Cucumis sativus and application thereof in identification of root rot of angelica sinensis

Abstract

The invention provides plectosphaerella cucumerina and application of the plectosphaerella cucumerina in identification of root rot of angelica sinensis, the taxonomic name of the plectosphaerella cucumerina is plectosphaerella cucumerina, the strain number of the plectosphaerella cucumerina is DTYP001, and the preservation number of the plectosphaerella cucumerina is CGMCC No. 42271. The invention further provides a preparation method of the plectosphaerella cucumerina. According to the application disclosed by the invention, a strain of fungus, namely, plectosphaerella cucumerina, is separated from the root of angelica sinensis, and the plectosphaerella cucumerina is identified as plectosphaerella cucumerina through combination of morphology and molecular biology. A pathogenic bacterium tieback experiment, namely the Koch's law, verifies the attribute that the brachythecium cucumerinum DTYP001 is the angelica sinensis root rot pathogenic bacterium (brachythecium cucumerinum); the strain (fusarium solani DTYP001) is used as a reference substance to be applied to angelica root rot disease identification, a key technical scheme is finally provided for solving the problems that angelica root rot pathogenic bacteria cannot be clearly identified, diagnosis methods are deficient, and prevention and treatment are lack of basic support, the research blank in the field is filled, and the application prospect is wide. A core foundation is laid for scientific diagnosis and effective prevention and treatment of the angelica sinensis root rot.

Description

Technical Field

[0001] This application relates to the field of pathogenic microorganism technology, and in particular to Cucumber Flocculation Fungus and its application in the identification of Angelica sinensis root rot. Background Technology

[0002] Angelica sinensis ( Angelica sinensis Angelica sinensis (Dang Gui) is a medicinal plant belonging to the Apiaceae family. Its roots are used in traditional Chinese medicine for their blood-tonifying and blood-activating effects. It is known as "nine out of ten prescriptions contain Angelica sinensis." This plant is rich in nutrients, with its main medicinal components including volatile oils, polysaccharides, amino acids, and other volatile substances. In my country, Gansu Province is the main cultivation area for Angelica sinensis, accounting for approximately 65% ​​of the national total cultivation area and producing over 90% of the national output. Therefore, developing a healthy Angelica sinensis industry plays a vital role in promoting industrial restructuring, revitalizing county economies, and helping farmers become wealthy.

[0003] In recent years, with the continuous advancement of the modernization strategy for traditional Chinese medicine, the planting scale of angelica has continued to expand, and market demand has also increased year by year. However, angelica production still faces a series of challenges, including the frequent occurrence of biological diseases such as root rot and root rot, severe continuous cropping obstacles, and imperfect seed and seedling quality standards. These factors restrict the further development of the angelica industry. In particular, root rot and root rot have a significant impact on angelica production, not only leading to a substantial reduction in yield but also causing significant economic losses, and have become key factors limiting the yield and quality of angelica.

[0004] Fusarium ( Fusarium Fusarium trifidum is considered a pathogen causing root rot in many crops. Regarding root rot in Angelica sinensis, the team led by Wang Ruoyu at the Northwest Institute of Eco-Environment and Resources, Chinese Academy of Sciences, conducted a large-scale disease survey and sampling in the main Angelica sinensis planting areas of Gansu Province. They isolated, identified, and verified the pathogenicity of the main pathogen causing root rot in Angelica sinensis from diseased soil and root rot tissue. Their article identifies Fusarium trifidum as the pathogen causing root rot in Angelica sinensis. Fusarium tricinctu Currently, scientific research on Angelica root rot and its pathogen is severely lacking, and there are no reports of Angelica root rot caused by Cucurbita cucumeroides. Summary of the Invention

[0005] In view of this, the purpose of this application is to provide Cucumber Coccidioides and its application in the identification of Angelica sinensis root rot, so as to solve the problem that there are no reports in the prior art on Angelica sinensis root rot caused by Cucumber Coccidioides.

[0006] The technical solution adopted in this application to solve the above-mentioned technical problems is as follows: Embodiments of the present invention provide *Cucumber Coccidioides*, the taxonomic name of which is *Cucumber Coccidioides* (…). Plectosphaerella cucumerinaThe strain number of the Cucumber Scale Bacterium is DTYP001, and the preservation number is CGMCC No. 42271.

[0007] In some embodiments, the cucumber coccidioidomyces ( Plectosphaerella cucumerina The ITS sequence of DTYP001 is shown in the sequence list SEQ ID No:5.

[0008] In some embodiments, the cucumber coccidioidomyces ( Plectosphaerella cucumerina The NL sequence of DTYP001 is shown in SEQ ID No:6.

[0009] In some embodiments, the cucumber coccidioidomyces ( Plectosphaerella cucumerina DTYP001 comes from the roots of plants infected with root rot disease in Angelica sinensis.

[0010] Accordingly, embodiments of the present invention provide the application of the above-described Cucumber Flocculation Mycorrhizae as a control in the identification of Angelica sinensis root rot disease.

[0011] In some embodiments, *Cyclocarya cucumeroides* is used as a control, and the concentration of its spore suspension is 4 × 10⁻⁶. 6 per mL.

[0012] This application isolated a fungus, *Cyclocarya cucumeris*, from the root of *Angelica sinensis*, and identified it through morphological and molecular biological methods. It was identified as Cucumber Scale ( Plectosphaerella cucumerina The strain, identified as DTYP001, was identified as having the preservation number CGMCC No. 42271. The pathogen was confirmed to be *Cyclocarya cucumeroides* through a pathogen re-inoculation experiment—Koch's postulates. Plectosphaerella cucumerina DTYP001 is the pathogen causing root rot of Angelica sinensis (Cucumber spores). Plectosphaerella cucumerina )) attributes.

[0013] This application is the first to isolate and verify *Cyclocarya cucumeroides* (strain DTYP001) from the root of *Angelica sinensis*, thus clarifying the pathogenic source of the disease. This fills a gap in current diagnostic methods for *Angelica sinensis* root rot, improving diagnostic efficiency and accuracy.

[0014] The strain of this application (Cucumber Glomerella) Plectosphaerella cucumerina DTYP001 was used as a reference standard in the identification of Angelica sinensis root rot disease. Ultimately, it provides a key technical solution to solve the problems of unclear identification of pathogens causing Angelica sinensis root rot, lack of diagnostic methods, and lack of basic support for prevention and control. It fills the research gap in this field and lays the core foundation for the scientific diagnosis and effective prevention and control of Angelica sinensis root rot. Attached Figure Description

[0015] To more clearly illustrate the technical solutions of the embodiments of this application, the accompanying drawings of the embodiments will be briefly described below. Obviously, the drawings described below only relate to some embodiments of this application and are not intended to limit this application, wherein: Figure 1 This is a field symptom diagram of root rot of Angelica sinensis in this application; Figure 2 The growth status of strain DTYP001 of this application on PDA medium; Figure 3 This is a diagram verifying Koch's law for this application; Figure 4 Image of the conidia of strain DTYP001 of this application; Figure 5 This is a multigene phylogenetic tree diagram of strain DTYP001 of this application; Figure 6 This is a scanning electron microscope image of the pathogen DTYP001 invading the root system of Angelica sinensis. Detailed Implementation

[0016] The technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, and not all embodiments. Based on the embodiments of this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application. Furthermore, it should be understood that the specific embodiments described herein are only for illustration and explanation of this application and are not intended to limit this application.

[0017] In this application, "and / or" describes the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can represent: A existing alone, A and B existing simultaneously, or B existing alone. A and B can be singular or plural.

[0018] In this application, "at least one" means one or more, and "more than one" means two or more. "One or more", "at least one of the following", or similar expressions refer to any combination of these items, including any combination of single or multiple items. For example, "at least one of a, b, or c", or "at least one of a, b, and c" can both mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, and c can be single or multiple.

[0019] Various embodiments of this application may exist in the form of a range; it should be understood that the description in the form of a range is merely for convenience and brevity and should not be construed as a hard limitation on the scope of this application; therefore, it should be considered that the range description has specifically disclosed all possible sub-ranges and single numerical values ​​within that range. For example, it should be considered that the range description from 1 to 6 has specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., and single numbers within the range, such as 1, 2, 3, 4, 5, and 6, regardless of the range. Furthermore, whenever a numerical range is referred to herein, it means including any referenced number (fraction or integer) within the referred range.

[0020] In a first aspect, embodiments of the present invention provide *Cucumber Coccidioides*, the taxonomic name of which is *Cucumber Coccidioides* (…). Plectosphaerella cucumerina The strain number of the Cucumber Scale Bacterium is DTYP001, and the preservation number is CGMCC No. 42271.

[0021] Currently, root rot is a frequent and serious problem in Angelica sinensis cultivation, but the specific pathogen causing this disease is unclear, especially regarding Cucurbita cucumeroides. Plectosphaerella cucumerina There is a gap in our understanding of whether this pathogen is responsible for Angelica sinensis root rot. We lack systematic evidence for strain isolation and purification, morphological analysis, and precise identification at the gene level, which makes it impossible to conduct targeted research from the source of the pathogen and restricts the precision of disease control.

[0022] This application isolates a fungus, *Cyclocarya cucumeris*, from the root of *Angelica sinensis*, and identifies it as *Cyclocarya cucumeris* through morphological and molecular biological analysis. Plectosphaerella cucumerina The strain, identified as DTYP001, was identified as having the preservation number CGMCC No. 42271. The pathogen was confirmed to be *Cyclocarya cucumeroides* through a pathogen re-inoculation experiment—Koch's postulates. Plectosphaerella cucumerina DTYP001 is the pathogen causing root rot of Angelica sinensis (Cucumber spores). Plectosphaerella cucumerina )) attributes.

[0023] Current methods for diagnosing root rot in Angelica sinensis rely heavily on field symptom observation, which is highly subjective, inaccurate, and lacks standardized control strains and scientific testing techniques. This makes it difficult to achieve early, rapid, and accurate diagnosis of the disease, often resulting in misdiagnosis and missed diagnosis, delaying the best time for disease control and causing serious losses in yield and quality of Angelica sinensis.

[0024] The strain of this application (Cucumber Glomerella) Plectosphaerella cucumerinaDTYP001 was used as a reference standard in the identification of Angelica sinensis root rot disease. Ultimately, it provides a key technical solution to solve the problems of unclear identification of pathogens causing Angelica sinensis root rot, lack of diagnostic methods, and lack of basic support for prevention and control. It fills the research gap in this field and lays the core foundation for the scientific diagnosis and effective prevention and control of Angelica sinensis root rot.

[0025] This application is for Cucumber Scale ( Plectosphaerella cucumerina The strain, with accession number DTYP001, is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China, with accession number CGMCC No. 42271, deposited on October 10, 2025. The biological material (strain) is DTYP001, and its classification and name are *Cyclocarya cucumeroides*. Plectosphaerella cucumerina .

[0026] In some embodiments, the cucumber coccidioidomyces ( Plectosphaerella cucumerina The ITS sequence of DTYP001 is shown in the sequence list SEQ ID No:5.

[0027] Furthermore, SEQ ID No:5: CTTCCGTAGGGGGAACCTGCGGAGGGATCATTACTGAGTACTACACTCTCTACCCTTTGTGAACTATTATACCTGTTGCTTCGGCGGCGCCCGCGAGGGTGCCCGCCGGTCTCATCAGAATCTCTGTTTTCGAACCCGACGATACTTCTGAGTGTTCTTAGCGAACTGTCAAAACTTTTAACAACGGATCTCTTGGCTCCAGCATCGATGAAGAACGCAGCGAAACGCGATATGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATGGCGCCTTCCAGTATCCTGGGAGGCATGCCTGTCCGAGCGTCGTTTCAACCCTCGAGCCCCCGTGGCCCGGCGTTGGGGATCTGCCACGGCAGGCCCCTAAAACCAGTGGCGGACCCGAAGGCCCTCTCCTTTGCGCAGTAGCATCAGCCTCGCATTGGGATCCCTCGGCGTCCTGCCTCTAAACCCCCCACAAGTCCGCTCCGGCGGCACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAGCCGGAGGAA。

[0028] In some embodiments, the NL sequence of the Mycosphaerella melonis ( Plectosphaerella cucumerina ) DTYP001 is shown in SEQ ID No: 6 of the sequence listing: Furthermore, SEQ ID No: 6: AAAAGCGGAGGAAAAGAAACACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAGTTGTAATTTGCAGAGGATGCGTCGGGTACGGGTGCCTTCCGAGTTCCCTGGAAC GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTAGGACACCCAGCCCGTGTGACGCTCCCTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAACGGGAGGTATACTCCTTCCAAGGCTAAATACCGGCTGGAGACCGATAGCGCACAAGT AGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTCGCTACCAGACTTGGGTTCGGCGGTTCAACCGGGGCCACGCCCCGGGGCATTCCGCCGGCCCAGGCCAGCATCAGCT TTCCGTCGGGGGTAAAGGCGTCGGGAATGTGGCTCCCCTTCGGGGGAGTGTTATAGCCCGTCGTGTCATACCCTTCGGGGGGCTGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTAGCTAGTGACCCGTCTTGAACCACGGACCAT In some embodiments, the cucumber coccidioidomyces ( Plectosphaerella cucumerina DTYP001 comes from the roots of plants infected with root rot disease in Angelica sinensis.

[0029] Furthermore, root samples from Angelica sinensis plants infected with root rot were collected in 2024 from Gongzhuang Village, Basong Township, Kangle County, Linxia Hui Autonomous Prefecture, Gansu Province (35.2°N, 103.5°E).

[0030] It is understandable that the above-mentioned collection site is located in the transition zone between the Loess Plateau and the Qinghai-Tibet Plateau, with a diurnal temperature range of 10-15℃, annual rainfall of 500-600mm, large diurnal temperature range, and sufficient sunshine, which is suitable for the growth of Angelica sinensis. At the planting base, an investigation of diseases was conducted, and symptoms were described. Typical diseased plants were collected, and the morphology of the diseased plants was described as follows: brown, water-soaked lesions appeared on the stems; oval brown lesions appeared on the leaves; the leaves withered and turned yellow; the roots turned brown, rotted, and water-soaked, forming fibrous hollow shells (such as...). Figure 1 ); Collect diseased plants for pathogen isolation and purification.

[0031] Secondly, embodiments of the present invention provide the application of the aforementioned Cucumber Flocculation Mycorrhizum as a control in the identification of Angelica sinensis root rot disease.

[0032] In some embodiments, *Cyclocarya cucumeroides* is used as a control, and the concentration of its spore suspension is 4 × 10⁻⁶. 6 per mL.

[0033] Test case Diseased plant collection, isolation, purification, and identification Test materials Test culture medium: Potato dextrose agar medium (Beijing Solarbio Science & Technology Co., Ltd.); Test instruments: The main instruments include Nikon optical microscope, critical point dryer (Quorum, K850), ion sputtering instrument (hitachi, MC1000), and scanning electron microscope (hitachi, SU8100).

[0034] Diseased plant collection: Samples were collected in 2024 from Gongzhuang Village, Basong Township, Kanglu County, Linxia Hui Autonomous Prefecture, Gansu Province (35.2°N, 103.5°E). This area is located in the transition zone between the Loess Plateau and the Qinghai-Tibet Plateau, with a diurnal temperature range of 10-15°C and an annual rainfall of 500-600 mm. The large diurnal temperature range and abundant sunshine are suitable for the growth of Angelica sinensis. Disease was investigated at the planting base, and symptoms were described. Typical diseased plants were collected. The morphology of the diseased plants was described as follows: brown, water-soaked lesions on the stems; oval brown spots on the leaves; yellowing and withering of the leaves; brown, rotten, water-soaked roots forming fibrous hollow shells. Diseased plants were collected for pathogen isolation and purification. Figure 1 .

[0035] Pathogen isolation and purification Tissue isolation was employed. A 5 mm × 5 mm tissue block was excised from the boundary between diseased and healthy tissue. The lesion was disinfected with 70% alcohol, then rinsed three times with sterile distilled water. The block was then placed in PDA medium, with 2-4 blocks inoculated per dish, and incubated at 25°C. Healthy, uncontaminated colonies were selected. When the hyphae reached 2 cm in length, the hyphae at the colony edge were picked up with an inoculation hook and inoculated again into the center of a fresh PDA medium. This process of isolation and purification was repeated multiple times until the colonies grew uniformly and were free of contaminating bacteria.

[0036] A strain exhibiting typical growth was selected for subsequent experiments and designated DTYP001. The growth status of strain DTYP001 on PDA medium is shown below. Figure 2 As shown, colony morphology was observed, and conidial morphology was examined under a microscope. Subsequent experiments were then conducted.

[0037] When the DTYP001 strain was cultured on PDA medium for 7 days, the colonies were beige or light yellow with a dark pinkish-white center, large and dense fluffy hairs, moist surface, occasional radial wrinkles, and neat edges. The reverse side of the colony was light brown and the diameter was 43.5 mm.

[0038] Figure 2 In the diagram, 'a' represents the front of the colony, and 'b' represents the back of the colony.

[0039] Morphological and molecular biological identification of pathogens: Morphological identification Strains conforming to Koch's postulates were inoculated onto PDA medium. The purified fungal culture was scraped from the edge of the colony onto a clean glass slide using a sterile toothpick. A drop of distilled water was added, the hyphae were disturbed, and a coverslip was placed over the slide. The hyphae and spores were then observed under a microscope. Figure 4 .

[0040] Morphological identification results: spore size 6.3–24.3 μm × 1.4–3.3 μm (average 15.9 μm × 2.2 μm), conidia aggregated into heads, elliptical or oblong, narrow at both ends and wide in the middle, transparent, smooth surface, thin wall, 0–1 septa, with oil globules, size 4.0–8.9 μm × 2.0–4.0 μm, average 6.9 μm × 2.8 μm.

[0041] Molecular identification DNA extraction: Genomic DNA of pathogenic bacteria strain DTYP001 was extracted using the CTAB method.

[0042] PCR amplification: PCR amplification was performed using primers ITS1 / 4 and NL1 / 4, respectively. Primer sequences: ITS1 as shown in SEQ ID NO.1: TCCGTAGGTGAACCTGCGG; ITS4 as shown in SEQ ID NO.2: TCCTCGCTTATTGATATGC; NL1 as shown in SEQ ID NO.3: GCATATCAATAAGCGGAGGAAAAG; NL4 as shown in SEQ ID NO.4: GGTCCGTGTTTCAAGACGG.

[0043] Amplification system (50.0 μL): Genomic DNA (20 ng / μL), 1.0 μL 10× Buffer (containing 2.5 mM Mg2+) 2+5.0 μL, Taq polymerase (5 u / μL) 1.0 μL, dNTP (10 mM) 1.0 μL, ITS1 primer (10 uM) 1.5 μL, ITS4 primer (10 uM) 1.5 μL [or NL1 primer (10 uM) 1.5 μL, NL4 primer (10 uM) 1.5 μL], ddH2O 39.0 μL.

[0044] Reaction conditions: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 10 s, 60℃ annealing for 40 s, 72℃ extension for 1 min; 40 cycles; 72℃ final extension for 10 min; store at 4℃.

[0045] ITS Sequencing: The PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0046] NL sequence sequencing: The PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0047] Primer sequences: ITS1 is shown in SEQ ID NO.1; ITS4 is shown in SEQ ID NO.2; NL1 is shown in SEQ ID NO.3; NL4 is shown in SEQ ID NO.4.

[0048] It is understandable that primers ITS1 / 4 and NL1 / 4 are used for PCR amplification, and the amplification system and reaction conditions are the same for both.

[0049] Genomic DNA from strain DTYP001 was used as a template for PCR amplification and sequencing. The obtained ITS and NL gene sequences were aligned and analyzed on the NCBI BLAST platform (https: / / www.ncbi.nlm.nih.gov / ). Based on the alignment results, the ITS and NL sequences were trimmed and tandemly used with phylosuit. A phylogenetic tree was then constructed using Mega12, NJ method, and bootstrap with 1000 iterations.

[0050] A phylogenetic tree was constructed based on the comparison results, showing that the experimental strain DTYP001 is related to... Plectosphaerella cucumerina When they cluster together into one main branch, while simultaneously forming a separate offshoot, we define this as a new species and name it [name]. Plectosphaerella cucumerina DTYP001.

[0051] It is understandable that strain DTYP001 and Plectosphaerella cucumerina The fact that they cluster together as one branch while simultaneously forming a separate branch indicates that they are closely related and have significant genetic differences. Furthermore, this fungus has never been reported in Angelica sinensis root rot before, therefore it is defined as a new species.

[0052] Pathogenicity determination of pathogens: Pathogen reinoculation experiment (Koch's postulates) Koch's postulates were used to verify the inoculation of the strain in potted strawberry plants. Healthy Angelica sinensis plants with similar growth were selected for inoculation.

[0053] For potted Angelica sinensis plants, root irrigation after puncture wounds: Spores of pathogenic strain DTYP001 were washed away to prepare a suspension. 0.01% Tween 20 was added, and the mixture was gently shaken until the spores were evenly dispersed. The spore concentration was 4 × 10⁻⁶. 6 The number of plants per mL was determined. Young angelica seedlings were transplanted into a sterilized substrate. After 7 days of acclimatization, a sterilized scalpel was inserted into the soil near the plant to create micro-wounds at the root zone. Each angelica plant was then infused with 100 mL of a solution containing 4×10⁻⁶ cells / mL. 6 A conidial suspension of 1 conidia / mL was prepared, and each treatment was performed 3 times.

[0054] Root drenching experiments showed that approximately 21 days after root drenching, Angelica dahurica wilted. Dissection of the roots revealed lesions consistent with those observed in diseased plants in the field. Figure 3 The diseased tissue was isolated and purified, and the resulting strain had the same morphology as the inoculated strain. Based on Koch's postulates, strain DTYP001 was identified as the pathogen causing root rot of Angelica sinensis.

[0055] Figure 3 In Figures A and D, A shows a healthy Angelica sinensis plant and its root section; B shows a plant and its root section after inoculation with the pathogenic fungus Cucumber spores; C shows in vitro root culture in sterile water; and D shows in vitro root culture treated with Cucumber spore suspension. In Figures C and D, the white area represents the sterile cotton placed under the roots. Figure 3 No bacteria grew on the roots of C after treatment with sterile water, and the root system was healthy. Figure 3 As can be seen from Figure D, after treatment with the suspension of Cucumber spores, mycelium grew on the roots and decayed.

[0056] Scanning electron microscopy observation of sample preparation After pathogenicity testing, Angelica sinensis root samples were fixed in 4% glutaraldehyde solution (stored at 4℃) for 7 days. The samples were then rinsed three times with 0.1 mol / L pH 7.4 phosphate buffer for 15 min each time. Then, they were fixed in 1% osmium tetroxide solution prepared with 0.1 mol / L pH 7.4 phosphate buffer at room temperature in the dark for 1-2 h. Finally, they were rinsed three times again with 0.1 mol / L pH 7.4 phosphate buffer for 15 min each time. Leaf tissue samples, approximately 5 mm × 5 mm in size, one from each side, were cut and placed in 30%, 50%, 70%, 80%, 90%, 95%, 100%, and 100% (v / v) alcohol solutions for dehydration, with each gradient dehydration lasting 15 min. Finally, the samples were placed in isoamyl acetate for 15 min, and then dried in a critical point desiccator (Quorum, K850). After drying, the samples were adhered tightly to a conductive carbon film double-sided adhesive and placed on an ion sputtering stage (Hitachi, MC1000) for approximately 30 s of gold sputtering. The samples were observed using a field emission scanning electron microscope (Hitachi, SU8100) at 3.00 kV.

[0057] The results showed that the pathogenic fungus DTYP001 colonized the surface and interior of Angelica sinensis roots in multiple ways. Under low magnification (e.g., 500×), obvious structural damage to the root epidermis was observed, with mycelium invading the host tissue through epidermal fissures. Under medium to high magnification (1000×-5000×), the fungal hyphae were distributed in a network, forming a dense hyphal layer in some areas. The hyphae were approximately 2-5 μm in diameter, and fine ornamentation was visible on the surface. Under high magnification (20000×), the tight integration of the fungal specialized structures (such as appressoria) with the root cells was clearly visible, as well as the morphological response of the host cells after infection (including cell wall thickening and destruction of intercellular structures). Figure 6 .

[0058] The basic concepts have been described above. Obviously, for those skilled in the art, the detailed disclosure above is merely illustrative and does not constitute a limitation of this application. Although not explicitly stated herein, those skilled in the art may make various modifications, improvements, and corrections to this application. Such modifications, improvements, and corrections are suggested in this application, and therefore remain within the spirit and scope of the exemplary embodiments of this application.

[0059] Furthermore, this application uses specific terms to describe embodiments of the application. For example, "an embodiment," "one embodiment," and / or "some embodiments" refer to a particular feature, structure, or characteristic associated with at least one embodiment of the application. Therefore, it should be emphasized and noted that "an embodiment," "one embodiment," or "an alternative embodiment" mentioned twice or more in different locations in this specification do not necessarily refer to the same embodiment. In addition, certain features, structures, or characteristics in one or more embodiments of the application can be appropriately combined.

Claims

1. Cucumber-derived *Sphaerocarpus cucumeris*, characterized in that, The taxonomic name of the fungus *Calamus spp.* is *Calamus spp.* (also known as Cucumber spp.). Plectosphaerella cucumerina The strain number of the Cucumber Scale Bacterium is DTYP001, and the preservation number is CGMCC No. 42271.

2. The cucumber-growing coccidia according to claim 1, characterized in that, The cucumber coccidioidomycetes ( Plectosphaerella cucumerina The ITS sequence of DTYP001 is shown in the sequence list SEQ ID No:

5.

3. The cucumber-growing coccidia according to claim 1, characterized in that, The cucumber coccidioidomycetes ( Plectosphaerella cucumerina The NL sequence of DTYP001 is shown in SEQ ID No:

6.

4. The cucumber-growing coccidia according to claim 1, characterized in that, The cucumber coccidioidomycetes ( Plectosphaerella cucumerina DTYP001 comes from the roots of plants infected with root rot disease in Angelica sinensis.

5. The use of *Cucumis medullaris* as a reference standard according to any one of claims 1-4 in the identification of root rot disease in *Angelica sinensis*.

6. The application according to claim 5, characterized in that: Using *Sphaerocera cucumberensis* as a control, the concentration of its spore suspension was 4 × 10⁻⁶. 6 per mL.

Images