Cucumber seed specific promoter pSEP5 and application thereof

Abstract

The invention relates to a cucumber seed specific promoter pSEP5 and application thereof. The invention further discloses an expression vector pCAMBIA2300-enhance35S-pSEP5-DsRed2-d35S-eGFP containing a candidate promoter pSEP5, the expression vector is characterized in that restriction enzymes BamHI and EcoRI are used for carrying out linear treatment on a vector pCAMBIA2300-enhance35S-LTP2-DsRed2-d35S-eGFP, the vector pCAMBIA2300-enhance35S-LTP2-DsRed2-d35S-eGFP is used for constructing a vector pCAMBIA2300-enhance35S-pSEP5-DsRed2-d35S-eGFP with fragments pSEP5 and fragments DsRed2 through a homologous recombination method The invention also discloses application of the cucumber seed specific promoter pSEP5 in driving expression of a cucumber SPT system seed fluorescent module and in cucumber hybrid seed production.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological genetic engineering, and particularly relates to cloning and function verification of a cucumber (Cucumis sativus L.) male sterility system seed fluorescence element promoter. Cucumis sativus L. ) male sterility using an SPT system seed fluorescence element promoter pSEP5 . BACKGROUND

[0002] At present, hybrid seed production of cucumber relies on artificial pollination, and the seed production cost is high. Using male sterile lines as female parents can effectively reduce the seed production cost. Traditional recessive nuclear male sterile lines need to be used as half-maintenance lines to cross with male sterile lines as female parents to produce 50% fertile heterozygotes and 50% male sterile seeds. The two are difficult to distinguish at the seedling stage, and cannot be applied to large-scale seed production.

[0003] Seed production technology (SPT) constructs a transgenic maintenance line by transferring tightly linked fertility restoration elements, pollen lethal elements, seed fluorescence elements into recessive nuclear male sterile lines through genetic transformation method. The transgenic maintenance line as the male parent crosses with the male sterile line can produce 100% male sterile seeds, and the pollen lethal element avoids transgenic pollen escape, realizing safe and efficient breeding of recessive nuclear male sterile lines (Yongzhong Wu et al. Development of a novel recessive genetic male sterility system for hybrid seed production in maize and other cross-pollinating crops, 2016). The technology applied to hybrid seed production can greatly reduce the seed production cost, ensure the seed purity, realize the effective protection of parent variety rights, and has broad application prospect.

[0004] Currently, the application based on SPT technology is mainly concentrated in the grass crops such as corn (Yongzhong Wu et al. Development of a novel recessive genetic male sterility system for hybrid seed production in maize and other cross-pollinating crops, 2016), rice (Zhenyi Chang et al. Construction of a male sterility system for hybrid rice breeding and seed production using a nuclear male sterility gene, 2016), and there is no SPT breeding application report in cucumber. In 2012, Tianjin Keli Cucumber Research Institute first discovered a cucumber male sterile mutant controlled by a single recessive nuclear gene, and named it ms-3 (Yike Han et al. Fine mapping of a male sterility gene ms-3 in a novel cucumber ( Cucumis sativus L.)mutant, 2018), which provides the male sterile background material and fertility restoration element information for the establishment of cucumber SPT technology.

[0005] In the SPT transgenic maintainer line, the seed-specific promoter drives DsRed2 The gene specifically expresses red fluorescence in the seed, and the transgenic maintainer line seeds and male sterile line seeds in the selfed progeny of the transgenic maintainer line can be distinguished by the fluorescence signal, so as to realize the efficient breeding of the transgenic maintainer line. Therefore, the promoter driving the seed fluorescence marker element to specifically express in the seed is one of the key factors for the successful application of the SPT system. In the present application, the endogenous seed-specific driving promoter of cucumber is screened by using cucumber multi-tissue transcriptome analysis, and the seed-specific driving function of the promoter is verified. SUMMARY

[0006] The cucumber seed-specific promoter disclosed in the present application pSEP5 has seed driving specificity. The promoter can effectively drive DsRed2 the gene to specifically express red fluorescence in the seed tissue, and provides the seed fluorescence element promoter for the application of the SPT system for the utilization of cucumber male sterility.

[0007] To achieve the above object, the present application discloses the following technical contents: (1) By means of transcriptome analysis on each tissue sample of cucumber embryo, cucumber seed coat, tetrad, pollen at mature stage, true leaf, unpollinated ovary, root, stem, tendril, male flower tissue, etc., the cucumber seed-specific expression gene is screened and obtained, and the promoter thereof is cloned pSEP5 Sequence information.

[0008] (2) The cucumber seed-specific promoter pSEP5 is connected with the gene to construct a plant expression vector pCAMBIA2300- DsRed2 - enhancer35S - pSEP5-DsRed2-eGFP , the agrobacterium engineering bacteria GV3101 is transformed to perform inflorescence infection on Arabidopsis, and the activity of the cucumber seed-specific promoter pSEP5 driven expression is verified. DsRed2

[0009] (3) The cucumber seed candidate promoter pSEP5 is connected with GUS to construct a plant expression vector pCAMBIA1391- pSEP5-GUS , the agrobacterium engineering bacteria GV3101 is transformed to perform inflorescence infection on Arabidopsis, and the tissue specificity of the promoter is verified. pSEP5

[0010] The present application is realized by the following technical solutions: Firstly, the transcriptome analysis is performed on each tissue sample of cucumber embryo, cucumber seed coat, tetrad, pollen at mature stage, true leaf (SRR13277938, SRR13277937), unpollinated ovary (SRR11358252, SRR11358252), root (SRR1740416, SRR1740417), stem (SRR351905), tendril (SRR351910), and male flower (SRR3207663). The publicly disclosed transcriptome original data can be obtained by inputting the SRR number on the NCBI website (https: / / www.ncbi.nlm.nih.gov).

[0011] The pollen-specific expression candidate gene is screened by the following conditions: high expression (FPKM>20) in seeds and low expression (FPKM<1) in other tissues. And the cucumber seed-specific expression candidate gene CsaV4_2G003392 (sequence see http: / / www.cucumberdb.com / # / detail?search=CsaV4_2G003392) is finally screened out by the relative expression amount of the gene in each tissue, and the CsaV4_2G003392 promoter is cloned from the cucumber genomic DNA pSEP5 ​​the 2034 bp sequence (see SEQ ID NO: 1) and cloned from SPT vector (SPT vector sequence see patent: US8257930B2) DsRed2 gene sequence.

[0012] SEQ ID NO: 1 Secondly, the application constructs an expression vector pCAMBIA2300-enhancer35S-pSEP5-DsRed2-d35S-eGFP: the pCAMBIA2300-enhancer35S-LTP2-DsRed2-d35S-eGFP vector is linearized by using restriction endonuclease BamHI and EcoRI, and is combined with pSEP5 and DsRed2 fragments to construct the pCAMBIA2300-enhancer35S-pSEP5-DsRed2-d35S-eGFP vector by homologous recombination, and the engineering strain is obtained by transforming Agrobacterium GV3101 by heat shock method.

[0013] Thirdly, the pCAMBIA2300-enhancer35S-pSEP5-DsRed2-d35S-eGFP Agrobacterium engineering strain is used to stably genetically transform wild-type Arabidopsis, and it is found that the transgenic Arabidopsis plant does not show obvious difference in leaf morphology, rosette leaf number and the like compared with the wild-type plant. This shows that the pCAMBIA2300-enhancer35S-pSEP5-DsRed2-d35S-eGFP expression product does not cause significant influence on the vegetative growth of Arabidopsis.

[0014] Fourthly, the application constructs the pCAMBIA1391-pSEP5-GUS vector, and uses the Agrobacterium engineering strain containing pCAMBIA1391-pSEP5-GUS to infect Arabidopsis, and it is found that the pCAMBIA1391-pSEP5-GUS Arabidopsis only observes blue color representing GUS activity in seeds, and no obvious staining phenomenon is observed in other tissues including roots, stems, leaves, flowers and fruit pods, which shows that the pSEP5 promoter drives the GUS gene to be specifically expressed in seeds only, and belongs to a seed-specific promoter.

[0015] The application also discloses application of the cucumber seed-specific promoter pSEP5 in driving expression of a seed fluorescence module of a cucumber SPT system and in cucumber hybrid breeding.

[0016] The application mainly solves the problem of optimization of a cucumber SPT system seed fluorescence module element promoter, focuses on investigating seed tissue driving specificity of the cucumber seed-specific promoter pSEP5, and the main difficulty lies in verification of the seed-specific driving function of the pSEP5 promoter. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 Cucumber seed-specific expression geneCsaV4_2G003392 Transcriptome multi-tissue expression information: the relative expression of the gene in root, stem, tendril, pollen at starch accumulation stage, pollen at tetrad stage, fresh unfertilized ovary and the first leaf are shown in the figure respectively; Root: root; Stem: stem; Tetrad: tetrad; Pollen: pollen; Ovary: ovary; Tedril: tendril; Leaf: leaf; CsaV4_2G003392 The relative expression of the gene in root, stem, tendril, pollen at starch accumulation stage, pollen at tetrad stage, fresh unfertilized ovary and the first leaf are shown in the figure respectively; Root: root; Stem: stem; Tetrad: tetrad; Pollen: pollen; Ovary: ovary; Tedril: tendril; Leaf: leaf; Figure 2 Cucumber seed-specific expression gene CsaV4_2G003392 The relative expression of the gene in root, stem, tendril, pollen at starch accumulation stage, pollen at tetrad stage, fresh unfertilized ovary and the first leaf are shown in the figure respectively; Root: root; Stem: stem; Tetrad: tetrad; Pollen: pollen; Ovary: ovary; Tedril: tendril; Leaf: leaf; Figure 3 pCAMBIA2300- enhancer35S - pSEP5-DsRed2 -d35S- eGFP Phenotype results of T3 generation of transgenic Arabidopsis thaliana infected by Agrobacterium for two weeks: the left is the phenotype of wild type Arabidopsis thaliana; the right is the phenotype of transgenic Arabidopsis thaliana; Figure 4 GUS expression detection results of wild type Arabidopsis thaliana and pCAMBIA1391- pSEP5 - GUS transgenic Arabidopsis thaliana; wild type Arabidopsis thaliana has no GUS staining, and pCAMBIA1391- pSEP5 -GUS transgenic Arabidopsis thaliana has specific staining in seeds. DETAILED DESCRIPTION

[0018] The present application will be described in detail below through specific embodiments. Unless otherwise specified, the technical means used in the present application are methods known to those skilled in the art. In addition, the embodiments should be understood as illustrative, rather than limiting the scope of the present application, and the essence and scope of the present application are only limited by the claims. For those skilled in the art, various changes or modifications to the ingredients and amounts of the materials in these embodiments without departing from the essence and scope of the present application also fall within the protection scope of the present application. The raw materials and reagents used in the present application are commercially available. EXAMPLE

[0019] Eighteen cucumber pollen transcriptome samples were analyzed, and the process was as follows: (1) Transcriptome library construction and sequencing: Using the RNA samples of different tissues of cucumber to construct the transcriptome library, and performing transcriptome sequencing to obtain the transcriptome sequencing data information of each tissue, removing low-quality bases and adapter sequences to obtain high-quality clean reads; (2) HISAT2 (http: / / www.ccb.jhu.edu / software / hisat) was used to align the clean reads to the cucumber reference genome 9930 V4 (http: / / www.cucumberdb.com / # / download); then the transcript quantification analysis was performed based on the RSEM analysis process, and the gene expression profile data was obtained by FPKM standardization processing to screen the candidate seed-specific expression genes CsaV4_2G003392 Figure 1 , and the corresponding candidate promoter was named pSEP5 . qRT-PCR was used to analyze the relative tissue expression amount of the cucumber candidate seed-specific expression gene CsaV4_2G003392 . Figure 2 . Embodiment

[0020] An expression vector pCAMBIA2300- pSEP5 containing the candidate promoter enhancer35S was constructed pSEP5 DsRed2 -d35S- eGFP , including the following steps: 1. Constructing pCAMBIA2300- d35S-eGFP basic vector The sequence NOS-d35S-eGFP-NOS (see Appendix 1 for sequence information) was artificially synthesized. The fragment was amplified by PCR with primers with homologous arms, and the PCR product was subjected to agarose gel electrophoresis and gel recovery. The amplification primers are: F1: CCTCTAGAGTCGACCTGCAGGATGACCATGATTACGATCGC R1: AAACACTGATAGTTTAAACAAGCCTCTCTAACCATCTGTG ​​1 mL of E. coli containing pCAMBIA2300 plasmid was inoculated into 20 mL of liquid LB medium containing 50 μg / mL kanamycin, cultured at 37°C, 200 rpm overnight, and the plasmid was extracted using AxyPrep™ Plasmid Miniprep Kit. The pCAMBIA2300 plasmid was double-digested using Sbf I and Pme I restriction endonucleases, and the linearized vector pCAMBIA2300 was subjected to agarose gel electrophoresis and gel recovery; The gel-recovered NOS-d35S-eGFP-NOS The target fragment was subjected to homologous recombination with the linearized pCAMBIA2300 vector. The reaction conditions were 50°C for 15 min, and then placed on ice. The ligation product pCAMBIA2300- d35S-eGFP The E. coli competent DH5α was transformed, and the methods and steps were performed according to the instructions of the E. coli DH5α Chemically Competent Cell. After plating, the pCAMBIA2300- eGFP Positive colonies were subjected to PCR verification (PCR product 619 bp), and the PCR primers were: F2: AGAGGACAATGGTGAGCAAG R2: GTGCTCAGGTAGTGGTTGT After the PCR verification, the single colonies were subjected to sanger sequencing verification to ensure that the sequence of the constructed vector was correct.

[0021] 2. Construction of pCAMBIA2300- enhancer35s-LTP2-DsRed2-d35S-eGFP Intermediate vector The SPT vector was used as a template, and the PrimeSTAR Max DNA Polymerase high-fidelity enzyme was used to amplify the DsRed2 fragment, and the PCR product was subjected to agarose gel electrophoresis and gel recovery. The amplification primers were: F3: GGAATTCCGGATGGCCTCCTCCGAGAAC R3: CAGGTCGACTCTAGAGGATCTACAGGAACAGGTGGTGGC The pCAMBIA2300- d35S-eGFP vector homologous arm primers were used to amplify 35Senhancer- LTP2 promoter the fragment, and the PCR product was subjected to agarose gel electrophoresis and gel recovery. The amplification primers were: F4: CTATGACATGATTACGAATTGTCAACATGGTGGAGCACG R4: AGGAGGCCATCCGGAATTCCGTACTCGG Using restriction endonucleases BamHI and EcoRI to target pCAMBIA2300- d35S-eGFP The plasmid was linearized by double enzyme digestion, and the linearized pCAMBIA2300- d35S-eGFP The carrier product was subjected to agarose gel electrophoresis and then recovered from the gel. Using the TaRaKa 5×In-fusion Snap Assembly Master Mix Seamless Cloning Kit, for DsRed2 Fragments 35Senhancer-LTP2 promoter Fragment, linearized vector pCAMBIA2300- d35S-eGFP Homologous recombination was performed under the following conditions: 50°C for 15 min, followed by placement on ice to obtain the recombinant vector-ligated product pCAMBIA2300-. enhancer35s-LTP2-DsRed2-d35S-eGFP The vector was used to transform the above ligation product into competent E. coli DH5α cells. After plating, pCAMBIA2300- enhancer35s-LTP2-DsRed2-d35S-eGFP Positive colonies were validated by PCR (PCR product was 995 bp). The PCR primers were: F5: CGTAACAAGAGACGGAAACATC R5: ATGGTGTAGTCCTCGTTGTG After PCR verification, single colonies are then subjected to Sanger sequencing to ensure the correctness of the constructed vector sequence.

[0022] 3. Construct pCAMBIA2300- enhancer35s-pSEP5-DsRed2-d35S-eGFP Final carrier Using cucumber leaf genomic DNA as a template, amplification of cucumber seed-specific promoters was performed. pSEP5 The sequence and amplification primers are: F6: GATGTGATCGGGATCGTCAACCTTGTAAACAGAGAAAT R6: AGGCCATCCGGAATTAATCTCTTCCACCCACAC The PCR amplification products were subjected to agarose gel electrophoresis and gel recovery.

[0023] Using restriction endonucleases BamHI and EcoRI to target pCAMBIA2300- enhancer35s-LTP2-DsRed2- d35S-eGFP The vector plasmid was linearized by double enzyme digestion, and the linearized pCAMBIA2300- enhancer35s-LTP2-DsRed2-d35S-eGFP The vector product was subjected to agarose gel electrophoresis and gel recovery.

[0024] The TaRaKa 5x In-fusion Snap Assembly Master Mix Seamless Cloning Kit was used to perform homologous recombination between the pSEP5 fragment and the pCAMBIA2300- enhancer35s-LTP2-DsRed2-d35S-eGFP The linearized vector was subjected to a homologous recombination reaction. The reaction conditions for the homologous recombination reaction were the same as above. The ligation product pCAMBIA2300- enhancer35s-pSEP5- DsRed2-d35S-eGFP The E. coli competent DH5a was transformed, and LB plates containing kanamycin were coated. After overnight culture, positive colonies were picked for colony PCR detection, and the primers were F6 and R6 (PCR product: 2064 bp). The single colony with correct Sanger sequencing was used to extract the recombinant plasmid, which was then transformed into Agrobacterium GV3101, according to the instructions for the Chemically Competent Cell of Agrobacterium GV3101. Example

[0025] A pCAMBIA1391- pSEP5 vector containing a promoter was constructed, including the following steps: pSEP5 GUS The vector plasmid pCAMBIA2300- was used as a template to amplify the promoter fragment enhancer35s-pSEP5-DsRed2-d35S-eGFP , and agarose gel electrophoresis and gel recovery were performed. The amplification primers were: pSEP5 F7: GCAGGTCGACGGATCGGATCCGTCAACCTTGTAAACAGAGAAAT R7: ACTCCTCTTAGAATTGAATTCAATCTCTTCCACCCACACTC The pCAMBIA1391 vector was double-digested with BamH I and R I restriction endonucleases, and the linearized vector pCAMBIA1391 was obtained by agarose electrophoresis and gel recovery of the digestion product. The Eco fragment and the linearized pCAMBIA1391 vector were subjected to homologous recombination by using the TaRaKa 5x In-fusion Snap Assembly Master Mix Seamless Cloning Kit, and the ligation product pCAMBIA1391- pSEP5 was obtained. pSEP5 GUS The E. coli DH5a was transformed, and the plates were coated and incubated overnight. Positive colonies were picked for colony PCR detection and Sanger sequencing. The PCR verification primers were (PCR product: 1313 bp):​​ F7: TTATGCGGGCAACGTCTG R7: TCGGCTGATGCAGTTTCTC The pCAMBIA1391-35S-AtCYP71D4-ocs-3'UTR recombinant plasmid was sequenced correctly and transformed into Agrobacterium GV3101 by heat shock method. pSEP5 GUS Example

[0026] The pCAMBIA2300-35S-AtCYP71D4-ocs-3'UTR recombinant plasmid was sequenced correctly and transformed into Agrobacterium GV3101 by heat shock method. enhancer35s-pSEP5-DsRed2-d35S-eGFP Agrobacterium containing the recombinant plasmid pCAMBIA2300-enhancer35S-AtCYP71D4-ocs-3'UTR was expanded in culture, and then used to infect Col-0 wild-type Arabidopsis plants by the flower-dipping method. The harvested seeds were recorded as T1 generation. After two generations of continuous selfing, T3 generation seeds were obtained. The T3 generation Arabidopsis seeds were placed in 1 / 2 MS medium containing 50 mg / L kanamycin for screening. The obtained positive seedlings were transplanted into nutrient soil for greenhouse culture. After two weeks of growth, the phenotype of the seedlings was observed. pSEP5 DsRed2 eGFP Agrobacterium containing the recombinant plasmid pCAMBIA2300-enhancer35S-AtCYP71D4-ocs-3'UTR was expanded in culture, and then used to infect Col-0 wild-type Arabidopsis plants by the flower-dipping method. The harvested seeds were recorded as T1 generation. After two generations of continuous selfing, T3 generation seeds were obtained. The T3 generation Arabidopsis seeds were placed in 1 / 2 MS medium containing 50 mg / L kanamycin for screening. The obtained positive seedlings were transplanted into nutrient soil for greenhouse culture. After two weeks of growth, the phenotype of the seedlings was observed. Example

[0027] Agrobacterium containing the recombinant plasmid pCAMBIA1391-35S-AtCYP71D4-ocs-3'UTR was expanded in culture, and then used to infect Col-0 wild-type Arabidopsis plants by the flower-dipping method. The harvested seeds were recorded as T1 generation. pSEP5 GUS Agrobacterium containing the recombinant plasmid pCAMBIA1391-35S-AtCYP71D4-ocs-3'UTR was expanded in culture, and then used to infect Col-0 wild-type Arabidopsis plants by the flower-dipping method. The harvested seeds were recorded as T1 generation. The leaves, flowers, roots, stems, and silique of wild-type and transgenic T1 generation Arabidopsis were placed in 1.5 mL centrifuge tubes. 1 mL of pre-prepared GUS staining working solution was added to the samples to completely infiltrate them, and they were incubated in a 37°C incubator for 24 h. 1 mL of decolorizing solution (anhydrous ethanol and glacial acetic acid mixed at a ratio of 7:3) was added to each sample tube, and the samples were soaked for 3 h to remove chlorophyll. 1 mL of decolorizing solution (anhydrous ethanol: glacial acetic acid = 7:3) was added to each tube, and the samples were soaked for 3 h to remove chlorophyll. The GUS-stained materials were observed by the naked eye or under a microscope and photographed. pSEP5 GUS Agrobacterium containing the recombinant plasmid pCAMBIA1391-35S-AtCYP71D4-ocs-3'UTR was expanded in culture, and then used to infect Col-0 wild-type Arabidopsis plants by the flower-dipping method. The harvested seeds were recorded as T1 generation. The leaves, flowers, roots, stems, and silique of wild-type and transgenic T1 generation Arabidopsis were placed in 1.5 mL centrifuge tubes. 1 mL of pre-prepared GUS staining working solution was added to the samples to completely infiltrate them, and they were incubated in a 37°C incubator for 24 h. 1 mL of decolorizing solution (anhydrous ethanol and glacial acetic acid mixed at a ratio of 7:3) was added to each sample tube, and the samples were soaked for 3 h to remove chlorophyll. 1 mL of decolorizing solution (anhydrous ethanol: glacial acetic acid = 7:3) was added to each tube, and the samples were soaked for 3 h to remove chlorophyll. The GUS-stained materials were observed by the naked eye or under a microscope and photographed. Figure 4

[0028] Through cucumber tissue transcription expression analysis and qRT-PCR result analysis, it was shown that the seed-specific expression candidate gene CsaV4_2G00339 had significantly higher expression in seeds than in other tissues in cucumber Figure 1-Figure 2 ​​​​​​​​​). The candidate promoters were analyzed by GUS histochemical staining results pSEP5 In Arabidopsis, the seed tissue driving specificity ( Figure 4 ), indicating the feasibility of using cucumber seed-specific promoters pSEP5 to drive the expression of the seed fluorescence module of the cucumber SPT system.

Claims

1. A cucumber seed-specific promoter pSEP5, having the base sequence shown in SEQ ID NO:

1.

2. A seed-specific promoter pSEP5 The expression vector pCAMBIA2300- enhancer35S - pSEP5 - DsRed2 -d35S- eGFP Its features are: Using restriction endonucleases BamHI and EcoRI to target pCAMBIA2300- enhancer35S - LTP2-DsRed2 -d35S- eGFP The carrier is linearized and then compared with... pSEP5 and DsRed2 The fragment was constructed using homologous recombination to create pCAMBIA2300- enhancer35S - pSEP5-DsRed2 -d35S- eGFP The vector was used to transform Agrobacterium GV3101 via heat shock.

3. A pCAMBIA1391-pSEP5-GUS vector containing a pSEP5 promoter, characterized in that... Arabidopsis thaliana was infected with the GV3101 Agrobacterium engineered strain containing pCAMBIA1391-pSEP5-GUS. The pSEP5 promoter drives the GUS gene to be specifically expressed only in seeds, which is a seed-specific promoter.

4. The application of the cucumber seed-specific promoter pSEP5 as described in claim 1 in driving the expression of the cucumber SPT system seed fluorescence module and its application in cucumber hybrid seed production.

Images