21,000 × g) for 30 min.

[0141] In vitro enzyme activity test control group: The reaction conditions were different from those of the experimental group, except that the system was filled with inactivated MucABC enzyme solution (12 μM).

[0142] The detection conditions for HPLC and mass spectrometry are the same as above.

[0143] II. Experimental Results

[0144] Most acetyltransferases use acetyl-CoA as their acyl donor, but acetyl-CoA is costly and structurally unstable, hindering the industrial application of acyltransferases. The results of using acylphenyl esters of different chain lengths as acyl donors for MucABC are as follows... Figure 11 and 12 As shown, MucABC can not only be independent of acetyl-CoA as an acyl donor source, but also accept acylphenyl esters of different chain lengths as donors: in addition to phenyl acetate, MucABC can also accept phenyl propionate (P1), phenyl butyrate (P2), phenyl 2-methoxyacetate (P3), phenyl valerate (P4), phenyl 2-ethoxyacetate (P5), phenyl hexanoate (P6), phenyl heptanoate (P7), and phenyl octanoate (P8) as donor sources, indicating that MucABC has great catalytic potential as an acyltransferase.

[0145] The above description, in conjunction with specific embodiments, provides a further detailed explanation of this application and should not be construed as limiting the specific implementation of this application to these descriptions. Those skilled in the art to which this application pertains can make several simple deductions or substitutions without departing from the concept of this application.

Claims

1. A kit for the enzymatic catalysis of a Friedel-Crafts acylation reaction, characterized in that: The application comprises 1) a Friedel-Crafts acylation reaction buffer, and 2) a thiolase complex MucABC or a functional fragment or variant thereof.

2. The kit of claim 1, wherein: The subunit of the thiolase complex MucABC comprises a 3-hydroxy-3-methylglutaryl-CoA synthase, an acetyl-CoA acetyltransferase and a DUF35; Optionally, the pH of the buffer is 6-8; Optionally, the Friedel-Crafts acylation reaction buffer comprises at least one of a potassium phosphate buffer, Tris-HCl and HEPES buffer.

3. Use of a thiolase complex MucABC or a functional fragment or variant thereof in catalyzing a Friedel-Crafts acylation reaction.

4. Use according to claim 3, characterized in that: The Friedel-Crafts acylation reaction comprises C-acylation of an acyl acceptor catalyzed by the thiolase complex MucABC; Optionally, the acyl acceptor comprises a lactam compound; Optionally, the acyl acceptor comprises a lactam compound with a pyrrolidine-2,4-dione skeleton; Optionally, the lactam compound comprises at least one of 1-acetyl-5-isobutylpyrrolidine-2,4-dione, 5-isobutyl-1-octanoylpyrrolidine-2,4-dione, 5-isobutyl-1-tetradecanoylpyrrolidine-2,4-dione, 5-isobutyl-1-stearoylpyrrolidine-2,4-dione, 5-isobutyl-1-(3-phenylpropionyl)pyrrolidine-2,4-dione, (E)-1-(dec-2-enoyl)-5-methylpyrrolidine-2,4-dione, (E)-1-(dec-2-enoyl)-5-isopropylpyrrolidine-2,4-dione, (E)-1-(dec-2-enoyl)-5-(4-hydroxybenzyl)pyrrolidine-2,4-dione, (E)-5-benzyl-1-(dec-2-enoyl)pyrrolidine-2,4-dione, (E)-1-(dec-2-enoyl)-5-isobutylpyrrolidine-2,4-dione. Optionally, the Friedel-Crafts acylation reaction further comprises an acyl donor; Optionally, the acyl donor comprises at least one of acetyl-CoA, ethyl thioacetate, N-acetylimidazole, isopropenyl acetate and acyl phenyl ester; Optionally, the acyl phenyl ester comprises at least one of phenyl acetate, phenyl propionate, phenyl butyrate, phenyl 2-methoxyacetate, phenyl valerate, phenyl 2-ethoxyacetate, phenyl hexanoate, phenyl heptanoate, phenyl octanoate.

5. A method for improving the antibacterial activity of a lactam compound, characterized by: The application comprises C-acylation of the lactam compound catalyzed by the thiolase complex MucABC.

6. The method of claim 5, wherein: The lactam compound comprises (E)-1-(dec-2-enoyl)-5-isobutylpyrrolidine-2,4-dione or a structural analogue thereof; Optionally, the acetyl donor for the C-acylation reaction comprises at least one of acetyl-CoA, ethyl thioacetate, N-acetylimidazole, isopropenyl acetate and acyl phenyl ester; Optionally, the acyl phenyl ester comprises at least one of phenyl acetate, phenyl propionate, phenyl butyrate, phenyl 2-methoxyacetate, phenyl valerate, phenyl 2-ethoxyacetate, phenyl hexanoate, phenyl heptanoate, phenyl octanoate.

7. A method for the enzymatic catalysis of a Friedel-Crafts acylation reaction, characterized in that: The C-acylation modification of the acyl acceptor is catalyzed by a thiolase complex MucABC.

8. The method of claim 7, wherein: The reaction is carried out under mild conditions; Optionally, the temperature of the mild conditions is 18-42℃; Optionally, the mild conditions include a buffer system with pH 6-8; Optionally, the acyl acceptor includes a lactam compound; Optionally, the acyl acceptor includes a lactam compound with a pyrrolidine-2,4-dione skeleton; Optionally, the lactam compound includes at least one of 1-acetyl-5-isobutylpyrrolidine-2,4-dione, 5-isobutyl-1-octanoylpyrrolidine-2,4-dione, 5-isobutyl-1-tetradecanoylpyrrolidine-2,4-dione, 5-isobutyl-1-stearoylpyrrolidine-2,4-dione, 5-isobutyl-1-(3-phenylpropionyl)pyrrolidine-2,4-dione, (E)-1-(dec-2-enoyl)-5-methylpyrrolidine-2,4-dione, (E)-1-(dec-2-enoyl)-5-isopropylpyrrolidine-2,4-dione, (E)-1-(dec-2-enoyl)-5-(4-hydroxybenzyl)pyrrolidine-2,4-dione, (E)-5-benzyl-1-(dec-2-enoyl)pyrrolidine-2,4-dione, (E)-1-(dec-2-enoyl)-5-isobutylpyrrolidine-2,4-dione; Optionally, the acetyl donor for the C-acylation modification is at least one of acetyl-CoA, ethyl thioacetate, N-acetylimidazole, isopropenyl acetate, and acyl phenyl ester; Optionally, the acyl phenyl ester includes at least one of phenyl acetate, phenyl propionate, phenyl butyrate, phenyl 2-methoxyacetate, phenyl valerate, phenyl 2-ethoxyacetate, phenyl hexanoate, phenyl heptanoate, and phenyl octanoate.

9. A method for preparing the sulpholysis enzyme complex MucABC, characterized by: The protein expression of the host cell is induced to obtain the thiolase complex MucABC; The host cell contains a nucleic acid sequence for expressing the thiolase complex MucABC.

10. The method of claim 9, wherein: The protein is further purified after the protein expression; Optionally, the purification includes at least one of precipitation, chromatography, electrophoresis, centrifugation, dialysis, ultrafiltration, two-liquid extraction, and high-performance liquid chromatography; Optionally, the precipitation includes at least one of salting-out precipitation, isoelectric point precipitation, and organic solvent precipitation; Optionally, the chromatography includes at least one of ion exchange chromatography, molecular sieve filtration chromatography, affinity chromatography, and hydrophobic chromatography; Optionally, the electrophoresis includes at least one of SDS-PAGE electrophoresis and isoelectric focusing electrophoresis; Optionally, the host cell contains a recombinant expression vector, and the recombinant expression vector is constructed with the nucleic acid sequence for expressing the thiolase complex MucABC; Optionally, the host includes at least one of a eukaryotic expression host and a prokaryotic expression host; Optionally, the eukaryotic expression host includes at least one of a yeast system, an insect cell, a mammalian cell, and a plant cell; Optionally, the prokaryotic expression host includes at least one of Escherichia coli, Bacillus subtilis, Lactobacillus, Streptomyces, and Agrobacterium. Optionally, the nucleic acid sequence comprises a mucABC sequence. Optionally, the mucABC sequence comprises a mucA sequence expressing a MucA subunit, a mucB sequence expressing a MucB subunit, and a mucC sequence expressing a MucC subunit. Optionally, the mucA sequence is the sequence shown in Seq ID No. 1, the mucB sequence is the sequence shown in Seq ID No. 2, and the mucC sequence is the sequence shown in Seq ID No.

3. Optionally, the recombinant expression vector comprises at least one of a eukaryotic expression vector and a prokaryotic expression vector. Optionally, the eukaryotic expression vector comprises at least one of a yeast expression vector, an insect cell vector, and a mammalian cell vector. Optionally, the prokaryotic expression vector comprises at least one of a pET series vector, a pGEX series vector, a pBAD series vector, a pMAL series vector, a Duet series vector, and an ASKIBIO series vector. Optionally, the recombinant expression vector comprises pACYCDuet-1 or pASKIBA3plus. Optionally, the recombinant expression vector comprises at least one of the following schemes for the design of the sequences of the promoter and the affinity tag: 1) using pACYCDuet-1 as the expression vector, the inserted sequence comprises, in order from the 5' end to the 3' end, a promoter sequence, an RBS sequence, an affinity tag sequence, a mucA sequence, an RBS sequence, a mucB sequence, an RBS sequence, and a mucC sequence; 2) using pACYCDuet-1 as the expression vector, the inserted sequence comprises, in order from the 5' end to the 3' end, a promoter sequence, an RBS sequence, a mucA sequence, a promoter sequence, an RBS sequence, a mucB sequence, an affinity tag sequence, an RBS sequence, and a mucC sequence; 3) using pACYCDuet-1 as the expression vector, the inserted sequence comprises, in order from the 5' end to the 3' end, a promoter sequence, an RBS sequence, a mucA sequence, an RBS sequence, a mucC sequence, a promoter sequence, an RBS sequence, a mucB sequence, and an affinity tag sequence; 4) using pACYCDuet-1 as the expression vector, the inserted sequence comprises, in order from the 5' end to the 3' end, a promoter sequence, an RBS sequence, a mucA sequence, a promoter sequence, an RBS sequence, a mucB sequence, an RBS sequence, a mucC sequence, and an affinity tag sequence; 5) using pASKIBA3plus as the expression vector, the inserted sequence comprises, in order from the 5' end to the 3' end, a promoter sequence, an RBS sequence, a mucA sequence, an RBS sequence, a mucB sequence, an RBS sequence, a mucC sequence, and an affinity tag sequence. Optionally, the affinity tag sequence comprises at least one of His6, GAT, MBP, FLAG, HA, and Myc.