Preparation method and application of active medicinal and edible composite nutrient

By preparing active medicinal and edible compound nutrients, the bioactive components of Ganoderma lucidum, Polygonatum sibiricum, and mulberry leaves are decomposed into small molecules, which solves the problem of poor intestinal absorption of traditional materials. This achieves the simultaneous enhancement of the recovery of neutrophils, macrophages, and T cells and the immune function, and has the characteristics of high safety.

CN121445819APending Publication Date: 2026-02-03HANGZHOU RUILIN FOOD TECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511514788.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-22
Publication Date
2026-02-03

AI Technical Summary

Technical Problem

Traditional medicinal and edible materials such as Ganoderma lucidum, Polygonatum sibiricum, and mulberry leaves have low oral bioavailability due to their complex macromolecular structures, which limits their immune-regulating effects.

Method used

The large molecular active ingredients were decomposed into small molecules through liquid culture of Ganoderma lucidum monoclonal isolates, quantitative determination of β-glucosidase activity, biotransformation and fermentation with Lactobacillus plantarum, and active medicinal and food homologous compound nutrients were prepared. The 100-mesh granular freeze-dried powder was then formed by freeze-drying.

Benefits of technology

It improves the intestinal absorption of Ganoderma lucidum, Polygonatum sibiricum, and mulberry leaves, restores the number of neutrophils, macrophages, and T cells, and simultaneously restores innate and adaptive immune functions. Moreover, it is a natural source with high safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121445819A_ABST
    Figure CN121445819A_ABST
Patent Text Reader

Abstract

The invention designs a preparation method of an active medicinal and edible composite nutrient, and the method comprises the following steps: carrying out initial culture on a ganoderma lucidum monoclonal isolate through a potato dextrose agar plate, and then transferring the ganoderma lucidum monoclonal isolate to a specific liquid culture medium for shake culture; after detecting that the activity of beta-glucosidase reaches 100 mU / mL, centrifuging to take supernatant, and adding rhizoma polygonati, lucid ganoderma and mulberry leaf powder for biotransformation; and inoculating lactobacillus plantarum, adding a freeze-drying protective additive, freeze-drying, and sieving to obtain the active medicinal and edible composite nutrient. According to the method, macromolecular active components of lucid ganoderma, rhizoma polygonati and folium mori are decomposed into small molecules through biotransformation, the problem that a traditional material is poor in intestinal absorption is solved, the prepared active medicinal and edible composite nutrient can restore the number of neutrophils, macrophages and T cells, meanwhile, tnf-alpha, il-12a and ifn-gamma proinflammatory gene expression is up-regulated, and the effect of improving the intestinal absorption rate is achieved. In addition, the natural source is high in safety, and can be used for an immune function regulation scene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of preparation of food-medicine homology compound nutrients, specifically relating to a method for preparing an active food-medicine homology compound nutrient and its application. Background Technology

[0002] The immune system is crucial for host defense, immune surveillance, and tissue homeostasis. The immune function of cancer patients is often impaired due to the tumor microenvironment or cytotoxic therapies such as chemotherapy and radiotherapy. Immunosuppression in these patients can lead to increased risk of infection, slow recovery, and poor treatment outcomes. Therefore, there is an urgent clinical need for safe and effective drugs to support or restore immune function—ideally, naturally derived ingredients should be chosen to provide both therapeutic benefits and good safety profiles.

[0003] In traditional Chinese medicine theory, certain natural substances are classified according to the principle of "medicine and food sharing the same origin," meaning they can be used as therapeutic drugs and also incorporated into daily diets to promote health and prevent disease. Among them, Ganoderma lucidum, Polygonatum sibiricum, and mulberry leaves have a long history of use in East Asian medicine due to their immune-enhancing properties. These natural substances are rich in bioactive components such as polysaccharides, flavonoids, and glycoproteins, and have been proven to regulate immune responses, reduce inflammation, and provide antioxidant protection.

[0004] However, these natural materials often contain large, complex molecules that are difficult for the human body to absorb effectively. For example, Ganoderma lucidum (reishi mushroom) is encased in a hard spore shell in its original form and must be broken down to release its bioactive components. Polygonatum sibiricum (Huang Jing) and mulberry leaves, as traditional medicinal plants, are rich in polysaccharides, flavonoids, and other bioactive substances. However, due to the presence of high-molecular-weight polysaccharides, glycosylated flavonoids, and poor lipophilicity, their oral bioavailability is limited, which hinders intestinal absorption. Summary of the Invention

[0005] To address the limitations of traditional medicinal and edible materials such as Ganoderma lucidum, Polygonatum sibiricum, and mulberry leaves due to their complex macromolecular structures, low oral bioavailability, and restricted immune-regulating effects, this application presents a method for preparing and applying an active medicinal and edible compound nutrient, aiming to enhance the absorption of Ganoderma lucidum, Polygonatum sibiricum, and mulberry leaves when used to boost immunity.

[0006] A method for preparing an active food-medicine homology compound nutrient includes the following steps: Step S1, Initial culture of Ganoderma lucidum monoclonal isolates: First, Ganoderma lucidum monoclonal isolates were cultured on potato dextrose agar plates, and then the agar blocks containing actively growing mycelia were transferred to liquid culture medium for culture. Step S2: Place the liquid culture obtained in step S1 into an Erlenmeyer flask and culture it with shaking in the dark at 30°C. Step S3, using a β-glucosidase detection kit to quantitatively determine the β-glucosidase activity of the culture of step S2; when the enzyme activity exceeds 100 mU / mL, centrifuge the culture and collect the supernatant; Step S4, supplementing 1.5% w / v Huangjing powder, 1.5% w / v Lingzhi powder and 1.5% w / v mulberry leaf powder to the supernatant collected in step S3; oscillating culture for 24 hours for biotransformation; Step S5, collecting the supernatant after centrifuging the culture liquid after biotransformation in step S4; Step S6, inoculating Lactobacillus plantarum into the supernatant collected in step S5, so that the final concentration of Lactobacillus plantarum reaches 1×10 7 CFU / mL, to obtain an active pharmafood complex nutrient precursor; Step S7, adding a freeze-drying protective agent: adding 10% w / v malt dextrin, 10% w / v mannitol and 2% w / v D-(+) trehalose dihydrate to the active pharmafood complex nutrient precursor of step S6, and stirring thoroughly until uniformly dispersed; Step S8, freeze-drying the mixture of step S7 using a laboratory freeze-drying machine until a constant weight is reached, and ensuring that the freeze-dried powder is uniform and free of polysaccharide precipitation; grinding and sieving to 100 mesh particle size to obtain an active pharmafood complex nutrient.

[0007] Preferably, in step S1, the liquid culture medium comprises the following ingredients: 40 g / L D-glucose, 5 g / L peptone, 5 g / L yeast extract, 0.46 g / L potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate heptahydrate.

[0008] Preferably, in step S2, the dark environment of the oscillating culture needs to be kept free of light interference throughout the process, and the rotation speed of the oscillating culture is 100 revolutions per minute.

[0009] Preferably, in step S3, the quantitative determination of β-glucosidase activity needs to be completed within 1 hour after sampling the culture.

[0010] Preferably, in step S4, the Huangjing powder, Lingzhi powder and mulberry leaf powder all need to be sieved through an 80-mesh sieve before being added to the supernatant.

[0011] Preferably, in step S6, the Lactobacillus plantarum needs to be activated and cultured to the logarithmic growth phase in MRS medium before inoculation.

[0012] Preferably, in step S8, the pre-freezing temperature of the freeze-drying is -40°C, and the pre-freezing time is 4 hours.

[0013] An active pharmaconutritional product is a 100 mesh granular lyophilized powder comprising bio-transformed rhizoma polygonati saponins, ganoderma lucidum polysaccharides, mulberry leaf flavonoids active ingredients, and a final concentration of 1x10 7 CFU / mL of Vege-start 60 strain Lactobacillus plantarum.

[0014] An active pharmaconutritional product for use in the preparation of a medicament for increasing the number of neutrophils and for use in the preparation of a medicament for increasing the number of macrophages.

[0015] An active pharmaconutritional product for use in the preparation of a medicament for increasing the number of T cells; and for use in the preparation of a medicament for proinflammatory genes.

[0016] The advantages and effects of the present application are as follows: The present application designs a preparation method of an active pharmaconutritional product, which comprises: after initial culture of ganoderma lucidum monoclonal isolates on a potato dextrose agar plate, transferring to a specific liquid medium for shaking culture; centrifuging and taking supernatant after detecting that the activity of beta-glucosidase reaches 100 mU / mL, adding rhizoma polygonati, ganoderma lucidum and mulberry leaf powders for bio-transformation; inoculating Lactobacillus plantarum, then adding a lyophilization protective agent for freeze-drying and sieving to obtain the active pharmaconutritional product. The method decomposes macromolecular active ingredients of ganoderma lucidum, rhizoma polygonati and mulberry leaves into small molecules through bio-transformation, solves the problem of poor intestinal absorption of traditional materials, and the prepared active pharmaconutritional product can restore the number of neutrophils, macrophages and T cells, up-regulate the expression of tnf-alpha, il-12a and ifn-gamma proinflammatory genes, synchronously restore innate and adaptive immune functions, and is safe in natural source and can be used in immune function regulation scenarios.

[0017] The above description is only a summary of the technical solutions of the present application, in order to more clearly understand the technical means of the present application, so as to be implemented according to the content of the description, and in order to make the above and other purposes, characteristics and advantages of the present application more obvious and easy to understand, the following will be described in detail with the preferred embodiments of the present application and with the help of the accompanying drawings.

[0018] According to the detailed description of the specific embodiments of the present application in the following combined with the drawings, those skilled in the art will be more clear about the above and other purposes, advantages and characteristics of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, hereinafter, the drawings needed to be used in the embodiments or prior art description will be briefly introduced. Obviously, the drawings in the following description are some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained without creative labor. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the elements or parts are not necessarily drawn according to the actual proportion.

[0020] Figure 1 Figure for the effect of AMCN on neutrophil of zebrafish larvae provided in the present application; Figure 2 Figure for the effect of AMCN on macrophage of zebrafish larvae provided in the present application; Figure 3 Figure for the effect of AMCN on T cell of zebrafish larvae provided in the present application; Figure 4 Figure for the effect of AMCN on the relative expression of tnf-α, il-12a and ifn-γ genes of zebrafish larvae detected by qRT-PCR. DETAILED DESCRIPTION

[0021] In order to make the purpose, technical solutions and advantages of the embodiments of the present application more clear, hereinafter, the technical solutions in the embodiments of the present application will be clearly and completely described with the drawings in the embodiments of the present application. Obviously, the described embodiments are some embodiments of the present application, but not all the embodiments. In the following description, specific details such as specific configurations and components are provided only to help the overall understanding of the embodiments of the present application. Therefore, those skilled in the art should understand that various changes and modifications can be made to the embodiments described herein without departing from the scope and spirit of the present application. In addition, in order to be clear and concise, the description of known functions and structures is omitted in the embodiments.

[0022] It should be understood that the "one embodiment" or "the embodiment" mentioned throughout the specification means that the specific features, structures or characteristics related to the embodiment are included in at least one embodiment of the present application. Therefore, "one embodiment" or "the embodiment" appearing throughout the specification does not necessarily mean the same embodiment. In addition, these specific features, structures or characteristics can be combined in one or more embodiments in any suitable manner.

[0023] In addition, the reference numerals and / or letters can be repeated in different examples in the present application. Such repetition is for the purpose of simplification and clarity, and does not indicate the relationship between the various embodiments and / or arrangements discussed.

[0024] In this article, the term "and / or" is merely a description of the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can mean: A exists alone, B exists alone, and A and B exist simultaneously. The term " / and" in this article describes another type of relationship between related objects, indicating that two relationships can exist. For example, A / and B can mean: A exists alone, and A and B exist alone. In addition, the character " / " in this article generally indicates that the related objects before and after it are in an "or" relationship.

[0025] In this article, the term "at least one" is merely a description of the relationship between related objects, indicating that there can be three relationships. For example, "at least one of A and B" can mean: A exists alone, A and B exist simultaneously, or B exists alone.

[0026] It should also be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion.

[0027] Example 1: This example mainly introduces the specific design of a method for preparing an active food-medicine homology compound nutrient, including: Production of AMCN, a complex nutrient product derived from both food and medicine: Initial culture of Ganoderma lucidum monoclonal isolates was performed using potato dextrose agar plates. Agar blocks containing actively growing mycelia were transferred to a medium containing: 40 g / L D-glucose, 5 g / L peptone, 5 g / L yeast extract, 0.46 g / L potassium dihydrogen phosphate, and 0.5 g / L magnesium sulfate heptahydrate. 25 mL of the liquid culture was placed in a 250 mL Erlenmeyer flask and incubated in the dark at 30°C with shaking at 100 rpm.

[0028] β-glucosidase activity was quantitatively determined using a β-glucosidase assay kit. When the enzyme activity exceeded 100 mU / mL, the culture medium was centrifuged at 5000 rpm for 10 minutes to collect the supernatant. Then, 1.5% (w / v) Polygonatum sibiricum powder, 1.5% (w / v) Ganoderma lucidum powder, and 1.5% (w / v) mulberry leaf powder were added to the supernatant. The mixture was cultured under the same conditions for another 24 hours to promote biotransformation. After biotransformation, the culture medium was centrifuged again at 5000 rpm for 10 minutes. The supernatant was inoculated with Lactobacillus plantarum to a final concentration of 1×10⁻⁶. 7 CFU / mL was used to prepare AMCN. The *Lactobacillus plantarum* strain Vege-start 60 used was a probiotic starter optimized for fermentation.

[0029] Subsequently, 10% (mass / volume) maltodextrin, 10% (mass / volume) mannitol, and 2% (mass / volume) D-(+) trehalose dihydrate were added to the final supernatant as freeze-drying protectants. The mixture was stirred thoroughly for at least one hour to ensure uniform dispersion. After mixing, the solution was freeze-dried using a laboratory freeze dryer until constant weight was achieved. Special care was taken during the process to ensure that the freeze-dried powder was uniform and free of polysaccharide precipitation. All freeze-dried powders were weighed and the weight data were recorded. The powders were then ground and sieved to obtain particles with a particle size of approximately 100 mesh. The final product was named AMCN. The freeze-dried AMCN powder was packaged in 1 kg aluminum foil bags and stored at room temperature, avoiding direct sunlight.

[0030] Example 2: This example mainly introduces the efficacy verification of an active medicinal and edible homologous compound nutrient designed in this application: To evaluate the immunomodulatory potential of active food-medicine homologous compound nutrients, we used a zebrafish immunosuppression model. This model can simulate the hematopoietic dysfunction and immune cell exhaustion commonly seen in cancer patients. Zebrafish, as an important model organism for vertebrate immunology research, has increasingly demonstrated its advantages: it not only possesses a highly conserved hematopoietic pathway and optical transparency in early developmental stages, but also has transgenic strains capable of expressing fluorescent markers in key immune cell populations. The zebrafish immune system includes innate components, such as macrophages and neutrophils, as well as adaptive components, such as T lymphocytes, allowing for comprehensive analysis of in vivo immune responses.

[0031] In this study, we first assessed the in vivo toxicity of AMCN to ensure its safety. Then, using a transgenic zebrafish model, we quantified the changes in macrophages, neutrophils, and T cells after AMCN treatment. Finally, we employed quantitative real-time PCR (qRT-PCR) to analyze immune-related genes, delving into the molecular mechanisms behind these immune-enhancing effects.

[0032] I. Zebrafish rearing and embryo collection The rearing and breeding methods for zebrafish were as described in our previous study. In short, adult zebrafish were housed in a recirculating aquatic system at 28°C, using a 14-hour light / 10-hour dark photocycle, and fed three times daily. At embryo collection, males and females were paired in a 1:1 ratio during the evening and separated by a partition. The partition was removed the following morning to allow spawning to occur within the first hour of the photocycle's commencement. Fertilized larvae were collected and cultured in 1×E3 medium supplemented with methylene blue (0.1%). Samples were incubated at a concentration of 3 ppm in a 28.5°C incubator until use.

[0033] II. Acute Toxicity Assessment Wild-type AB strain zebrafish were reared under standard conditions in aquarium-grade culture medium at 28°C. Embryos were randomly seeded into six-well plates, 30 fish per well, and treated with AMCN at concentrations of 12.5, 25, 50, 4000, 100, 200, and 400 µg / mL.

[0034] All groups were exposed to 20 µg / mL cyclophosphamide for 48 hours to induce immunosuppression, except for the normal control group (untreated). All groups were cultured at 28°C for 72 hours. Embryo mortality was recorded daily, and dead embryos were immediately removed to prevent the effects of decomposition.

[0035] III. Assessment of Immunomodulatory Activity 1. Neutrophil Count Analysis in Zebrafish Model Myeloperoxidase (MPO) is a well-known neutrophil marker in zebrafish. Transgenic zebrafish (MPO:EGFP) is a transgenic strain that expresses enhanced green fluorescent protein (EGFP) via the MPO promoter, enabling specific labeling and in vivo visualization of neutrophils. Two-day-old transgenic zebrafish larvae were randomly aliquoted into 6-well plates (30 larvae per well) and treated with AMCN at concentrations of 12.5, 25, and 50 μg / mL. The experiment consisted of three groups: a normal control group, a model group, and a treatment group. Except for the normal control group, all other groups received cyclophosphamide treatment at 20 μg / mL to induce immunosuppression. All treatments were maintained at a constant temperature of 28°C for 48 hours. After treatment, 10 larvae were randomly selected from each group for imaging under a fluorescence microscope. The number of neutrophils in the tail vein was quantitatively analyzed using NIS-Elements software.

[0036] 2. Macrophage level analysis in zebrafish model Macrophage-specific gene 1 (mpeg1) is unique to zebrafish. Transgenic zebrafish strains (mpeg1:EGFP) express EGFP via the mpeg1 promoter, enabling specific visualization of macrophages in vivo. Thirty two-day-old transgenic (mpeg1:EGFP) zebrafish larvae were randomly grouped under the same conditions described above. Following a predetermined treatment protocol, the larvae were exposed to AMCN solutions at concentrations of 12.5, 25, and 50 μg / mL, with or without cyclophosphamide, and then cultured at 28°C for 48 hours. Ten larvae from each group were then subjected to microscopic imaging using an MZX81 fluorescence microscope. The fluorescence intensity of tail vein macrophages was quantitatively analyzed using NIS-Elements software.

[0037] 3. Analysis of T cell levels in a zebrafish model Recombinant activator gene 2 (rag2) is a well-known T lymphocyte-specific marker in the thymus, highly conserved in vertebrates such as mice, humans, and zebrafish. Tg(rag2:dsRed) zebrafish is a transgenic strain whose rag2 promoter drives the expression of discoid red fluorescent protein (dsRed), enabling specific detection of lymphoid progenitor cells (especially thymic T cells). In this experiment, 30 Tg(rag2:dsRed) zebrafish (2 days old) were randomly divided into groups and placed in 6-well plates. Each group was treated with different concentrations of AMCN (12.5, 25, and 50 μg / mL) under the same conditions, with or without cyclophosphamide added as described above. After incubation at 28°C for 48 hours, 10 juvenile fish from each group were selected for further observation.

[0038] Randomly selected cells were used for imaging, and the fluorescence intensity levels of T cells in the tail vein were quantified using NIS-Elements software.

[0039] 4. Gene expression analysis This study used transgenic zebrafish larvae (2 days old) with green fluorescent neutrophils for immunogene expression detection. The experimental procedures were as described in Section 3.1. After culturing the larvae at 28°C for 48 hours, total RNA was extracted from each group of larvae using the RNeasy universal RNA extraction kit according to the manufacturer's instructions. RNA concentration and purity were measured using a UV-Vis spectrophotometer. 2 μg of RNA samples were used for reverse transcription using a first-strand cDNA synthesis kit, with a final reaction volume of 20.0 μL. The relative expression levels of pro-inflammatory genes tumor necrosis factor-α (TNF-α), interleukin-12α (IL-12A), and interferon-γ (IFN-γ) were detected using quantitative real-time PCR (qRT-PCR), with β-actin as an internal control. All experiments were performed in triplicate. Detailed primer information is shown in Table 1.

[0040] Table 1. Primer sequences used in qPCR Gene primer sequences (5' to 3') β-actin-prothymine-guanine-glutamine-guanine-glutamine-guanine-glutamine-guanine Reverse CTCGTGGATACCGCAAGATTC tnf-α exGCGCTTTTCTGAATCCTACG Reverse TGCCCAGTCTGTCTCCTTCT il-12α exAACTCCTACAAGCCCAGCAC Reverse ACTACCGTGTGTGTCAAACGAA Ifn-γ pre-CTTTCCAGGCAAGTGCAGA Reverse thymine-guanine-cytosine-adenine-guanine-cytosine-thymine-cytosine 5. Statistical Analysis This study used one-way ANOVA combined with Dunnett's post-hoc test to statistically compare the normal control group, the AMCN treatment group, and the model group. All quantitative data are expressed as mean ± standard error (SE). Data analysis was performed blinded using GraphPadPrism software, and the statistical significance criterion was p-value < 0.05.

[0041] 6. Results (1) AMCN increases the number of neutrophils in zebrafish models. To determine whether AMCN modulates the immune system in our immunodeficient zebrafish model, we first examined its effects on neutrophils—key effectors of innate immunity. Immunization – using Tg (mpo:EGFP) larvae. Please refer to [reference needed]. Figure 1 , Figure 1 The effect of AMCN on neutrophil count in zebrafish larvae. Figure 1 (A) Representative image of Tg(mpo:EGFP) zebrafish larvae (4 days later) after AMCN treatment for 48 hours. The white dashed area indicates the region used for quantitative analysis. Scale bar = 100µm. Figure 1 (B) Quantitative analysis of tail vein neutrophil count. Data are expressed as mean ± standard deviation (n=10 per group). Compared with the model group, p<0.01, p < 0.001 (one-way ANOVA combined with Dunnett's post-hoc test). Compared with the normal control group, the number of neutrophils in the model group was reduced by ~30% ( Figure 1 The A&B study confirmed the successful establishment of the immunodeficiency model. Notably, AMCN treatment increased the number of neutrophils by ~14% relative to the model group.

[0042] (2) AMCN increases the number of macrophages in zebrafish models. Next, we used Tg(mpeg1:EGFP) transgenic zebrafish larvae to evaluate the effects of AMCN on macrophages. Macrophages are another key cell type in zebrafish responsible for phagocytizing cellular debris. Please refer to [link to relevant documentation]. Figure 2 , Figure 2 The effect of AMCN on macrophage levels in zebrafish larvae. Figure 2(A) Representative image of Tg (mpeg1:EGFP) zebrafish larvae (4 days later) after AMCN treatment for 48 hours. The white dashed area indicates the region used for quantitative analysis. Scale bar = 100µm. Figure 2 (B) Quantitative analysis of macrophage levels was performed using tail vein fluorescence intensity. Data are presented as mean ± standard deviation (n=10 per group), compared with the model group. p<0.001, p < 0.0001 (one-way ANOVA combined with Dunnett's post-hoc test). The highest number of macrophages was observed in the normal control group, reflecting the baseline level in zebrafish larvae. Figure 2 (A&B). Compared to the normal control group, the number of macrophages in the model group was reduced by ~54%. Notably, AMCN treatment significantly restored the number of macrophages, increasing it by ~57% relative to the model group.

[0043] (3) AMCN increases the level of T cells in zebrafish models. Next, we used Tg(rag2:dsRed) zebrafish larvae to study the effect of AMCN on T cells. Because T cells in the thymus are densely aggregated, it is impossible to accurately count the number of individual cells; therefore, fluorescence intensity was used as a surrogate indicator of T cell abundance. Please refer to [reference needed]. Figure 3 , Figure 3 The effect of AMCN on T cell levels in zebrafish larvae. Figure 3 (A) Representative image of 4-day-old Tg(rag2:dsR-ed) zebrafish larvae after 48 hours of AMCN treatment. The white dashed line area represents the thymus quantitative analysis area. Scale bar = 100µm. Figure 3 (B) Quantitative analysis of fluorescence intensity at the thymic T cell level. Data are expressed as mean ± standard deviation (n=10 per group). Compared with the model group, p<0.01, p<0.0001 (one-way ANOVA combined with Dunnett's post-hoc test).

[0044] Compared with the normal control group, the fluorescence intensity of the thymus in the model group decreased by ~45%, indicating a significant reduction in the number of T cells. Notably, AMCN treatment significantly increased the fluorescence intensity of the model group by 61%, indicating an effective recovery of the T cell population.

[0045] (4) AMCN increases pro-inflammatory genes in zebrafish models Given that AMCN treatment can increase the levels of key immune cell types in a zebrafish model, we further investigated the mechanism by which AMCN affects the immune system by evaluating several pro-inflammatory cytokine genes known to be involved in regulating innate immunity—namely TNF-α, IL-12A, and IFN-γ.

[0046] Please refer to Figure 4 , Figure 4 To detect the effect of AMCN on the relative expression of tnf-α, il-12a, and ifn-γ genes in zebrafish larvae by qRT-PCR. Data are presented as mean ± standard deviation (n=3 per group). p<0.05, p<0.01, p<0.001, p < 0.0001 compared to the model group (one-way ANOVA combined with Dunnett's post-hoc test). Our qRT-PCR showed that, compared with the normal control group, tnf-α expression was significantly reduced in the model group, while AMCN treatment significantly increased tnf-α expression. Figure 4 (Left figure) Similar to TNF-α, the expression levels of IL-12A and IFN-γ in the model group were also significantly lower than those in the normal control group. AMCN treatment resulted in a statistically significant increase in the expression levels of these genes. Figure 4 (Middle and right figures). These findings indicate that AMCN can effectively improve the immune function of a zebrafish model by enhancing the expression of key pro-inflammatory cytokine genes.

[0047] In an immunodeficient zebrafish model, this study investigated the immunomodulatory effects of AMCN, a complex nutrient derived from the biotransformation of Ganoderma lucidum, Polygonatum sibiricum, and mulberry leaf. The results of this application provide strong evidence that AMCN promotes the recovery of both innate and adaptive immune function by restoring the function of neutrophil, macrophage, and T cell populations, while simultaneously enhancing the expression of key pro-inflammatory cytokine genes, including tumor necrosis factor-α (TNF-α), interleukin-12a (IL-12a), and interferon-γ (IFN-γ). These findings highlight the significant potential of AMCN as a natural medicine to effectively combat immunosuppression—a common and clinically significant complication prevalent in cancer and other chronic diseases.

[0048] Neutrophils and macrophages, among other innate immune cells, form the first line of defense against pathogens, clearing cellular debris and regulating adaptive immune responses through signal transduction. In our constructed immunodeficient zebrafish model, the numbers of these two cell types were significantly reduced, which is highly consistent with immunosuppression. After AMCN treatment, the numbers of both cell types significantly rebounded, indicating that the drug can effectively restore innate immune function. Neutrophils are crucial for acute antibacterial defense, and their sharp decline is significantly associated with an increased risk of infection during chemotherapy in cancer patients. By partially restoring neutrophil levels, AMCN may help alleviate complications related to neutropenia. Similarly, the involvement of macrophages in tissue repair and antigen presentation demonstrates AMCN's ability to restore macrophage function.

[0049] This study demonstrates that AMCN plays a broader role in maintaining immune homeostasis and promoting immune recovery after cytotoxic stress.

[0050] The simultaneous increase in TNF-α and IL-12a expression levels further supports this explanation. TNF-α, produced by cells such as activated macrophages, can promote inflammatory responses, enhance phagocytic function, and recruit more immune effector factors. IL-12a, as a key cytokine connecting innate and adaptive immunity, can drive the differentiation of naive T cells into Th1 effector cells. The upregulation of these cytokines by AMCN indicates that their immunostimulatory effects are not limited to the restoration of cell numbers but also extend to the functional activation of innate immune pathways.

[0051] The adaptive immune system, particularly T cells, plays a central role in long-term immune protection and anti-tumor surveillance. In our zebrafish model, the number of thymic T cells was significantly reduced under immunodeficient conditions, consistent with impaired adaptive immune function. Notably, AMCN treatment successfully restored T cell levels—a phenomenon strongly supported by the significantly enhanced thymic fluorescence intensity observed in transgenic (rag2:dsRed) juvenile fish. This finding is noteworthy because adaptive immune recovery is typically slower and less complete than innate immune recovery in immunocompromised states such as after chemotherapy or transplantation.

[0052] The increased expression level of interferon-γ (IFN-γ) provides further support for this mechanism. As an immune factor mainly secreted by T cells and natural killer cells, IFN-γ not only enhances antigen presentation and activates macrophages, but also participates in antiviral and antitumor defense mechanisms. Elevated IFN-γ levels were detected in AMCN-treated zebrafish, indicating that this treatment not only restores the number of T cells but may also enhance their functional activity. Taken together, these results suggest that AMCN exerts its immunomodulatory effects by regulating the synergistic effect of innate and adaptive immune systems, a characteristic that is of significant value in aiding the recovery of immunodeficient patients.

[0053] A notable feature of AMCN is its use of biotransformation to process Ganoderma lucidum, Polygonatum sibiricum, and mulberry leaves. These natural... The materials themselves are rich in bioactive components, but due to their high molecular weight and complex glycosylation structure, they often suffer from low oral bioavailability. Through microbial or enzymatic biotransformation processes, large molecules can be broken down into more easily absorbed metabolites, and sometimes new compounds with enhanced pharmacological activity can be generated. Previous studies have shown that biotransformed Ganoderma lucidum polysaccharides exhibit stronger immunostimulatory and antitumor effects compared to unprocessed raw materials. Similarly, flavonoid metabolites produced from the fermentation of mulberry leaves and Polygonatum sibiricum have also shown superior antioxidant and immune-supporting activities. Our study found that AMCN, with these advantages, outperforms the expected effects of unprocessed raw materials in immune repair.

[0054] Immunosuppression remains a major obstacle in cancer treatment. Chemotherapy-induced neutropenia, lymphopenia, and immune failure increase the risk of infection, delay recovery, and reduce the response to immunotherapy. Current clinical interventions for immunosuppression, such as granulocyte colony-stimulating factor (G-CSF) or cytokine therapy, while showing significant efficacy, are accompanied by high costs and side effects such as bone pain, fatigue, and excessive inflammatory responses. Nutritional immunomodulators derived from food-grade substances (such as AMCN) offer a safer and more accessible adjuvant therapy option for susceptible patient populations. These preparations, possessing both food and drug properties, make them an ideal choice for cancer survivors and elderly patients requiring long-term medication—in which safety and tolerability remain paramount considerations.

[0055] The above description is merely a preferred embodiment of the present invention and does not limit the scope of protection of the present invention. For those skilled in the art, the present invention can have various modifications and variations. Any changes, modifications, substitutions, integrations, and parameter alterations to these embodiments within the spirit and principles of the present invention, achieved through conventional substitutions or by achieving the same function without departing from the principles and spirit of the present invention, fall within the scope of protection of the present invention.

Claims

1. A method for preparing an active medicinal and edible homologous compound nutrient, characterized in that, Includes the following steps: Step S1, Initial culture of Ganoderma lucidum monoclonal isolates: First, Ganoderma lucidum monoclonal isolates were cultured on potato dextrose agar plates, and then the agar blocks containing actively growing mycelia were transferred to liquid culture medium for culture. Step S2: Place the liquid culture obtained in step S1 into an Erlenmeyer flask and culture it with shaking in the dark at 30°C. Step S3: Quantitatively determine the β-glucosidase activity of the culture from step S2 using a β-glucosidase assay kit; when the enzyme activity exceeds 100 mU / mL, centrifuge the culture and collect the supernatant. Step S4: Add 1.5% w / v Polygonatum sibiricum powder, 1.5% w / v Ganoderma lucidum powder and 1.5% w / v mulberry leaf powder to the supernatant collected in step S3; shake and culture for 24 hours to carry out biotransformation; Step S5: Centrifuge the culture medium after biotransformation in step S4 and collect the supernatant; Step S6: Inoculate the supernatant collected in step S5 with *Lactobacillus plantarum* to achieve a final concentration of 1 × 10⁻⁶. 7 CFU / mL was used to obtain an active precursor of food-medicine homology complex nutrients; Step S7: Add freeze-drying protectant: Add 10% w / v maltodextrin, 10% w / v mannitol and 2% w / v D-(+) trehalose dihydrate to the active food and medicine homology compound nutrient precursor in step S6, and stir thoroughly until evenly dispersed. Step S8: The mixture from step S7 is freeze-dried using a laboratory freeze dryer until constant weight is achieved, ensuring that the freeze-dried powder is uniform and free of polysaccharide precipitation; then it is ground and sieved to a particle size of 100 mesh to obtain the active medicinal and edible compound nutrients.

2. The method for preparing the active medicinal and edible homologous compound nutrient according to claim 1, characterized in that, In step S1, the liquid culture medium contains the following components: 40 g / L D-glucose, 5 g / L peptone, 5 g / L yeast extract, 0.46 g / L potassium dihydrogen phosphate, and 0.5 g / L magnesium sulfate heptahydrate.

3. The method for preparing the active medicinal and edible homologous compound nutrient according to claim 1 or 2, characterized in that, In step S2, the dark environment for the oscillation culture must be kept completely free from light interference, and the rotation speed of the oscillation culture is 100 rpm.

4. The method for preparing the active medicinal and edible homologous compound nutrient according to claim 1, characterized in that, In step S3, the quantitative determination of β-glucosidase activity must be completed within 1 hour after the culture is sampled.

5. The method for preparing the active medicinal and edible homologous compound nutrient according to claim 1, characterized in that, In step S4, the Polygonatum powder, Ganoderma powder, and mulberry leaf powder must all be passed through an 80-mesh sieve before being added to the supernatant.

6. The method for preparing the active medicinal and edible homologous compound nutrient according to claim 1, characterized in that, In step S6, the *Lactobacillus plantarum* needs to be activated and cultured in MRS medium to the logarithmic growth phase before inoculation.

7. The method for preparing the active medicinal and edible homologous compound nutrient according to claim 1, characterized in that, In step S8, the pre-freezing temperature for freeze drying is -40°C, and the pre-freezing time is 4 hours.

8. An active medicinal and edible homologous compound nutrient product prepared by the method according to any one of claims 1 to 7, characterized in that, The active medicinal and edible compound nutrient product is a 100-mesh granular freeze-dried powder containing biotransformed active ingredients such as Polygonatum saponins, Ganoderma lucidum polysaccharides, and mulberry leaf flavonoids, with a final concentration of 1×10⁻⁶. 7 CFU / mL of Vege-start60 strain of Lactobacillus plantarum.

9. An active medicinal and edible homologous compound nutrient product prepared by the method according to any one of claims 1 to 7, characterized in that, Drugs for preparing drugs that increase the number of neutrophils and drugs for preparing drugs that increase the number of macrophages.

10. An active medicinal and edible homologous compound nutrient product prepared by the method according to any one of claims 1 to 7, characterized in that, Drugs for preparing drugs that increase the number of T cells; and drugs for preparing pro-inflammatory genes.